The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009590	Bacillus cereus G9241 chromosome, complete genome	5267792	556844	571201	5267792		Bacillus_phage(60.0%)	14	NA	NA
WP_001258498.1|556844_557717_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	42.9	4.0e-64
WP_002194884.1|557849_558521_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	90.5	2.6e-63
WP_000818985.1|558668_559388_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001979959.1|559881_560799_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.1	1.4e-43
WP_001979957.1|560795_561548_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001979955.1|561560_562292_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001979953.1|562314_562665_+	YxeA family protein	NA	NA	NA	NA	NA
WP_001979951.1|563015_563729_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.9	1.2e-37
WP_001979949.1|563729_565142_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.2	7.1e-10
WP_033691618.1|565220_566309_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	89.8	2.5e-172
WP_139254152.1|566305_567010_-	response regulator	NA	W8CYM9	Bacillus_phage	92.7	6.5e-121
WP_033691617.1|567071_568832_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	96.7	2.1e-269
WP_033691616.1|569071_569836_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033691615.1|569932_571201_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	7.6e-11
>prophage 2
NZ_CP009590	Bacillus cereus G9241 chromosome, complete genome	5267792	2161048	2169421	5267792		Synechococcus_phage(50.0%)	8	NA	NA
WP_001979846.1|2161048_2161636_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	7.7e-27
WP_001262445.1|2161632_2162673_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	3.2e-68
WP_000879025.1|2162775_2164191_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055574.1|2164175_2166395_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.3	4.4e-163
WP_001979839.1|2166378_2167062_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278820.1|2167058_2167313_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170542.1|2167305_2168025_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000625683.1|2168113_2169421_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
>prophage 3
NZ_CP009590	Bacillus cereus G9241 chromosome, complete genome	5267792	2205176	2213125	5267792		Bacillus_phage(33.33%)	6	NA	NA
WP_033692601.1|2205176_2206682_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.1	4.1e-32
WP_001975561.1|2206665_2207367_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	9.5e-40
WP_000833097.1|2207512_2208838_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	9.2e-44
WP_162837124.1|2209221_2210763_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	3.4e-21
WP_001975554.1|2211167_2212802_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	4.5e-157
WP_000917306.1|2212840_2213125_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
>prophage 4
NZ_CP009590	Bacillus cereus G9241 chromosome, complete genome	5267792	3374708	3382389	5267792		uncultured_Caudovirales_phage(16.67%)	10	NA	NA
WP_033691318.1|3374708_3375692_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.2	2.1e-16
WP_000403735.1|3375681_3376452_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.1	2.2e-13
WP_033691316.1|3376484_3377249_+	class B sortase	NA	NA	NA	NA	NA
WP_000587814.1|3377314_3377638_-	heme oxygenase	NA	NA	NA	NA	NA
WP_001255958.1|3377934_3379134_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	6.1e-71
WP_033691314.1|3379173_3379368_-	YwbE family protein	NA	NA	NA	NA	NA
WP_001293578.1|3379368_3379542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033691311.1|3379710_3380403_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_033691309.1|3380404_3381340_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.9	8.6e-12
WP_033691307.1|3381465_3382389_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	6.9e-46
>prophage 5
NZ_CP009590	Bacillus cereus G9241 chromosome, complete genome	5267792	5118946	5128123	5267792		Geobacillus_phage(25.0%)	11	NA	NA
WP_000540642.1|5118946_5119753_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	68.9	2.1e-107
WP_001981065.1|5119770_5119983_-	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	52.9	1.9e-12
WP_001981062.1|5119985_5121371_-	S-layer homology domain-containing protein	NA	Q0H255	Geobacillus_phage	59.9	6.0e-78
WP_001981059.1|5121801_5122218_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000648514.1|5122220_5122574_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_033691753.1|5122595_5123303_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	27.0	6.7e-17
WP_002194813.1|5123368_5123755_+	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
WP_002194812.1|5123776_5124280_+	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	46.1	2.5e-42
WP_002194811.1|5124426_5125107_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	38.2	3.0e-30
WP_033691752.1|5125192_5126386_+	glycosyl transferase family 1	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	26.2	3.1e-06
WP_002194809.1|5126755_5128123_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.1	4.3e-20
