The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009480	Mycobacterium tuberculosis H37Rv, complete genome	4396119	2934780	2974015	4396119	terminase,integrase,tRNA,capsid,protease,head	Mycobacterium_phage(30.0%)	47	2963186:2963213	2974168:2974195
WP_003413486.1|2934780_2936859_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2936967_2937195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413569.1|2938928_2939429_+	DUF1990 domain-containing protein	NA	NA	NA	NA	NA
WP_003413574.1|2939445_2939886_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2940032_2940710_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2940694_2941048_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2941060_2941486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2941482_2942157_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413589.1|2942234_2943056_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2943191_2944085_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2944087_2944906_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2944920_2946102_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_003413598.1|2946160_2946592_-	hypoxic response protein 1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2947105_2948347_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2948656_2949019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2949365_2950490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2950491_2951031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2951170_2952469_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2952507_2952789_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2952933_2953419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003902325.1|2953445_2953703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2955666_2955909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2955909_2956587_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2956782_2957439_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2957601_2958048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413663.1|2958222_2958555_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2958674_2959034_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2959135_2959594_+	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_003899407.1|2959729_2960110_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2960106_2961603_+	arsenical-resistance protein	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2961837_2962029_+	DUF3018 domain-containing protein	NA	NA	NA	NA	NA
WP_077365235.1|2962101_2962275_+	hypothetical protein	NA	NA	NA	NA	NA
2963186:2963213	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2963319_2963751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2963747_2964746_+|integrase	integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2964759_2965224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075155216.1|2965211_2965400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012054201.1|2966614_2966821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009935349.1|2966991_2968431_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2968438_2968972_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2969124_2969751_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
WP_003899414.1|2969782_2970106_-	toxin	NA	NA	NA	NA	NA
WP_003899415.1|2970185_2970431_-	antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2970427_2971855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899417.1|2971856_2972249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078803784.1|2972245_2972506_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	6.7e-15
WP_003900543.1|2972522_2972885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2972887_2974015_-|integrase	integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2974168:2974195	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
