The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014680	Lactobacillus hokkaidonensis JCM 18461 strain LOOC260	2277985	115612	142582	2277985	integrase,transposase	Listeria_phage(16.67%)	28	116529:116543	142275:142289
WP_041092103.1|115612_116530_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.2	7.2e-72
116529:116543	attL	AAGCTTTTCATTATA	NA	NA	NA	NA
WP_157869559.1|116545_117820_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_052467229.1|117746_118322_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_041092105.1|118381_119305_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_052467230.1|119336_119864_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_082232230.1|120112_121321_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_052467231.1|121363_122134_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	51.0	2.0e-38
WP_156406629.1|122250_122427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041092109.1|122416_122770_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_041095116.1|122859_124374_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_041092111.1|124667_125852_+	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	27.6	1.4e-06
WP_041092113.1|126026_127175_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_041092116.1|127482_128838_+|transposase	IS4-like element ISLho3 family transposase	transposase	NA	NA	NA	NA
WP_041092118.1|128937_130488_+	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
WP_041092120.1|130496_131174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041092122.1|131591_132785_+	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.5	1.3e-17
WP_041092124.1|133077_134556_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_041092126.1|134686_135295_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041092128.1|135391_136429_-	aldehyde reductase	NA	NA	NA	NA	NA
WP_041092130.1|136536_136983_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041092131.1|137264_137621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041092133.1|137795_138719_+	EamA family transporter	NA	NA	NA	NA	NA
WP_041092135.1|138806_139364_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_041092137.1|139375_139882_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EL10	Moumouvirus	39.5	1.6e-17
WP_082232232.1|140422_140926_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_041092141.1|140932_141172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082232234.1|141806_142244_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.5	1.1e-06
WP_082232236.1|142225_142582_-|transposase	transposase	transposase	NA	NA	NA	NA
142275:142289	attR	AAGCTTTTCATTATA	NA	NA	NA	NA
>prophage 2
NZ_AP014680	Lactobacillus hokkaidonensis JCM 18461 strain LOOC260	2277985	208366	239638	2277985	tRNA,holin,transposase	Lactobacillus_phage(37.5%)	27	NA	NA
WP_041092247.1|208366_209611_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041092249.1|210144_211497_+	amino acid permease	NA	NA	NA	NA	NA
WP_041092251.1|211618_212707_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_041091960.1|212888_214253_+|transposase	ISLre2-like element ISLho1 family transposase	transposase	NA	NA	NA	NA
WP_156406659.1|214514_214658_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_041092253.1|215201_217004_+|tRNA	threonine--tRNA ligase	tRNA	A0A1V0SKZ9	Klosneuvirus	33.4	3.8e-64
WP_041092255.1|217465_218503_+	lactonase family protein	NA	NA	NA	NA	NA
WP_041092256.1|219297_220494_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041092258.1|220803_221631_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_041092260.1|222144_223509_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_041092262.1|223984_225244_+	nucleoside permease	NA	NA	NA	NA	NA
WP_041092263.1|225358_226279_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_041092266.1|226856_227582_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_041092268.1|227736_228603_+	nucleoid occlusion protein	NA	A0A1C9EHY8	Gordonia_phage	29.1	1.3e-09
WP_041092271.1|228620_229388_+	ParA family protein	NA	Q8JL10	Natrialba_phage	30.6	1.4e-28
WP_041092273.1|229377_230259_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.8	1.4e-16
WP_041092275.1|230303_230495_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_041092277.1|230809_231910_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_041092280.1|231939_232710_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_041092282.1|232850_233408_+	hypothetical protein	NA	A0A2D1GPG5	Lactobacillus_phage	27.5	7.6e-08
WP_041092285.1|233457_233694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041092287.1|233705_234119_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_041092290.1|234269_235412_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	32.4	1.1e-61
WP_041092292.1|235632_237036_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_041092294.1|237462_238389_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_041092296.1|238490_239333_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	1.3e-155
