The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009335	Bacillus thuringiensis strain HD1011 chromosome, complete genome	5232696	655008	696796	5232696	coat,transposase,protease	Prochlorococcus_phage(12.5%)	53	NA	NA
WP_000379269.1|655008_655686_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003298570.1|655783_656578_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000248599.1|656630_656939_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|657145_657382_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125503.1|657700_657916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581265.1|657986_658988_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000655323.1|659108_659600_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.4	1.2e-41
WP_000351169.1|659620_660100_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000683408.1|660712_661294_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000289900.1|661327_661858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276467.1|661973_662738_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_000503330.1|662847_663480_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000274012.1|663551_663992_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|664139_665111_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000392606.1|665128_665395_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_001174599.1|665767_666265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435941.1|666310_666613_-	YutD family protein	NA	NA	NA	NA	NA
WP_000744046.1|666731_667307_+	lipoprotein	NA	NA	NA	NA	NA
WP_001240995.1|667344_668076_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002003767.1|668161_668977_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000264796.1|668999_669473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721026.1|669576_670131_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000272731.1|670205_670685_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000166375.1|670705_671602_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_000944673.1|671791_672775_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_042996026.1|672811_673543_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000248463.1|673597_673900_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_078384002.1|673965_675357_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001118827.1|676198_677596_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000009523.1|677644_678076_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001020769.1|678065_679286_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	5.2e-118
WP_000152181.1|679285_680578_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000929160.1|680593_681379_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.8	1.3e-08
WP_000757009.1|681618_682425_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000735109.1|682446_683259_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000359553.1|683282_683948_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000601752.1|683940_684966_-	methionine ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000781216.1|685497_685842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568167.1|685996_686296_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000640869.1|686308_686653_-	DNA primase	NA	NA	NA	NA	NA
WP_000026899.1|687146_687530_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000218967.1|687571_687937_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	6.7e-21
WP_000494859.1|688467_688707_-	DUF3937 family protein	NA	NA	NA	NA	NA
WP_000920740.1|689208_689598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171578.1|689921_690113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000525951.1|690128_690359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000826893.1|690414_690942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080775383.1|691189_692743_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D5GVD8	Campylobacter_virus	27.2	1.0e-09
WP_131371309.1|692720_693182_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	36.8	5.7e-17
WP_157447971.1|693130_693376_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000713756.1|693613_694261_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000666170.1|694316_695330_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001002987.1|696547_696796_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 2
NZ_CP009335	Bacillus thuringiensis strain HD1011 chromosome, complete genome	5232696	1444701	1452650	5232696		uncultured_virus(33.33%)	6	NA	NA
WP_000917306.1|1444701_1444986_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
WP_001029999.1|1445024_1446659_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000743900.1|1447066_1448605_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_000833093.1|1448989_1450315_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	5.4e-44
WP_000929883.1|1450459_1451161_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	5.6e-40
WP_000719243.1|1451144_1452650_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	9.2e-32
>prophage 3
NZ_CP009335	Bacillus thuringiensis strain HD1011 chromosome, complete genome	5232696	1497665	1506042	5232696		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625683.1|1497665_1498973_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170542.1|1499061_1499781_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	5.2e-49