>prophage 1
NZ_CP009591	Bacillus cereus G9241 plasmid pBC210, complete sequence	209255	103035	133885	209255	protease,integrase,transposase	Bacillus_phage(28.57%)	35	111992:112007	132290:132305
WP_001053948.1|103035_104472_+|transposase	IS4-like element IS231R family transposase	transposase	NA	NA	NA	NA
WP_001971802.1|104684_105035_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001971804.1|105123_105318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001971806.1|105443_105617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001971807.1|105744_106425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050412754.1|106874_107075_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001971811.1|107043_107427_-	DUF3796 domain-containing protein	NA	NA	NA	NA	NA
WP_001971814.1|107856_108339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001971817.1|108417_108939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038356958.1|109029_109515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001971825.1|109826_110576_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_038356959.1|110789_111110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001971827.1|111106_111469_-	hypothetical protein	NA	NA	NA	NA	NA
111992:112007	attL	TAAAAAAATATATTGA	NA	NA	NA	NA
WP_001971829.1|112033_112564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001971831.1|112607_112964_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	53.8	7.2e-28
WP_000462739.1|113063_113537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001971839.1|113538_114069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001971841.1|114130_114304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001971844.1|114668_115268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158319034.1|115783_115915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158319033.1|115883_116081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038356961.1|116342_116912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001971852.1|117687_117972_+	hypothetical protein	NA	A0A2H4J841	uncultured_Caudovirales_phage	81.6	2.7e-09
WP_040119926.1|118057_119065_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001971857.1|119463_120636_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	4.0e-06
WP_001025757.1|120975_121194_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	66.2	2.1e-17
WP_033692168.1|121714_124693_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	44.2	4.7e-253
WP_001971434.1|124832_125414_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.7	1.4e-28
WP_001973432.1|125754_126822_+	spore germination protein GerXB	NA	NA	NA	NA	NA
WP_001971436.1|126865_128344_+	spore germination protein GerXA	NA	NA	NA	NA	NA
WP_001978048.1|128330_129500_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_158319032.1|131303_131444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001971446.1|131943_132531_+	hypothetical protein	NA	NA	NA	NA	NA
132290:132305	attR	TAAAAAAATATATTGA	NA	NA	NA	NA
WP_078030537.1|133396_133573_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_078030536.1|133573_133885_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	50.5	2.3e-22
>prophage 1
NZ_CP009592	Bacillus cereus G9241 plasmid pBCX01, complete sequence	190860	25229	102601	190860	protease,transposase,integrase	Bacillus_phage(60.0%)	59	56657:56677	101613:101633
WP_001098036.1|25229_26165_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000502634.1|26251_26521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169888.1|26778_26964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025986961.1|27080_27500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233519.1|27566_27917_+	PrgI family protein	NA	NA	NA	NA	NA
WP_000891997.1|27917_28832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001977984.1|28834_30934_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_001977986.1|30964_34981_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001977989.1|34977_37182_+	lysozyme family protein	NA	A7KUS1	Bacillus_phage	39.1	1.8e-15
WP_000720694.1|37198_37774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001242516.1|37931_38315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003159747.1|38305_38611_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_000678363.1|38740_39028_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	72.6	1.4e-34
WP_000094350.1|39151_39835_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001186855.1|40292_41438_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000725577.1|41477_41960_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_042442017.1|42840_43227_-	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_001066877.1|43739_44765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012680378.1|46289_48311_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000481542.1|48522_49365_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_073806349.1|49484_49607_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000034640.1|49629_49857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033691404.1|50715_51999_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000702222.1|52041_52929_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	53.3	9.1e-80
