The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	634274	686940	6814936	tRNA,tail,holin,plate	Pseudomonas_phage(24.0%)	55	NA	NA
WP_003085059.1|634274_635300_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|635378_635948_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|636031_636385_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085067.1|636375_636918_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003085069.1|636890_638123_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	1.6e-77
WP_003085071.1|638166_638673_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003085073.1|638767_640321_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003085075.1|640317_641589_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|641689_643612_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003085081.1|643890_644223_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003085083.1|644266_645118_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003085085.1|645117_645498_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003085087.1|645534_646341_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003085089.1|646456_647443_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|647439_648732_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|648712_651514_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003085094.1|651640_652657_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003085095.1|652653_653328_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003085097.1|653329_654088_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003085099.1|654088_655150_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_023098434.1|655301_657695_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|657740_658373_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|658501_659536_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|659769_660879_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003085111.1|660934_661981_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023656960.1|662095_663343_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|663448_664279_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|664402_665077_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003085124.1|665076_665895_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|665967_667446_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085128.1|667632_667947_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003085129.1|668046_668817_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	6.1e-72
WP_003085132.1|669274_669475_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|669522_669882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003137382.1|670244_670694_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003085139.1|670715_671231_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003085141.1|671227_671785_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|671937_672264_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|672260_673148_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|673140_673674_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_003085168.1|673675_675784_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	51.1	2.6e-218
WP_003085172.1|675792_676233_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_003085173.1|676275_677436_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|677448_677952_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|677966_678311_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023098436.1|678480_680718_+|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_003085182.1|680727_681600_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|681574_681781_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003085186.1|681838_682828_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	3.7e-106
WP_003085188.1|682860_683490_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_003085190.1|683486_683849_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	48.7	6.5e-16
WP_003118919.1|683845_684103_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003085194.1|684450_685056_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|685057_686107_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|686103_686940_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	1301288	1340733	6814936	tail,integrase,transposase	Pseudomonas_phage(98.15%)	54	1292614:1292629	1318851:1318866
1292614:1292629	attL	TTCCTCTCCGGCCTGC	NA	NA	NA	NA
WP_003094179.1|1301288_1301648_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_023657063.1|1301650_1302214_-	regulatory protein GemA	NA	J9RWI3	Pseudomonas_phage	100.0	5.0e-100
WP_003129239.1|1302200_1302668_-	hypothetical protein	NA	J9SH82	Pseudomonas_phage	100.0	6.3e-56
WP_003148480.1|1302669_1302888_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_003094188.1|1302889_1303579_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
WP_003094190.1|1303580_1304204_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	100.0	2.0e-110
WP_003148482.1|1304196_1304397_-	hypothetical protein	NA	J9SVU3	Pseudomonas_phage	100.0	2.7e-32
WP_100814931.1|1304389_1304743_-	hypothetical protein	NA	A0A0S4L050	Pseudomonas_phage	95.7	1.1e-60
WP_003148486.1|1305000_1305306_-	hypothetical protein	NA	A0A0S4L2V0	Pseudomonas_phage	99.0	1.1e-48
WP_003148488.1|1305302_1305644_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	98.2	3.9e-55
WP_003148490.1|1305645_1306815_-	AAA family ATPase	NA	A0A0S4L1G1	Pseudomonas_phage	97.4	2.7e-212
WP_023657067.1|1306814_1308593_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0S4L2U5	Pseudomonas_phage	99.5	0.0e+00
WP_023657068.1|1308597_1309554_-	hypothetical protein	NA	A0A0S4L093	Pseudomonas_phage	93.1	3.5e-154