WP_002816285.1|239386_239638_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
>prophage 3
NZ_AP014680	Lactobacillus hokkaidonensis JCM 18461 strain LOOC260	2277985	714499	763287	2277985	bacteriocin,protease,transposase	Enterococcus_phage(22.22%)	37	NA	NA
WP_041092043.1|714499_715912_+|transposase	IS5-like element ISLho2 family transposase	transposase	NA	NA	NA	NA
WP_041093047.1|715981_718225_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	40.7	6.6e-127
WP_041093049.1|718522_718708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093050.1|718891_719158_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_041093052.1|719157_720879_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_041093054.1|721217_722420_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041093056.1|722423_723446_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041093058.1|723448_724459_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_156406656.1|724628_725819_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_041093061.1|725926_726175_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_052467275.1|732816_734334_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	26.0	3.5e-23
WP_041095214.1|734427_734775_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_156406640.1|734776_734953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093063.1|735111_737103_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_041093065.1|737594_739808_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.1	2.8e-247
WP_041093067.1|739749_740331_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.9	6.4e-50
WP_041093068.1|740353_741109_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.1	5.1e-07
WP_052467276.1|741108_742272_+	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_041093070.1|742283_743489_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.4	1.6e-90
WP_041093072.1|743481_743913_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_041093074.1|743912_745322_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_041093075.1|745590_746940_+	guanine deaminase	NA	NA	NA	NA	NA
WP_041093077.1|746951_748292_+	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	28.0	1.8e-18
WP_041093079.1|748596_749310_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041093081.1|749648_750164_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_041093083.1|750387_751578_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_041093085.1|751673_753014_-	amino acid permease	NA	NA	NA	NA	NA
WP_041093088.1|753491_754613_+	vitamin B12 independent methionine synthase	NA	A0A218MNE0	uncultured_virus	44.7	2.9e-83
WP_041093090.1|756653_757838_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_041093092.1|758507_759263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093093.1|759259_759949_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	5.7e-29
WP_041093095.1|759945_761112_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041093097.1|761162_761354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093098.1|761463_762165_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_156406639.1|762340_762496_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_041093100.1|762510_762693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082232286.1|763164_763287_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 4
NZ_AP014680	Lactobacillus hokkaidonensis JCM 18461 strain LOOC260	2277985	938297	1019210	2277985	tail,tRNA,holin,capsid,head,integrase,portal,protease,terminase	Lactobacillus_phage(46.34%)	104	950208:950223	996945:996960
WP_041093345.1|938297_939344_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	36.0	3.4e-25
WP_041093347.1|939356_941774_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_041093349.1|941914_943033_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_041095252.1|943050_943722_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.6	4.8e-33
WP_041093356.1|943844_944321_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_041093358.1|944451_944757_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_041093360.1|944818_947467_-	YfhO family protein	NA	NA	NA	NA	NA
WP_041093362.1|947634_949698_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081721478.1|949824_949974_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_041093364.1|950117_950681_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
950208:950223	attL	ATCTATCAGCAATTAT	NA	NA	NA	NA
WP_082232422.1|950755_951349_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_041093366.1|951364_951580_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_041093367.1|951600_952569_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_041093369.1|952587_953001_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_041093371.1|953067_953244_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_041093372.1|953330_954248_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_041093373.1|954350_954737_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041093374.1|954767_956108_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_041093376.1|956435_957317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052467293.1|957309_958251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093378.1|958264_958804_+	dUTP diphosphatase	NA	NA	NA	NA	NA
