The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010557	Raoultella ornithinolytica strain S12, complete genome	5522044	377473	386428	5522044	integrase	Enterobacteria_phage(100.0%)	9	377292:377316	389014:389038
377292:377316	attL	ACTCCTGTGATCTTCCGCCAAAATT	NA	NA	NA	NA
WP_041143258.1|377473_378652_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	89.6	3.0e-203
WP_041143259.1|378648_380046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041143260.1|380600_381167_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	2.5e-59
WP_004185270.1|381184_381430_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_041143261.1|381426_382164_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.0	1.2e-69
WP_071844865.1|382987_383539_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.1	5.0e-36
WP_023339336.1|383535_383763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098169.1|383759_384080_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_041143262.1|384094_386428_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.7	0.0e+00
389014:389038	attR	ACTCCTGTGATCTTCCGCCAAAATT	NA	NA	NA	NA
>prophage 2
NZ_CP010557	Raoultella ornithinolytica strain S12, complete genome	5522044	1067306	1076937	5522044		Enterobacteria_phage(71.43%)	9	NA	NA
WP_041143820.1|1067306_1068572_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.8e-74
WP_052474452.1|1068610_1070377_-	DUF262 domain-containing protein	NA	K4F7C3	Cronobacter_phage	23.7	8.6e-05
WP_041143821.1|1071122_1071689_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.1e-57
WP_004185270.1|1071706_1071952_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_041143822.1|1071948_1072686_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.8	3.8e-71
WP_041143823.1|1073499_1074051_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.6	1.4e-30
WP_041143824.1|1074047_1074275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185276.1|1074271_1074592_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_041143825.1|1074603_1076937_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.4	0.0e+00
>prophage 3
NZ_CP010557	Raoultella ornithinolytica strain S12, complete genome	5522044	2219249	2228987	5522044	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_041144772.1|2219249_2220365_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	47.1	2.4e-05
WP_041144773.1|2220361_2222308_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.7e-38
WP_041144774.1|2222376_2222598_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	5.1e-16
WP_041144775.1|2222923_2223241_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.9	9.0e-14
WP_041144776.1|2223271_2225551_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	3.7e-165
WP_002211347.1|2225687_2225906_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_041147565.1|2226416_2227121_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_041144777.1|2227265_2228987_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	5.8e-14
>prophage 4
NZ_CP010557	Raoultella ornithinolytica strain S12, complete genome	5522044	3541615	3596896	5522044	integrase,coat,tail,terminase,lysis,holin	Enterobacteria_phage(25.0%)	67	3548970:3548985	3598980:3598995
WP_052474535.1|3541615_3543382_-	hypothetical protein	NA	A0A286S1R8	Klebsiella_phage	66.0	4.9e-08
WP_041145863.1|3543457_3546538_-	kinase	NA	A0A286S259	Klebsiella_phage	66.6	0.0e+00
WP_041145864.1|3546534_3546915_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	81.7	9.0e-61
WP_041145865.1|3546924_3547407_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	75.0	7.2e-63
WP_041145866.1|3547393_3547867_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	65.8	2.6e-57
WP_041145867.1|3548194_3548530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145868.1|3548613_3551724_-|tail	tail protein	tail	A0A2D1GPC9	Escherichia_phage	31.5	7.4e-84
3548970:3548985	attL	CGACACCAGCAGGCTG	NA	NA	NA	NA
WP_155397508.1|3551822_3552290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145870.1|3552334_3553018_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	42.8	6.4e-41
WP_155397509.1|3553084_3553282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145871.1|3553419_3553902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145872.1|3553957_3555130_-	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	39.9	1.4e-56
WP_041145873.1|3555154_3555547_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_041145874.1|3555543_3556095_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.3	1.2e-29
WP_041145875.1|3556096_3556480_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	43.7	1.7e-19
WP_041145876.1|3556481_3556892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145878.1|3557375_3558512_-|coat	coat protein	coat	G8C7P7	Escherichia_phage	74.9	5.9e-156
WP_041145879.1|3558599_3559364_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	62.2	5.8e-83
WP_041145880.1|3559469_3560582_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	54.1	3.1e-109
WP_041145881.1|3560583_3561990_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.8	7.2e-188
WP_041147660.1|3561994_3563224_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.8	1.5e-133
WP_052474540.1|3563766_3564180_+	hypothetical protein	NA	A0A1J0GVM9	Pseudoalteromonas_phage	44.5	4.9e-28
WP_041145882.1|3564284_3565298_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	3.8e-37
WP_071844933.1|3565357_3565558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145883.1|3565675_3565921_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	4.7e-18
WP_071844934.1|3566062_3566602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145885.1|3567589_3567814_-	hypothetical protein	NA	A0A2H4J182	uncultured_Caudovirales_phage	66.2	1.6e-20