WP_031642102.1|1309611_1309911_-	helix-turn-helix domain-containing protein	NA	A0A0S4L7B4	Pseudomonas_phage	100.0	1.7e-46
WP_023442738.1|1309907_1310168_-	hypothetical protein	NA	A0A0S4L062	Pseudomonas_phage	100.0	6.0e-40
WP_023442737.1|1310160_1310649_-	hypothetical protein	NA	A0A0S4L5L2	Pseudomonas_phage	100.0	8.8e-93
WP_124214277.1|1310774_1311455_-	hypothetical protein	NA	A0A0S4L0N5	Pseudomonas_phage	99.5	9.7e-106
WP_023442735.1|1311481_1311802_+	hypothetical protein	NA	A0A0S4L532	Pseudomonas_phage	99.1	2.2e-52
WP_023657070.1|1311847_1312057_-	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	100.0	9.7e-33
WP_033894733.1|1312612_1312816_+	hypothetical protein	NA	A0A0S4L2S2	Pseudomonas_phage	98.5	8.8e-31
WP_173427251.1|1312871_1313759_-	hypothetical protein	NA	A0A0S4L2W3	Pseudomonas_phage	92.6	1.1e-157
WP_003094225.1|1313971_1314229_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_003094227.1|1314231_1314390_+	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	100.0	3.4e-22
WP_042933672.1|1314386_1315016_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	98.6	2.1e-118
WP_023657073.1|1315196_1315808_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_003094234.1|1315811_1316201_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_003094236.1|1316190_1316499_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	1.7e-54
WP_003094238.1|1316504_1317080_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_023657074.1|1317081_1318785_+	phage protein gp28	NA	J9SHP2	Pseudomonas_phage	100.0	0.0e+00
WP_023657075.1|1318784_1320263_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	100.0	4.2e-287
1318851:1318866	attR	TTCCTCTCCGGCCTGC	NA	NA	NA	NA
WP_003139984.1|1320262_1321513_+	hypothetical protein	NA	A0A0S4L0Q0	Pseudomonas_phage	100.0	8.5e-241
WP_003139982.1|1321509_1322079_+	phage virion morphogenesis protein	NA	A0A0S4L546	Pseudomonas_phage	100.0	5.4e-102
WP_074198081.1|1322366_1323536_+	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	99.7	3.9e-187
WP_023102437.1|1323539_1323917_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	100.0	3.2e-58
WP_003139975.1|1323928_1324858_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	100.0	7.6e-178
WP_003094256.1|1324904_1325099_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|1325098_1325425_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_023442966.1|1325432_1325942_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	99.4	2.3e-91
WP_023657076.1|1325943_1326399_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	96.7	1.5e-78
WP_003139972.1|1326395_1326605_+	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094267.1|1326608_1327361_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_003139971.1|1327362_1327869_+	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	100.0	3.2e-90
WP_003094272.1|1327865_1328009_+	hypothetical protein	NA	J9SNX9	Pseudomonas_phage	100.0	2.4e-19
WP_023657077.1|1328095_1331938_+|tail	phage tail length tape measure family protein	tail	A0A0S4L7E6	Pseudomonas_phage	97.0	0.0e+00
WP_023657078.1|1331945_1332902_+	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	96.5	9.2e-187
WP_023657079.1|1332903_1333827_+	hypothetical protein	NA	A0A0A7DJR0	Pseudomonas_phage	98.7	1.2e-183
WP_023657080.1|1333826_1335530_+	hypothetical protein	NA	A0A076FRD9	Pseudomonas_phage	97.9	0.0e+00
WP_023657081.1|1335519_1336341_+	phage BR0599 family protein	NA	A0A0A7DJU6	Pseudomonas_phage	97.4	2.8e-160
WP_023657082.1|1336349_1336589_+	hypothetical protein	NA	A0A0U5KN06	unidentified_phage	98.7	1.4e-38
WP_023102217.1|1336585_1336804_+	hypothetical protein	NA	A0A125RNE0	Pseudomonas_phage	100.0	9.8e-36
WP_023657083.1|1336793_1339001_+	hypothetical protein	NA	Q6TM49	Pseudomonas_phage	99.2	0.0e+00
WP_023657084.1|1338997_1340146_+	DUF2793 domain-containing protein	NA	A0A076FRD5	Pseudomonas_phage	99.0	1.5e-223
WP_023657085.1|1340142_1340430_+	hypothetical protein	NA	A0A076FSS3	Pseudomonas_phage	97.9	1.9e-47
WP_022580010.1|1340508_1340733_+	hypothetical protein	NA	Q5ZQV7	Pseudomonas_phage	98.6	5.5e-34
>prophage 3
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	1430337	1485102	6814936	tRNA,integrase,protease,transposase	Bacillus_phage(25.0%)	49	1438510:1438527	1462399:1462416
WP_003082462.1|1430337_1431162_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
WP_003086602.1|1431264_1431858_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_003082455.1|1432016_1432616_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_003082453.1|1432783_1433281_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_045404278.1|1433282_1434467_-	CoA transferase	NA	NA	NA	NA	NA
WP_003082447.1|1434555_1435695_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003086595.1|1435796_1436816_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_003086592.1|1436812_1437442_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_023098704.1|1437643_1438534_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1438510:1438527	attL	CGAGCAGGCCGCCGCCGA	NA	NA	NA	NA
WP_003082442.1|1438608_1439919_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_023098705.1|1440254_1441256_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_173427252.1|1441259_1444229_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	6.9e-15
WP_079396316.1|1444251_1444605_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000179844.1|1444572_1446252_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|1446254_1447247_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000376623.1|1447215_1447716_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|1447843_1448683_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|1448676_1449024_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_003159191.1|1449192_1449747_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_032492622.1|1449894_1450635_-	subclass B1 metallo-beta-lactamase IMP-34	NA	NA	NA	NA	NA