WP_000278820.1|1499773_1500028_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666779.1|1500024_1500708_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055577.1|1500691_1502911_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.7e-162
WP_000879029.1|1502895_1504311_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	7.3e-55
WP_001262436.1|1504417_1505458_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.4	9.4e-68
WP_000088592.1|1505454_1506042_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.1	1.2e-27
>prophage 4
NZ_CP009335	Bacillus thuringiensis strain HD1011 chromosome, complete genome	5232696	2913047	2956918	5232696	portal,integrase,protease,tail,terminase,head,holin,capsid	Bacillus_phage(86.79%)	61	2901706:2901721	2962793:2962808
2901706:2901721	attL	AGTTATATATGTATTT	NA	NA	NA	NA
WP_000675866.1|2913047_2914154_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.1	1.5e-143
WP_001091279.1|2914744_2915089_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	38.4	1.5e-17
WP_000787655.1|2915536_2916682_+	hypothetical protein	NA	H0UST6	Bacillus_phage	32.4	5.3e-56
WP_000713534.1|2916683_2916818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000943157.1|2916960_2917143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001021263.1|2917139_2917496_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	40.6	4.5e-14
WP_000935435.1|2917662_2917857_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	43.5	2.1e-05
WP_000522019.1|2917974_2918241_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	7.0e-36
WP_000550146.1|2918434_2918611_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	87.9	1.5e-23
WP_000190239.1|2918615_2919407_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	91.3	1.6e-104
WP_042995975.1|2919375_2920179_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	1.3e-144
WP_000337983.1|2920193_2920388_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	87.5	1.3e-26
WP_000805172.1|2920412_2920586_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	96.5	3.6e-25
WP_000811871.1|2920600_2920855_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	91.7	5.5e-38
WP_000885282.1|2920866_2921286_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	40.7	9.1e-14
WP_000866998.1|2921301_2921784_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	49.5	2.0e-20
WP_000360007.1|2921822_2922059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028140.1|2922209_2922995_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	92.0	1.3e-141
WP_000137371.1|2923142_2923385_+	hypothetical protein	NA	A0A1B1P7A3	Bacillus_phage	100.0	4.9e-44
WP_000805073.1|2923387_2923819_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	94.3	5.1e-76
WP_003297246.1|2924670_2924931_+	DUF3947 family protein	NA	NA	NA	NA	NA
WP_001199273.1|2925214_2925784_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	86.9	1.1e-86
WP_001058285.1|2926499_2927015_+	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	45.8	2.9e-30
WP_000572581.1|2927029_2927314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645585.1|2927930_2928053_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000166192.1|2928368_2928851_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	1.9e-71
WP_001012162.1|2928850_2929393_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	2.9e-89
WP_003297254.1|2929689_2930223_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003297255.1|2930532_2930751_+	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	2.0e-20
WP_001283620.1|2931160_2931379_+	hypothetical protein	NA	A0A1B1P7C1	Bacillus_phage	38.5	3.3e-07
WP_000389425.1|2931419_2931773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097006.1|2931765_2932020_+	hypothetical protein	NA	A0A0S2MVC8	Bacillus_phage	39.5	8.0e-05
WP_000778961.1|2932043_2932256_+	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	95.7	5.1e-29
WP_000376883.1|2932391_2932583_+	hypothetical protein	NA	Q3HKW9	Bacillus_phage	76.2	4.3e-19
WP_001198487.1|2932602_2932857_+	hypothetical protein	NA	H0USW0	Bacillus_phage	89.3	6.5e-39
WP_142286273.1|2932877_2933246_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	76.2	1.0e-29
WP_001139464.1|2933251_2933629_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	98.4	2.6e-68
WP_000242929.1|2933758_2934262_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	100.0	2.3e-88
WP_000621128.1|2934263_2935958_+|terminase	terminase large subunit	terminase	A0A2H4JB98	uncultured_Caudovirales_phage	99.8	0.0e+00
WP_000577482.1|2936146_2937400_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	97.4	1.7e-236
WP_001259168.1|2937386_2938097_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	94.9	7.0e-123
WP_000361131.1|2938134_2939307_+|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	91.3	3.1e-200
WP_000244593.1|2939327_2939615_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	96.8	2.9e-43
WP_001068020.1|2939601_2939925_+|head	phage head closure protein	head	A0A2H4J374	uncultured_Caudovirales_phage	95.3	1.8e-54
WP_000763225.1|2939917_2940355_+	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	99.3	6.1e-77
