The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009600	Bacillus thuringiensis strain HD571 chromosome, complete genome	5256240	410212	417418	5256240		Geobacillus_phage(33.33%)	9	NA	NA
WP_001065246.1|410212_411580_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	9.6e-20
WP_000720567.1|412017_412536_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.3	9.5e-45
WP_001093444.1|412745_413132_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_000655496.1|413197_413905_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	1.0e-17
WP_000994639.1|413926_414280_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000288934.1|414293_414698_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000714651.1|414945_416331_+	MBL fold metallo-hydrolase	NA	Q0H255	Geobacillus_phage	59.5	1.1e-76
WP_000820167.1|416333_416546_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	54.4	7.3e-12
WP_000540634.1|416611_417418_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	69.7	6.5e-109
>prophage 2
NZ_CP009600	Bacillus thuringiensis strain HD571 chromosome, complete genome	5256240	1951025	2012101	5256240	protease,bacteriocin,integrase,tRNA,coat	Bacillus_phage(33.33%)	53	1969471:1969490	2005481:2005500
WP_000125362.1|1951025_1952165_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.1	2.5e-82
WP_000354030.1|1952177_1953230_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|1953249_1953450_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344460.1|1953446_1954448_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.2	1.2e-08
WP_000464508.1|1954453_1955071_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823597.1|1955259_1956204_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871185.1|1956216_1956747_-	BofC protein	NA	NA	NA	NA	NA
WP_001079930.1|1956867_1957797_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000426920.1|1957864_1958185_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000721241.1|1958630_1959065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093533.1|1959098_1959743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000690816.1|1959921_1961769_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_000025291.1|1962143_1963250_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092246.1|1963280_1964114_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138561.1|1964133_1965663_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973794.1|1965815_1966955_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	28.9	7.7e-31
WP_000812272.1|1966957_1967500_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000510428.1|1967581_1968229_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621721.1|1968310_1969162_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001026353.1|1969258_1971175_-	ABC transporter permease	NA	NA	NA	NA	NA
1969471:1969490	attL	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
WP_001011372.1|1971224_1973147_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114531.1|1973121_1973898_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.2e-19
WP_000865391.1|1973991_1975074_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000276720.1|1975063_1975771_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000496111.1|1975910_1977197_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001037006.1|1977196_1977745_-	sporulation protein	NA	NA	NA	NA	NA
WP_000944957.1|1977808_1978099_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001973720.1|1978102_1978447_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|1978458_1978767_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_000855457.1|1978936_1980325_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599073.1|1980392_1981253_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797461.1|1981245_1981992_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503310.1|1982125_1982923_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391517.1|1982925_1983612_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975753.1|1983647_1984193_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135493.1|1984207_1985059_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466737.1|1985100_1986120_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_000366809.1|1986554_1987976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907107.1|1987935_1990977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000913003.1|1991006_1992770_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001087615.1|1992756_1993509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000081956.1|1995065_1996433_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000051680.1|1996460_1998653_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.7	6.9e-44
WP_000849670.1|1998862_1999039_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001089676.1|1999061_1999268_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_001212906.1|2000176_2001298_+	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000682196.1|2001704_2003006_-	collagen-like protein	NA	NA	NA	NA	NA
WP_001013372.1|2004041_2004668_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001226277.1|2004714_2005290_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000360976.1|2005511_2006474_-	hypothetical protein	NA	NA	NA	NA	NA
2005481:2005500	attR	ATACTTCTTCCTTCGTCATT	NA	NA	NA	NA
WP_000582048.1|2006639_2007941_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072246.1|2008034_2010680_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.9	8.0e-164
WP_000366997.1|2011075_2012101_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
>prophage 3
NZ_CP009600	Bacillus thuringiensis strain HD571 chromosome, complete genome	5256240	3321853	3330230	5256240		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625683.1|3321853_3323161_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170542.1|3323249_3323969_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278823.1|3323961_3324216_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666777.1|3324212_3324896_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|3324879_3327099_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|3327083_3328499_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262436.1|3328605_3329646_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000088592.1|3329642_3330230_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
>prophage 4
NZ_CP009600	Bacillus thuringiensis strain HD571 chromosome, complete genome	5256240	4878867	4888186	5256240		Bacillus_phage(71.43%)	9	NA	NA