WP_001027044.1|52955_54287_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.1	4.7e-88
56657:56677	attL	AGGTGTTTTTTTCATGTACCA	NA	NA	NA	NA
WP_001978028.1|57118_57376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000601747.1|57669_58272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704427.1|58368_58824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000055896.1|59651_60029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578140.1|60158_60611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197746.1|62088_64491_+	anthrax toxin edema factor	NA	NA	NA	NA	NA
WP_000957312.1|67245_68673_-	anthrax toxin expression trans-acting transcriptional regulator AtxA	NA	NA	NA	NA	NA
WP_000388434.1|69031_69484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000415716.1|69639_70146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787061.1|71395_71602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033692168.1|72609_75588_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	44.2	4.7e-253
WP_001971434.1|75727_76309_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.7	1.4e-28
WP_001973432.1|76649_77717_+	spore germination protein GerXB	NA	NA	NA	NA	NA
WP_001971436.1|77760_79239_+	spore germination protein GerXA	NA	NA	NA	NA	NA
WP_001978048.1|79225_80395_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_000444608.1|81815_82493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000746484.1|83267_85562_+	anthrax toxin protective antigen	NA	A0A1V0E026	Clostridioides_phage	33.5	1.8e-74
WP_000215714.1|86484_86784_+	transcriptional repressor PagR	NA	NA	NA	NA	NA
WP_108021244.1|87346_87463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578527.1|88505_88712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033691385.1|88844_91274_-	anthrax toxin lethal factor	NA	NA	NA	NA	NA
WP_042442027.1|93318_93504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334991.1|94204_94387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021546.1|94743_95787_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	24.0	2.9e-08
WP_000202840.1|96014_96365_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000385111.1|96386_96899_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000045595.1|97186_97441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000394767.1|97800_97953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010890021.1|98217_98406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003171474.1|98694_98991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033691386.1|99204_99738_+	membrane protein	NA	NA	NA	NA	NA
WP_000107153.1|99870_101103_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	58.9	8.0e-66
WP_000073367.1|101115_101568_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_144318823.1|101689_102601_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.6	3.5e-42
101613:101633	attR	TGGTACATGAAAAAAACACCT	NA	NA	NA	NA
>prophage 1
NZ_CP009589	Bacillus cereus G9241 plasmid pBFH_1, complete sequence	52166	0	24928	52166	tail,capsid	Bacillus_virus(50.0%)	29	NA	NA
WP_001980897.1|29_1157_+|capsid	phage minor capsid protein	capsid	B5LPR2	Bacillus_virus	66.9	8.5e-139
WP_001980900.1|1168_1429_+	DUF2829 domain-containing protein	NA	S5MAK7	Bacillus_phage	70.7	4.8e-29
WP_033691940.1|1425_1704_+	hypothetical protein	NA	A0A142F1A2	Bacillus_phage	47.4	4.6e-14
WP_033691990.1|1885_2149_+	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	78.0	2.2e-34
WP_001980906.1|2150_2801_+	hypothetical protein	NA	D2XPY4	Bacillus_virus	82.5	1.6e-81
WP_001980909.1|2875_3772_+	hypothetical protein	NA	D2XPY5	Bacillus_virus	95.0	5.3e-160
WP_001980911.1|3825_4065_+	hypothetical protein	NA	B5LPR5	Bacillus_virus	68.4	4.2e-24
WP_001980913.1|4073_4475_+	hypothetical protein	NA	D2XPY6	Bacillus_virus	96.2	4.3e-69
WP_001980916.1|4471_4828_+	hypothetical protein	NA	D2XPY7	Bacillus_virus	93.2	3.4e-62
WP_038357040.1|4824_5175_+	hypothetical protein	NA	D2XPY8	Bacillus_virus	97.0	3.5e-51
WP_001980918.1|5236_5848_+	hypothetical protein	NA	D2XPY9	Bacillus_virus	99.0	8.7e-122
WP_038357041.1|5887_6307_+	hypothetical protein	NA	B5LPR9	Bacillus_virus	84.9	2.8e-63
WP_001980920.1|6311_6755_+	hypothetical protein	NA	B5LPS0	Bacillus_virus	81.3	3.8e-50
WP_001980922.1|6836_7241_+	hypothetical protein	NA	A0A1B1P876	Bacillus_phage	67.2	1.4e-43
WP_001981074.1|7252_7918_+	hypothetical protein	NA	D2XPZ3	Bacillus_virus	79.7	6.0e-92
WP_038415774.1|7910_11618_+	carbamoyl phosphate synthase large subunit	NA	D2XPZ4	Bacillus_virus	90.6	0.0e+00
WP_001979293.1|11665_13144_+|tail	phage tail family protein	tail	A0A1B1P894	Bacillus_phage	87.6	4.5e-265
WP_002194824.1|13143_18741_+|tail	phage tail protein	tail	D2XR28	Bacillus_phage	44.8	0.0e+00
WP_002194825.1|18779_19016_+	hemolysin XhlA family protein	NA	A0A1B1P887	Bacillus_phage	63.2	1.0e-17
WP_002194826.1|19017_19224_+	hypothetical protein	NA	D2XR32	Bacillus_phage	90.9	3.8e-29
WP_002194827.1|19223_19985_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7G0	Bacillus_phage	85.4	3.6e-125