WP_000609198.1|2940351_2940711_+	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.8	1.6e-59
WP_000896772.1|2940711_2941320_+|tail	tail protein	tail	A0A288WG55	Bacillus_phage	99.0	4.8e-104
WP_000779158.1|2941368_2941686_+	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	95.2	3.2e-51
WP_000344052.1|2941715_2941892_+	hypothetical protein	NA	A0A288WFY6	Bacillus_phage	100.0	3.4e-15
WP_001262729.1|2941906_2945758_+|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	94.8	0.0e+00
WP_000517350.1|2945772_2947263_+	hypothetical protein	NA	Q2LIB8	Bacillus_phage	98.4	4.8e-291
WP_001260167.1|2947259_2951330_+	hypothetical protein	NA	A0A288WFW2	Bacillus_phage	81.9	0.0e+00
WP_000822835.1|2951434_2952394_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR30	Bacillus_phage	95.3	2.0e-173
WP_000373873.1|2952409_2952835_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.9	4.8e-71
WP_000509866.1|2952834_2953632_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	72.1	8.7e-114
WP_000277083.1|2953688_2954180_-	hypothetical protein	NA	Q3HL01	Bacillus_phage	99.4	1.2e-76
WP_001237238.1|2954172_2954385_-	helix-turn-helix transcriptional regulator	NA	Q2I8E4	Bacillus_phage	100.0	2.7e-30
WP_001267628.1|2954568_2954871_+	hypothetical protein	NA	Q2I8E3	Bacillus_phage	97.0	9.7e-50
WP_000170772.1|2954873_2955056_+	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	91.7	1.4e-22
WP_000891436.1|2955171_2956353_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	82.2	4.6e-188
WP_001166987.1|2956294_2956918_+	hypothetical protein	NA	H0USY2	Bacillus_phage	84.4	5.6e-100
2962793:2962808	attR	AAATACATATATAACT	NA	NA	NA	NA
>prophage 5
NZ_CP009335	Bacillus thuringiensis strain HD1011 chromosome, complete genome	5232696	3044205	3052931	5232696		Bacillus_phage(71.43%)	9	NA	NA
WP_000755551.1|3044205_3045462_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	2.6e-11
WP_001194296.1|3045560_3046325_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453764.1|3046565_3048326_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.5	8.2e-266
WP_002036191.1|3048405_3049092_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.4	2.9e-118
WP_001231491.1|3049088_3050162_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.8	7.2e-172
WP_000823560.1|3050186_3050774_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|3050969_3051689_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_002036196.1|3051804_3051918_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	91.7	2.1e-05
WP_001258549.1|3052058_3052931_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	46.6	6.0e-68
>prophage 6
NZ_CP009335	Bacillus thuringiensis strain HD1011 chromosome, complete genome	5232696	4546532	4560570	5232696	transposase	Bacillus_phage(61.54%)	15	NA	NA
WP_000966324.1|4546532_4547090_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	50.7	4.4e-40
WP_000570190.1|4548436_4548676_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	73.4	2.2e-25
WP_000348873.1|4548675_4548912_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	80.8	3.1e-11
WP_000185568.1|4548990_4549287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001051363.1|4549670_4550633_-	M23 family metallopeptidase	NA	A0A2D0WXW0	Clostridium_phage	39.3	4.4e-11
WP_000716766.1|4552061_4553114_-	glycoside hydrolase family 25	NA	A7KV11	Bacillus_phage	47.9	2.3e-66
WP_043326495.1|4553246_4554131_-	M23 family metallopeptidase	NA	A0A1D8EVX2	Mycobacterium_phage	27.2	2.1e-12
WP_043326498.1|4554396_4555413_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	37.4	6.9e-31
WP_000460739.1|4555651_4556038_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	3.4e-47
WP_000510876.1|4556138_4557071_-	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	61.1	5.6e-72
WP_000527104.1|4557157_4557394_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	56.9	2.4e-11
WP_000579786.1|4557531_4557960_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	50.7	2.1e-29
WP_000673786.1|4557982_4558411_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	1.6e-34
WP_043326502.1|4559374_4559695_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144405369.1|4559664_4560570_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.8	2.0e-26
>prophage 1
NZ_CP009336	Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence	358965	20839	82926	358965	integrase,transposase	Bacillus_phage(33.33%)	42	43866:43890	69795:69819
WP_000105000.1|20839_21724_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_144405372.1|22999_23482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873059.1|23478_25356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000757359.1|25932_26796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071050.1|27827_28571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001003634.1|30144_30384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001125176.1|30664_31165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000466637.1|31632_33837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428009.1|34146_34566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000754470.1|34992_35382_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000775817.1|36054_38631_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	42.5	8.4e-33
WP_001044034.1|38623_39841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000516683.1|40263_40716_+	hypothetical protein	NA	A0A1B2LRS6	Wolbachia_phage	44.6	6.0e-11