WP_041093379.1|959462_960596_-|integrase	site-specific integrase	integrase	A0A2H4J2K7	uncultured_Caudovirales_phage	28.6	3.9e-27
WP_041093380.1|960828_961401_-	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	62.1	4.4e-43
WP_041093382.1|961457_961715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093383.1|961802_962519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093385.1|962578_963034_-	hypothetical protein	NA	A0A2H4IYT4	uncultured_Caudovirales_phage	33.3	1.3e-16
WP_082232308.1|963043_963388_-	helix-turn-helix transcriptional regulator	NA	Q4ZB06	Staphylococcus_virus	67.6	2.4e-20
WP_041093386.1|963547_963739_+	helix-turn-helix transcriptional regulator	NA	D2KRD7	Lactobacillus_phage	62.9	7.5e-16
WP_157869568.1|963775_963931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093388.1|963981_964695_+	phage antirepressor KilAC domain-containing protein	NA	B4XYR8	Lactobacillus_phage	59.9	4.5e-69
WP_041093390.1|964704_965004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156406665.1|965156_965348_+	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	58.1	1.3e-12
WP_041093394.1|965325_965823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093396.1|966006_966210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093398.1|966210_966414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082232310.1|967251_968151_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	48.9	4.4e-74
WP_041093399.1|968154_968601_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	58.0	3.8e-42
WP_052467294.1|968616_969498_+	DnaD domain protein	NA	A8YQM0	Lactobacillus_phage	40.6	5.2e-27
WP_041093401.1|969494_969773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156406661.1|969756_969897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093402.1|969900_970080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052467295.1|970080_970491_+	hypothetical protein	NA	C1KFD0	Lactobacillus_virus	45.2	9.9e-05
WP_041093404.1|970491_970782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162182085.1|971029_971167_+	hypothetical protein	NA	A0A2D1GPI6	Lactobacillus_phage	68.9	2.3e-11
WP_041093408.1|971156_971540_+	phage protein	NA	Q8LTB5	Lactobacillus_phage	53.7	1.4e-29
WP_041093410.1|971536_971929_+	hypothetical protein	NA	A0A2I7RP21	Vibrio_phage	34.4	1.2e-12
WP_041093411.1|971925_972138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157869569.1|972178_972346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156406667.1|972329_972503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052467296.1|972504_972960_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	51.1	3.4e-30
WP_041093414.1|972959_973205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093416.1|973294_973741_+	hypothetical protein	NA	A0A0P0IZR0	Lactobacillus_phage	38.8	1.4e-20
WP_082232426.1|974069_974354_+	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	71.1	3.2e-34
WP_041093417.1|974365_974545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137597130.1|974663_974984_+|terminase	P27 family phage terminase small subunit	terminase	A0A2H4JBX8	uncultured_Caudovirales_phage	42.3	3.2e-11
WP_041093419.1|974980_976663_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	60.5	3.6e-202
WP_041093421.1|976681_977830_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	52.7	9.0e-112
WP_041093423.1|977816_978584_+|protease	Clp protease ClpP	protease	A0A290FZN4	Caldibacillus_phage	52.7	2.6e-51
WP_041093426.1|978609_979800_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	71.8	7.3e-157
WP_041093429.1|979827_980034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093432.1|980045_980351_+|head,tail	phage head-tail connector protein	head,tail	A8ATA0	Listeria_phage	40.7	4.5e-10
WP_082232428.1|980313_980733_+	hypothetical protein	NA	A8ATA1	Listeria_phage	47.5	7.5e-24
WP_041093436.1|980729_981137_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	57.0	4.1e-35
WP_052467297.1|981543_982155_+	hypothetical protein	NA	A0A2P0ZLF5	Lactobacillus_phage	48.5	2.7e-46
WP_052467298.1|982226_982541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156406626.1|982576_982738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052467299.1|982771_987286_+|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	34.4	2.3e-09
WP_041093438.1|987282_989817_+|tail	phage tail family protein	tail	Q9AZL3	Lactococcus_phage	24.7	1.8e-11
WP_052467300.1|989834_993395_+|tail	phage tail protein	tail	A0A2P0ZL78	Lactobacillus_phage	74.5	2.5e-51
WP_041093439.1|993417_993843_+	DUF1617 family protein	NA	A0A2H4PB97	Lactobacillus_phage	25.9	1.6e-05
WP_041093440.1|993844_994108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093441.1|994242_994692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093442.1|994681_994987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093443.1|994983_995241_+|holin	phage holin	holin	A0A0N7IR91	Lactobacillus_phage	64.5	2.1e-21