WP_002194828.1|20072_20732_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_002194829.1|20753_21188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038357008.1|21313_21670_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_002194831.1|21760_22000_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	76.7	2.0e-26
WP_002194832.1|22733_23324_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	32.5	1.5e-09
WP_038357009.1|23367_23625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038357010.1|23724_24105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002194835.1|24106_24928_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	44.6	4.4e-52
>prophage 2
NZ_CP009589	Bacillus cereus G9241 plasmid pBFH_1, complete sequence	52166	28005	50670	52166	terminase,integrase,transposase	Bacillus_phage(76.67%)	46	24841:24854	49304:49317
24841:24854	attL	TTTTAGCAAATTCA	NA	NA	NA	NA
WP_002194840.1|28005_28614_-	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	92.6	6.7e-66
WP_033691960.1|28807_29152_-	helix-turn-helix domain-containing protein	NA	A0A1B1P888	Bacillus_phage	62.2	3.2e-33
WP_002194841.1|29654_30848_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	52.8	3.8e-113
WP_173405267.1|30887_31043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002194843.1|31182_31302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002194844.1|31346_31697_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	48.7	1.8e-23
WP_038357012.1|31875_32079_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	56.2	1.9e-12
WP_002194845.1|32143_32920_+	phage antirepressor Ant	NA	A0A0A8WHY0	Clostridium_phage	33.8	1.5e-38
WP_173405268.1|33036_33180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038357013.1|33213_33399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173405269.1|33599_33752_+	hypothetical protein	NA	B5LPL6	Bacillus_virus	75.6	5.8e-11
WP_002194848.1|33744_34893_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	2.7e-172
WP_116777354.1|35120_35285_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_038357014.1|35281_35497_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_038357015.1|35690_35885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038357016.1|35881_36436_+	HNH endonuclease	NA	D7PQ37	Enterococcus_phage	41.6	3.1e-25
WP_173405270.1|36437_36614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002194852.1|36610_36814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002194853.1|36810_37494_+	ERF family protein	NA	A0A2H4J7J4	uncultured_Caudovirales_phage	48.9	3.3e-37
WP_002194854.1|37507_37684_+	hypothetical protein	NA	A0A1B1P897	Bacillus_phage	71.4	9.7e-18
WP_038357017.1|37683_38442_+	DnaD domain protein	NA	A0A1B1P8C4	Bacillus_phage	56.1	7.1e-57
WP_038357018.1|38425_39184_+	ATP-binding protein	NA	U5PWH5	Bacillus_phage	39.9	1.8e-36
WP_002194857.1|39199_39391_+	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	74.6	1.9e-19
WP_002194858.1|39387_39651_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	59.1	5.7e-22
WP_001981646.1|39666_39984_+	hypothetical protein	NA	A0A0M4R373	Bacillus_phage	44.8	4.9e-12
WP_001981644.1|40009_40585_+	hypothetical protein	NA	A0A0E3DEV0	Bacillus_phage	44.9	1.2e-37
WP_001981568.1|40595_41048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001981137.1|41044_41452_+	hypothetical protein	NA	A0A1B1P8A6	Bacillus_phage	70.1	4.1e-27
WP_080332081.1|41460_41604_+	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	77.8	2.4e-11
WP_001981136.1|41587_41782_+	hypothetical protein	NA	A0A1B1P7U9	Bacillus_phage	79.7	2.1e-21
WP_001981135.1|41848_42490_+	hypothetical protein	NA	A0A2H4JAZ2	uncultured_Caudovirales_phage	41.4	2.7e-41
WP_001981134.1|42489_42723_+	glutaredoxin family protein	NA	A0A1B1P8E0	Bacillus_phage	81.3	3.9e-30
WP_001981132.1|42733_42910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001981129.1|42914_43406_+	dUTP diphosphatase	NA	M4W9N7	Bacillus_phage	38.2	2.9e-19
WP_173405271.1|43444_43612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144318820.1|43714_43897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001981119.1|43933_44074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001981114.1|44305_44479_+	hypothetical protein	NA	A0A1B1P875	Bacillus_phage	91.2	5.8e-23
WP_001981230.1|44496_44736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033691981.1|44736_45159_+	DUF1064 domain-containing protein	NA	A0A1B1P859	Bacillus_phage	91.4	1.8e-70
WP_001981227.1|45418_45790_+	DUF1492 domain-containing protein	NA	A0A1B1P853	Bacillus_phage	39.8	3.4e-12
WP_033691984.1|46765_46951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161772890.1|47043_47388_+	hypothetical protein	NA	U5PTS2	Bacillus_phage	58.7	4.7e-24
WP_001981282.1|47913_48453_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	49.2	7.8e-42
WP_001981248.1|48509_49412_+|terminase	terminase small subunit	terminase	B5LPQ9	Bacillus_virus	82.1	7.3e-117
49304:49317	attR	TGAATTTGCTAAAA	NA	NA	NA	NA
WP_001981247.1|49392_50670_+|terminase	PBSX family phage terminase large subunit	terminase	D2XPX9	Bacillus_virus	92.5	9.3e-243