WP_000751721.1|41338_41698_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WFJ2	Clostridium_phage	50.6	5.4e-15
WP_001079435.1|41804_42377_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000651404.1|42761_43571_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
43866:43890	attL	TCGATAGAACTCTTTACTTAGGAAT	NA	NA	NA	NA
WP_001190858.1|44562_44706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823827.1|44843_45563_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000356910.1|46846_47065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080545802.1|47321_47921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206852.1|48082_48310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003299460.1|48398_48548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000513570.1|48804_50151_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000520153.1|50541_53838_+	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_000527371.1|55155_56259_-	endospore germination permease	NA	NA	NA	NA	NA
WP_000055697.1|56260_57754_-	spore germination protein	NA	NA	NA	NA	NA
WP_000410157.1|58002_58710_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	43.0	1.6e-42
WP_001037567.1|59150_60134_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_144405374.1|61950_62226_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	35.3	1.3e-08
WP_144405373.1|62182_62314_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000520212.1|63283_64993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368536.1|65975_67652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043327243.1|68437_69409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003299058.1|70840_72001_+	hypothetical protein	NA	NA	NA	NA	NA
69795:69819	attR	TCGATAGAACTCTTTACTTAGGAAT	NA	NA	NA	NA
WP_003299056.1|72120_73224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003299054.1|73249_74446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157816.1|74497_75355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000586196.1|75431_76553_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	79.4	1.9e-167
WP_000893562.1|77624_77999_-	helix-turn-helix domain-containing protein	NA	A0A1B1P7A0	Bacillus_phage	33.8	2.8e-06
WP_000722288.1|78183_79188_+	asparaginase	NA	NA	NA	NA	NA
WP_000362584.1|79616_81110_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.0	1.2e-79
WP_085962085.1|81571_82926_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	84.8	1.1e-127
>prophage 1
NZ_CP009334	Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence	349601	14603	24404	349601		Bacillus_phage(83.33%)	15	NA	NA
WP_001004734.1|14603_14789_-	hypothetical protein	NA	F8WPL1	Bacillus_phage	60.3	3.6e-15
WP_001135708.1|14775_14982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000404429.1|14994_15510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033408.1|15520_15709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000834751.1|15722_16022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257080.1|16037_16382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003298987.1|16398_16878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085609.1|17003_17567_-	hypothetical protein	NA	A0A218KBS9	Bacillus_phage	48.2	2.0e-11
WP_000032377.1|17573_17771_-	hypothetical protein	NA	A0A218KBS9	Bacillus_phage	40.7	3.0e-07
WP_000442474.1|17788_18187_-	hypothetical protein	NA	U5J9G1	Bacillus_phage	39.3	2.4e-16
WP_003298982.1|18430_18751_-	hypothetical protein	NA	R4JDU4	Bacillus_phage	40.0	4.0e-09
WP_000727297.1|18839_19925_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_000565922.1|20112_20331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001198496.1|20682_21063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003298979.1|21110_24404_-	DNA polymerase I	NA	S4U8J4	Listeria_phage	23.2	1.7e-25
>prophage 1
NZ_CP009332	Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence	82340	0	27413	82340	terminase,portal	Bacillus_phage(76.92%)	34	NA	NA
WP_000166789.1|599_1601_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	39.3	9.4e-57
WP_001169145.1|1652_2579_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	35.4	5.8e-45
WP_000981366.1|2565_4104_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	39.5	5.6e-93
WP_042996038.1|4103_5420_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	69.7	2.7e-176
WP_000810412.1|5391_6192_-	hypothetical protein	NA	D2XPX8	Bacillus_virus	64.3	2.7e-54
WP_000428144.1|6565_6745_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	55.9	1.5e-10
WP_000600449.1|7211_7796_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.6	6.3e-21
WP_000356958.1|8276_8639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449880.1|8861_9122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000441079.1|10073_10445_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	48.8	1.8e-21
WP_000522788.1|10583_11213_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.4	1.7e-48
WP_000424230.1|12796_13075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776945.1|13936_14383_-	dUTP diphosphatase	NA	A0A0U3SLD3	Bacillus_phage	81.1	3.3e-62
WP_001005203.1|14650_14779_-	Fur-regulated basic protein FbpA	NA	A0A1B1P8B6	Bacillus_phage	73.0	5.0e-08