WP_052467301.1|995240_996089_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JN27	Lactococcus_phage	51.3	5.9e-44
WP_041093444.1|996302_996581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093445.1|996582_997053_+	hypothetical protein	NA	NA	NA	NA	NA
996945:996960	attR	ATCTATCAGCAATTAT	NA	NA	NA	NA
WP_052467302.1|997045_997495_+	AP2 domain-containing protein	NA	A3F671	Streptococcus_phage	33.5	6.6e-18
WP_052467303.1|997495_997870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041093446.1|998315_998957_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041093447.1|999106_999415_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_041093448.1|999430_999757_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_041093449.1|999783_1000065_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_041093450.1|1000133_1001201_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_041093451.1|1001265_1001826_+	elongation factor P	NA	NA	NA	NA	NA
WP_041093452.1|1001861_1002296_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_041093453.1|1002292_1002706_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_041093454.1|1002826_1003687_+	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	38.3	1.6e-33
WP_041093455.1|1003679_1005026_+	exodeoxyribonuclease VII large subunit	NA	A0A160DEV2	Gordonia_phage	29.3	9.4e-28
WP_041093456.1|1005028_1005280_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_041093457.1|1005272_1006148_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_041093458.1|1006166_1006982_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_041093459.1|1007072_1007528_+	arginine repressor	NA	NA	NA	NA	NA
WP_041093460.1|1007613_1009296_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_041093461.1|1009494_1010727_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	52.3	6.2e-18
WP_041093462.1|1010719_1011349_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041093463.1|1011365_1012298_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_041093464.1|1012297_1012960_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_041093465.1|1013031_1013367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093466.1|1013547_1014168_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	32.2	7.9e-22
WP_041093467.1|1014164_1014380_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_041093468.1|1014589_1015789_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.3	2.4e-43
WP_041093469.1|1015811_1018226_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_041093470.1|1018259_1019210_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.3	6.3e-10
>prophage 5
NZ_AP014680	Lactobacillus hokkaidonensis JCM 18461 strain LOOC260	2277985	1074544	1083164	2277985		Synechococcus_phage(50.0%)	9	NA	NA
WP_041093517.1|1074544_1075027_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	37.6	1.3e-16
WP_041093518.1|1075010_1076147_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_041093519.1|1076152_1076887_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	40.4	3.1e-41
WP_041093520.1|1076873_1077140_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_041093521.1|1077143_1077809_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_052467388.1|1077885_1080048_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	2.7e-141
WP_041093523.1|1080032_1081499_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	6.4e-54
WP_041093524.1|1081537_1082590_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	5.2e-58
WP_041093525.1|1082582_1083164_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	2.0e-22
>prophage 6
NZ_AP014680	Lactobacillus hokkaidonensis JCM 18461 strain LOOC260	2277985	1361294	1459147	2277985	tail,tRNA,holin,capsid,head,integrase,portal,terminase,transposase	Lactobacillus_phage(50.0%)	115	1400336:1400357	1437663:1437684
WP_041093866.1|1361294_1362428_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_041093868.1|1362583_1362925_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_041093870.1|1362926_1364090_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_041093872.1|1364105_1364801_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_041093874.1|1364830_1365148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093876.1|1365148_1365703_-	NUDIX hydrolase	NA	Q5ULM8	Lactobacillus_virus	28.5	1.8e-09
WP_041093877.1|1365705_1365924_-	cold-shock protein	NA	NA	NA	NA	NA
WP_041093879.1|1365943_1366933_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_041093881.1|1367022_1369821_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	26.5	5.2e-89
WP_041093883.1|1370141_1370831_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_041093885.1|1370845_1371631_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_173406301.1|1371646_1371922_-	YggT family protein	NA	NA	NA	NA	NA