WP_000755546.1|4878867_4880130_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_001194301.1|4880228_4880993_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453763.1|4881233_4882994_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.9	4.4e-267
WP_000254054.1|4883073_4883760_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.9	1.3e-118
WP_001231497.1|4883756_4884830_+	membrane protein	NA	W8CYF6	Bacillus_phage	87.4	1.2e-169
WP_000823554.1|4884854_4885442_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|4885638_4886358_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000103838.1|4886507_4887179_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	86.9	6.5e-62
WP_001258513.1|4887313_4888186_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	2.7e-68
>prophage 1
NZ_CP009599	Bacillus thuringiensis strain HD571 plasmid pBFQ, complete sequence	55939	0	18116	55939	tail,plate	Bacillus_phage(38.46%)	23	NA	NA
WP_001131834.1|861_1044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001128458.1|1049_1439_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.8	3.2e-21
WP_000056960.1|1438_1831_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_000168162.1|1815_2307_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	50.9	1.1e-39
WP_000273213.1|2309_2711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852141.1|2725_3190_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_001210040.1|3255_3672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229383.1|3749_4010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235292.1|4025_6752_+	hypothetical protein	NA	B5LPS3	Bacillus_virus	46.4	9.4e-75
WP_000383069.1|6751_7633_+|tail	phage tail family protein	tail	A0A2P1JTW0	Anoxybacillus_phage	47.6	1.7e-73
WP_000289463.1|7644_9492_+	hypothetical protein	NA	A0A2P1JTV8	Anoxybacillus_phage	44.2	2.9e-128
WP_000222205.1|9501_9768_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042329765.1|9828_11418_+|plate	BppU family phage baseplate upper protein	plate	D2XPZ7	Bacillus_virus	41.4	2.9e-76
WP_001152008.1|11432_12101_+	hypothetical protein	NA	A0A2H4J9X9	uncultured_Caudovirales_phage	74.8	7.9e-52
WP_000151216.1|12142_12424_+	hypothetical protein	NA	D2XR31	Bacillus_phage	84.9	4.8e-35
WP_001131587.1|12426_12651_+	hypothetical protein	NA	A0A1B2APX7	Phage_Wrath	79.4	5.2e-24
WP_001266380.1|12650_13412_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	84.2	1.3e-122
WP_001173690.1|13608_13962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249931.1|13974_14883_-	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	41.9	4.3e-16
WP_001057807.1|15052_15394_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000272608.1|15390_16656_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.6	1.7e-108
WP_000473803.1|17151_17415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128985.1|17525_18116_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	35.7	2.3e-10
>prophage 2
NZ_CP009599	Bacillus thuringiensis strain HD571 plasmid pBFQ, complete sequence	55939	22077	22899	55939		Enterococcus_phage(100.0%)	1	NA	NA
WP_001018643.1|22077_22899_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	43.8	1.3e-51
>prophage 3
NZ_CP009599	Bacillus thuringiensis strain HD571 plasmid pBFQ, complete sequence	55939	29001	55851	55939	portal,terminase	Bacillus_phage(66.67%)	37	NA	NA
WP_000451516.1|29001_29565_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	50.0	1.6e-37
WP_000831284.1|29699_30044_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.7	2.0e-43
WP_000448836.1|30063_30768_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	90.4	2.7e-58
WP_000859163.1|30972_31320_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.3	8.3e-21
WP_001189353.1|31816_32965_+	hypothetical protein	NA	A0A0S2MVK2	Bacillus_phage	33.8	1.8e-51
WP_000721629.1|33004_33154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578778.1|33474_33825_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	49.6	6.9e-23
WP_080011779.1|33956_34178_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	50.0	7.4e-07
WP_001006520.1|34217_34988_+	phage antirepressor Ant	NA	A0A2H4PQV4	Staphylococcus_phage	45.1	4.2e-57
WP_000780697.1|35607_36090_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	51.2	9.4e-39
WP_001043060.1|36086_36761_+	ERF family protein	NA	A0A0M3ULL1	Bacillus_phage	57.9	2.5e-61
WP_000487938.1|36960_37182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073890.1|37182_37998_+	replication protein	NA	A0A1W6JP67	Staphylococcus_phage	54.5	1.4e-58
WP_041184387.1|37948_38830_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	55.2	1.9e-85
WP_000332351.1|38842_39106_+	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	70.7	3.8e-18
WP_042329751.1|39062_39308_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	89.7	1.3e-31
WP_000811957.1|39304_39568_+	hypothetical protein	NA	A0A1B1P7U6	Bacillus_phage	64.4	7.2e-25
WP_000219525.1|39579_40293_+	hypothetical protein	NA	B5LPM7	Bacillus_virus	51.4	4.1e-38
WP_000434347.1|40301_40442_+	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	93.5	3.8e-17
WP_000201869.1|40744_41026_+	hypothetical protein	NA	M4W5X4	Bacillus_phage	56.3	1.1e-15
WP_000932236.1|41217_41715_+	hypothetical protein	NA	S6AVW3	Thermus_phage	31.1	1.0e-16
WP_011731650.1|41752_41962_+	hypothetical protein	NA	I1TLG8	Bacillus_phage	95.7	2.0e-33
WP_000455713.1|42002_42602_+	hypothetical protein	NA	A0A0S2SXN5	Bacillus_phage	45.6	1.9e-44
WP_000784801.1|43998_44196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292053.1|44198_44387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114345.1|44411_44591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529718.1|44593_45223_+	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.8	5.9e-49
WP_042329745.1|45360_45747_+	ArpU family transcriptional regulator	NA	D2XQ27	Bacillus_virus	97.7	7.5e-63
WP_000432046.1|46822_47149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000393224.1|47237_47468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000583549.1|47970_48555_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	47.2	6.5e-26
WP_000504255.1|48567_49392_+	GIY-YIG nuclease family protein	NA	D2XPX7	Bacillus_virus	60.6	1.2e-73
WP_000113786.1|49948_50878_+	hypothetical protein	NA	A0A0S2MVB6	Bacillus_phage	91.1	8.2e-132
WP_042513780.1|50849_52166_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	71.0	2.5e-182
WP_000182666.1|52165_53704_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	38.6	1.3e-94
WP_001169137.1|53690_54617_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	35.3	4.5e-45
WP_000746379.1|54663_55851_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	46.5	2.8e-76