WP_000414708.1|14787_15186_-	hypothetical protein	NA	B5LPM7	Bacillus_virus	68.7	3.2e-24
WP_000811971.1|15196_15460_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	58.6	4.4e-22
WP_050427553.1|15456_15669_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	75.6	4.6e-22
WP_000337751.1|15625_15889_-	hypothetical protein	NA	A0A1B1P8D7	Bacillus_phage	70.7	1.3e-18
WP_042996037.1|15901_16660_-	ATP-binding protein	NA	U5PWH5	Bacillus_phage	40.8	1.5e-38
WP_000190245.1|16643_17381_-	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	71.6	3.6e-74
WP_000472845.1|17381_17603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206165.1|17808_18426_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	38.6	5.4e-31
WP_000572107.1|18621_18822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024520.1|19602_19866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072753.1|19879_20728_-	ORF6N domain-containing protein	NA	A0A288WFS9	Bacillus_phage	51.3	7.7e-52
WP_001096410.1|20793_20997_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	54.7	9.2e-12
WP_080545786.1|21173_21524_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	51.3	9.6e-25
WP_003298867.1|21568_21688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001174511.1|21986_23144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000853779.1|23640_23985_+	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	29.4	9.8e-06
WP_000448834.1|24189_24846_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	92.8	4.5e-60
WP_000831282.1|24865_25210_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	80.7	2.6e-43
WP_000451519.1|25345_25909_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	48.7	6.1e-37
WP_000185538.1|26243_27413_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	39.0	2.6e-10
>prophage 2
NZ_CP009332	Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence	82340	31043	34556	82340		Geobacillus_virus(50.0%)	2	NA	NA
WP_080545817.1|31043_31286_+	hypothetical protein	NA	A6M971	Geobacillus_virus	43.8	4.2e-11
WP_000466761.1|32363_34556_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.2	5.4e-41
>prophage 3
NZ_CP009332	Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence	82340	39512	40400	82340		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000503948.1|39512_40400_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.8	6.2e-20
>prophage 4
NZ_CP009332	Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence	82340	45405	50611	82340	protease	Bacillus_phage(50.0%)	4	NA	NA
WP_001231501.1|45405_47613_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	30.0	3.4e-51
WP_043325353.1|47776_47986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000182927.1|48191_48893_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000517023.1|49117_50611_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	41.9	7.1e-85
>prophage 5
NZ_CP009332	Bacillus thuringiensis strain HD1011 plasmid 3, complete sequence	82340	60349	81811	82340	tail,holin	Bacillus_phage(38.46%)	27	NA	NA
WP_000335379.1|60349_61177_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	41.1	5.2e-53
WP_000368262.1|61169_61529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000428557.1|61628_61919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359173.1|61945_62203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000599688.1|62322_62625_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000504248.1|62702_63146_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000128996.1|63217_63805_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	36.3	2.3e-10
WP_000472089.1|64024_64237_-	DNA-binding protein	NA	A0A1Z1LZP5	Bacillus_phage	62.9	3.4e-17
WP_000720260.1|64978_65659_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_000272602.1|66074_67340_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	48.8	1.0e-108
WP_001057808.1|67336_67678_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_000249946.1|67809_68727_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	37.6	2.2e-20
WP_000069084.1|68749_69250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000406619.1|69340_70042_-	N-acetylmuramoyl-L-alanine amidase	NA	Q2I8E6	Bacillus_phage	95.7	9.9e-130
WP_000373907.1|70041_70467_-|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	96.5	2.7e-69
WP_001152007.1|70563_71232_-	hypothetical protein	NA	A0A2H4J9X9	uncultured_Caudovirales_phage	74.0	9.4e-53
WP_000331441.1|73089_73359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000289462.1|73368_75216_-	hypothetical protein	NA	A0A2P1JTV8	Anoxybacillus_phage	44.2	2.5e-127
WP_000383066.1|75227_76109_-|tail	phage tail family protein	tail	A0A2P1JTW0	Anoxybacillus_phage	47.9	2.6e-74
WP_000235298.1|76108_78835_-	hypothetical protein	NA	B5LPS3	Bacillus_virus	46.4	9.4e-75
WP_000424144.1|78850_79111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001210040.1|79188_79605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000852367.1|79670_80135_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_000273214.1|80149_80551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168166.1|80553_81045_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	50.3	5.6e-39
WP_000058075.1|81029_81422_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_001128457.1|81421_81811_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.8	9.4e-21