WP_041093887.1|1371934_1372357_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_041093889.1|1372392_1373613_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_041093891.1|1373640_1375047_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_052467330.1|1375190_1376045_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_041093893.1|1376073_1377174_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_041093894.1|1377173_1378547_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_041093896.1|1378558_1379521_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_041093898.1|1379545_1381708_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_041093900.1|1381707_1382097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093902.1|1382126_1383074_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_041093904.1|1383094_1383523_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_041093906.1|1383688_1384033_-	DUF3397 family protein	NA	NA	NA	NA	NA
WP_041093908.1|1384141_1385104_+	magnesium transporter CorA family protein	NA	C1KFH9	Lactobacillus_virus	31.0	3.9e-28
WP_082232334.1|1385175_1385295_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_041093910.1|1385564_1387856_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.3	1.3e-82
WP_041093911.1|1387882_1388395_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_041095358.1|1388589_1389438_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_052467392.1|1389448_1390618_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_041093913.1|1390742_1391774_+	lactonase family protein	NA	NA	NA	NA	NA
WP_041093915.1|1391949_1393296_-	magnesium transporter	NA	NA	NA	NA	NA
WP_041093917.1|1393310_1394198_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_041093919.1|1394194_1395004_-	NAD kinase	NA	NA	NA	NA	NA
WP_041093921.1|1395015_1395705_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_041093923.1|1395978_1396614_+	DsbA family protein	NA	NA	NA	NA	NA
WP_052467331.1|1396677_1397715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093925.1|1397798_1399073_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	22.1	2.1e-05
WP_041093927.1|1399085_1399937_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
1400336:1400357	attL	ACTTAGAAAAATAAAAACGCGT	NA	NA	NA	NA
WP_156406619.1|1400678_1401260_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_156406620.1|1401260_1401431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052467332.1|1401617_1402649_-	hypothetical protein	NA	A0A2K9VBX9	Lactobacillus_phage	30.8	2.3e-21
WP_156406621.1|1402661_1403132_-|holin	phage holin	holin	B4XYQ8	Lactobacillus_phage	49.1	7.3e-20
WP_082232338.1|1403160_1403265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093935.1|1403254_1403470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093937.1|1403462_1403840_-	hypothetical protein	NA	A0A0P0IV33	Lactobacillus_phage	60.2	5.8e-36
WP_041093939.1|1404030_1404228_-	XkdX family protein	NA	NA	NA	NA	NA
WP_041093940.1|1404224_1404557_-	DUF2977 domain-containing protein	NA	Q7M292	Lactobacillus_phage	47.4	3.4e-11
WP_041093942.1|1404556_1405312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093944.1|1405308_1406772_-	hypothetical protein	NA	A0A2K9VBY4	Lactobacillus_phage	33.4	4.9e-46
WP_041093946.1|1406771_1407098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162182090.1|1407081_1408365_-|tail	phage tail protein	tail	A0A0M7RDS2	Lactobacillus_phage	38.3	8.6e-71
WP_041093949.1|1408249_1409089_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	39.1	1.1e-47
WP_052467333.1|1409104_1413730_-|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	36.2	2.8e-103
WP_162182086.1|1413736_1413910_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	40.0	4.4e-07
WP_052467334.1|1413933_1414284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093951.1|1414434_1415043_-|tail	phage tail protein	tail	A0A2I6QQR1	Streptococcus_phage	53.2	2.6e-49
WP_041093953.1|1415046_1415427_-	DUF806 family protein	NA	A0A2I6QQR0	Streptococcus_phage	43.1	3.4e-23
WP_041093955.1|1415426_1415849_-	hypothetical protein	NA	Q9MCK1	Streptococcus_virus	49.6	1.1e-27
WP_052467335.1|1415851_1416229_-|head	phage head closure protein	head	B8R652	Lactobacillus_phage	36.2	7.4e-15
WP_041093957.1|1416209_1416497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082232342.1|1416688_1418581_-|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	47.8	3.3e-127
WP_041093959.1|1418561_1419737_-|portal	phage portal protein	portal	A0A0M9JJ63	Lactobacillus_phage	46.2	4.2e-88
WP_169790734.1|1419737_1419914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156406622.1|1419923_1421825_-|terminase	terminase large subunit	terminase	B8R649	Lactobacillus_phage	57.4	4.1e-210
WP_041093961.1|1421824_1422343_-|terminase	phage terminase small subunit P27 family	terminase	A0A286QNN0	Streptococcus_phage	37.9	9.9e-18
WP_041093963.1|1422465_1422945_-	HNH endonuclease	NA	B8R694	Lactobacillus_phage	59.2	1.7e-48
WP_041093965.1|1422937_1423213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093416.1|1423427_1423874_-	hypothetical protein	NA	A0A0P0IZR0	Lactobacillus_phage	38.8	1.4e-20