WP_041145886.1|3568017_3568479_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	64.7	2.2e-45
WP_041145887.1|3568579_3569083_-	lysozyme	NA	A0A1V0E5I4	Salmonella_phage	86.2	2.8e-78
WP_041145888.1|3569054_3569324_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	82.6	1.2e-35
WP_041145889.1|3570244_3571042_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	78.1	1.3e-117
WP_155397510.1|3571038_3571176_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	69.4	2.1e-07
WP_041147662.1|3571172_3571772_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	65.5	1.8e-55
WP_041145890.1|3571768_3572188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145892.1|3572396_3572993_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	78.6	7.2e-89
WP_071844936.1|3573028_3573298_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	69.1	4.2e-28
WP_041145893.1|3573387_3573621_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	1.4e-24
WP_041145894.1|3573991_3574417_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.8e-50
WP_041145895.1|3574429_3575719_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.2	2.1e-165
WP_041145896.1|3575763_3576084_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.8	7.7e-21
WP_041145897.1|3576169_3576868_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.2	8.5e-89
WP_041145898.1|3577155_3577623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145899.1|3577598_3579443_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	61.6	8.8e-218
WP_041147663.1|3579439_3579700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041145900.1|3579749_3580088_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	44.3	6.9e-12
WP_041145901.1|3580080_3580794_-	Replication protein P	NA	C1JJ54	Enterobacteria_phage	60.2	1.2e-74
WP_080773239.1|3580790_3581648_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	65.8	7.0e-93
WP_041145904.1|3582051_3582588_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	63.9	2.7e-58
WP_071844937.1|3582590_3582824_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.9	1.1e-21
WP_041145905.1|3582928_3583315_+	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	72.4	4.9e-46
WP_155397511.1|3583441_3583762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155397512.1|3583765_3584242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155397513.1|3584231_3584675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155397514.1|3585376_3585520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041145908.1|3585623_3585815_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_041147664.1|3585823_3585982_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	63.5	1.2e-14
WP_041145909.1|3586119_3588732_+	hypothetical protein	NA	H6WRX1	Salmonella_phage	46.1	4.6e-204
WP_041145910.1|3588743_3589853_+	hypothetical protein	NA	A0A2I7RQF1	Vibrio_phage	43.2	2.0e-60
WP_041145911.1|3590456_3590765_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	3.2e-24
WP_041145912.1|3590772_3591012_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	71.8	1.1e-24
WP_071844938.1|3591074_3591296_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	62.9	1.6e-17
WP_041145913.1|3591273_3592347_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	65.2	1.2e-131
WP_041145914.1|3592530_3593415_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	39.5	3.8e-17
WP_041145915.1|3593535_3594117_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_041145916.1|3594156_3595323_-	MFS transporter	NA	NA	NA	NA	NA
WP_041145917.1|3595486_3595576_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_041145918.1|3595870_3596896_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.2	8.2e-32
3598980:3598995	attR	CAGCCTGCTGGTGTCG	NA	NA	NA	NA
>prophage 5
NZ_CP010557	Raoultella ornithinolytica strain S12, complete genome	5522044	4218136	4224797	5522044	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_041146408.1|4218136_4219636_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	2.8e-28
WP_041146409.1|4219632_4220355_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	8.3e-31
WP_041146410.1|4220583_4221945_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	91.8	1.1e-201
WP_041146411.1|4222217_4223111_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	31.2	2.6e-13
WP_041146412.1|4223149_4223923_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.0e-26
WP_041147698.1|4223933_4224797_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	33.8	2.5e-05
>prophage 6
NZ_CP010557	Raoultella ornithinolytica strain S12, complete genome	5522044	4707234	4718439	5522044	integrase	Enterobacteria_phage(85.71%)	11	4707206:4707223	4718755:4718772
4707206:4707223	attL	CGTGTACCAATTATGGAA	NA	NA	NA	NA
WP_041146802.1|4707234_4708446_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.1	9.2e-107
WP_041147720.1|4708809_4709604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041147721.1|4709611_4710265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041146803.1|4711121_4711688_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.1e-59
WP_004136116.1|4711705_4711951_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_041146804.1|4711947_4712685_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.0	5.8e-72
WP_071844967.1|4713489_4714038_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	68.5	1.2e-29
WP_004185275.1|4714034_4714262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4714258_4714579_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_041146805.1|4714590_4716924_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.7	0.0e+00
WP_041146806.1|4717227_4718439_+	hypothetical protein	NA	U5N3F3	Enterobacteria_phage	28.4	1.4e-33
4718755:4718772	attR	TTCCATAATTGGTACACG	NA	NA	NA	NA