WP_041093414.1|1423963_1424209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052467296.1|1424208_1424664_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	51.1	3.4e-30
WP_156406666.1|1424665_1424839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162182091.1|1424822_1424990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093968.1|1425040_1425244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093970.1|1425240_1425615_-	hypothetical protein	NA	D2IZL0	Enterococcus_phage	40.8	1.6e-14
WP_041093972.1|1425663_1425855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093974.1|1425851_1426217_-	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	49.6	2.7e-22
WP_156406662.1|1426220_1426361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093975.1|1426364_1426763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093977.1|1426765_1428004_-	DnaB-like helicase C-terminal domain-containing protein	NA	A8YQM1	Lactobacillus_phage	35.3	2.0e-61
WP_052467336.1|1428000_1428834_-	conserved phage C-terminal domain-containing protein	NA	A0A0A0RQ10	Bacillus_phage	57.9	7.6e-36
WP_041093979.1|1428946_1429546_-	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	46.7	7.1e-44
WP_173406310.1|1429548_1430268_-	AAA family ATPase	NA	A8YQL5	Lactobacillus_phage	65.3	8.7e-81
WP_041093982.1|1430268_1430907_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_041093984.1|1430893_1431127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093394.1|1431311_1431809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156406665.1|1431786_1431978_-	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	58.1	1.3e-12
WP_041093986.1|1432167_1432455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093988.1|1432492_1433206_-	phage antirepressor KilAC domain-containing protein	NA	B4XYR8	Lactobacillus_phage	62.0	1.9e-72
WP_157869568.1|1433257_1433413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093989.1|1433424_1433607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041093991.1|1433882_1434206_+	helix-turn-helix transcriptional regulator	NA	D2IZV9	Enterococcus_phage	33.6	1.9e-11
WP_041093993.1|1434207_1434612_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	40.9	1.1e-21
WP_041093995.1|1434709_1435222_+	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	66.4	2.0e-10
WP_162182094.1|1435456_1436116_+	PH domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	42.4	1.2e-36
WP_041093997.1|1436294_1437464_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	23.2	1.5e-13
WP_041093999.1|1437660_1438365_-	adaptor protein MecA	NA	NA	NA	NA	NA
1437663:1437684	attR	ACTTAGAAAAATAAAAACGCGT	NA	NA	NA	NA
WP_041094001.1|1438501_1438903_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_041094003.1|1439210_1439951_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041094006.1|1440045_1440534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041094008.1|1447881_1448247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082232346.1|1448438_1449005_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	49.1	1.8e-36
WP_041094010.1|1448970_1449624_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_052467337.1|1449602_1450244_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_041094012.1|1450218_1450998_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_041094014.1|1451013_1451658_-	YutD family protein	NA	NA	NA	NA	NA
WP_041094016.1|1451692_1453072_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_041094017.1|1453115_1453724_-	metallophosphoesterase	NA	A0A076G7D9	Bacillus_phage	36.9	4.1e-31
WP_041094019.1|1453802_1454993_-	acetate kinase	NA	NA	NA	NA	NA
WP_082232438.1|1455007_1455769_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041094021.1|1456088_1456376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041094023.1|1456372_1456819_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_041094025.1|1456815_1457109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157869575.1|1457089_1457530_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_041092043.1|1457734_1459147_+|transposase	IS5-like element ISLho2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_AP014680	Lactobacillus hokkaidonensis JCM 18461 strain LOOC260	2277985	1809244	1817083	2277985		Streptococcus_phage(83.33%)	7	NA	NA
WP_041094396.1|1809244_1810291_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	48.4	8.8e-90
WP_003678268.1|1810403_1810625_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	4.9e-27
WP_010581070.1|1810650_1811154_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_010581389.1|1811221_1811602_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.6	1.0e-40
WP_010581390.1|1811598_1814052_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	66.1	0.0e+00
WP_010581391.1|1814052_1816095_+	conjugal transfer protein	NA	A0A1S5SF30	Streptococcus_phage	51.7	2.3e-150
WP_010581392.1|1816087_1817083_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	57.8	2.5e-102
>prophage 1
NZ_AP014681	Lactobacillus hokkaidonensis JCM 18461 strain LOOC260 plasmid pLOOC260-1, complete sequence	81630	3032	60932	81630	transposase,protease,integrase	Staphylococcus_phage(23.53%)	59	2619:2632	14800:14813
2619:2632	attL	GCATTTCATCAATT	NA	NA	NA	NA
WP_041095592.1|3032_3620_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	33.1	1.1e-20
WP_003625288.1|3723_4002_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_005917927.1|3991_4294_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_041095608.1|4552_5785_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041095610.1|7108_9223_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.0	1.1e-118
WP_082232458.1|10166_10664_-	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_041095612.1|10751_11306_-	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_041095614.1|11926_14920_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.8	3.9e-207
14800:14813	attR	GCATTTCATCAATT	NA	NA	NA	NA
WP_003582117.1|15098_15695_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.4	3.5e-27
WP_003582114.1|15817_16141_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	42.7	5.2e-17
WP_016373382.1|16192_17923_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_041095617.1|17965_19261_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	1.7e-143
WP_025013532.1|19297_19633_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004563097.1|19655_20072_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	56.9	3.9e-33
WP_041095619.1|20884_21133_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_041095621.1|21481_21676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041095623.1|21653_22127_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_041095625.1|22139_23183_+	hypothetical protein	NA	O03966	Lactobacillus_phage	43.0	7.8e-54
WP_157869582.1|23221_24008_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041095629.1|24339_25509_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003679174.1|26027_26888_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	25.2	1.1e-05
WP_041095635.1|26880_27423_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_041095637.1|27640_28696_+	oxidoreductase	NA	NA	NA	NA	NA
WP_082040903.1|29306_30590_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.5	3.9e-47
WP_041095641.1|31320_31665_-	DUF5388 domain-containing protein	NA	NA	NA	NA	NA
WP_041095643.1|31657_32467_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	44.2	6.0e-54
WP_041095645.1|33397_33601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014564139.1|35363_35645_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_041095650.1|35634_36141_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_015474680.1|36130_36409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082232462.1|36431_36659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041095659.1|36911_38975_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_082232464.1|39160_39745_+	hypothetical protein	NA	F2Y1B5	Organic_Lake_phycodnavirus	27.2	1.2e-11
WP_156406647.1|39734_40577_+	hypothetical protein	NA	A0A1X9I6W8	Streptococcus_phage	50.6	5.6e-63
WP_041095663.1|41791_42319_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_041095665.1|42462_42909_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_041095667.1|42921_43389_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_041095669.1|43399_44377_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_041095671.1|44402_44648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041095673.1|44651_45554_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_041095675.1|45560_46280_+	3-oxoacyl-ACP reductase FabG	NA	A0A0M4JSW6	Mollivirus	27.7	4.7e-10
WP_041095677.1|46289_47510_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_041095678.1|47512_47938_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_041095680.1|47939_48356_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_041095682.1|48361_49735_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_041095684.1|49715_50549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041095686.1|50549_51320_+	acetyl-CoA carboxylase	NA	NA	NA	NA	NA
WP_041095688.1|51344_52100_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_041095690.1|52109_52919_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003680381.1|53908_54124_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003681696.1|54321_54462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003680323.1|54473_54725_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_041095698.1|54739_55282_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_041095700.1|55309_55495_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_041095702.1|55506_56067_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_041095704.1|56264_56849_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	34.2	2.7e-19
WP_002825823.1|57208_58414_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024855732.1|58529_59906_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.5	1.3e-11
WP_155804434.1|60125_60932_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	29.4	7.2e-15