WP_003830719.1|1450753_1451086_-	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_000845048.1|1451324_1452338_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_023098450.1|1452514_1453945_+|transposase	IS1182-like element ISPa7 family transposase	transposase	NA	NA	NA	NA
WP_003082431.1|1454795_1455398_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_003082429.1|1455619_1455787_+	periplasmic nitrate reductase, NapE protein	NA	NA	NA	NA	NA
WP_003086571.1|1455795_1456287_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_003082422.1|1456279_1456609_+	chaperone NapD	NA	NA	NA	NA	NA
WP_003086569.1|1456589_1459094_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_003082414.1|1459104_1459596_+	cytochrome C protein NapB	NA	NA	NA	NA	NA
WP_003082412.1|1459606_1460203_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_003086565.1|1460234_1461431_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_003086563.1|1461887_1462622_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.2	1.7e-31
1462399:1462416	attR	TCGGCGGCGGCCTGCTCG	NA	NA	NA	NA
WP_045404285.1|1462665_1464591_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003082401.1|1464799_1465120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003082396.1|1465619_1466291_-	polysaccharide lyase family 7 protein	NA	NA	NA	NA	NA
WP_003086555.1|1466466_1467255_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_014603667.1|1467482_1468211_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_003086553.1|1468211_1469024_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.3	1.4e-13
WP_003086552.1|1469235_1471845_+	glycosyltransferase	NA	M1I277	Paramecium_bursaria_Chlorella_virus	26.8	1.1e-16
WP_003086551.1|1471959_1473111_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_003086550.1|1473110_1473914_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003082373.1|1473931_1474315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003082372.1|1474420_1474630_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	58.1	2.0e-14
WP_003082362.1|1474949_1476308_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.3	7.8e-14
WP_003082360.1|1476649_1477360_-	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	33.5	3.3e-32
WP_003082358.1|1478093_1480985_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.3	9.9e-184
WP_003086547.1|1481248_1482496_+	ribonucleotide-diphosphate reductase subunit beta	NA	K4K678	Caulobacter_phage	29.0	7.6e-32
WP_003086546.1|1482855_1483389_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_086937300.1|1483940_1485102_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.6	4.3e-85
>prophage 4
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	1637651	1694042	6814936	integrase,terminase,transposase,head,protease,portal,tail,holin,capsid	Pseudomonas_phage(68.18%)	73	1638994:1639053	1693148:1693211
WP_073660296.1|1637651_1638644_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.0	5.0e-10
1638994:1639053	attL	ATGGCGGAGAGATAGGGATTTGAACCCTAGGAGCCATTGCTGACTCAACGGATTTCGAAT	NA	NA	NA	NA
WP_023098716.1|1639186_1639450_-	hypothetical protein	NA	H2BDA2	Pseudomonas_phage	98.9	9.7e-46
WP_023098717.1|1639485_1639749_-	hypothetical protein	NA	H2BDD7	Pseudomonas_virus	90.7	2.0e-35
WP_023098718.1|1639745_1640114_-	hypothetical protein	NA	A0A125RNP2	Pseudomonas_phage	63.9	8.3e-27
WP_023098719.1|1640110_1640740_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	94.7	1.6e-110
WP_023098721.1|1642920_1645644_-	hypothetical protein	NA	A0A127KNI3	Pseudomonas_phage	84.3	0.0e+00
WP_014603776.1|1645615_1646023_-	hypothetical protein	NA	J7HX80	Pseudomonas_phage	98.5	3.4e-74
WP_023098722.1|1646027_1646519_-	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	96.9	1.6e-89
WP_033936236.1|1646502_1646982_-	hypothetical protein	NA	Q9MCA0	Pseudomonas_phage	98.1	2.5e-92
WP_033936239.1|1646978_1649429_-|tail	phage tail length tape measure family protein	tail	A0A0U4JEA4	Pseudomonas_phage	28.5	6.3e-30
WP_033936240.1|1649755_1650115_-|tail	phage tail assembly chaperone family protein, TAC	tail	Q9MCA4	Pseudomonas_phage	97.5	4.0e-58
WP_033936241.1|1650124_1650646_-|tail	phage major tail protein	tail	A0A0U4ISC1	Pseudomonas_phage	98.3	1.7e-94
WP_003101017.1|1650720_1651086_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	97.5	8.4e-64
WP_003101018.1|1651085_1651568_-	HK97 gp10 family phage protein	NA	K7PM60	Enterobacteria_phage	42.6	4.3e-31
WP_031630028.1|1651560_1652118_-	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	95.7	1.6e-106
WP_015648614.1|1652174_1652360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162836352.1|1652356_1653175_-	glycosyltransferase family 9 protein	NA	D4FUL8	Pseudomonas_phage	86.5	9.1e-143
WP_015648612.1|1653193_1653556_-	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	80.8	2.8e-51
WP_023098729.1|1653617_1654190_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_031630036.1|1654308_1654665_-|head	phage head closure protein	head	Q9XJT0	Pseudomonas_phage	98.3	2.8e-64
WP_012614021.1|1654665_1654986_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0U4JX27	Pseudomonas_phage	100.0	1.8e-54
WP_169309829.1|1654966_1655371_-	hypothetical protein	NA	D4FUL7	Pseudomonas_phage	97.8	9.9e-74
WP_023098730.1|1655729_1656917_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	97.2	3.3e-210
WP_023098731.1|1656913_1657804_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	98.3	2.1e-164
WP_031630043.1|1657807_1659112_-|portal	phage portal protein	portal	H2BDA8	Pseudomonas_virus	99.3	1.6e-250
WP_003088450.1|1659104_1659269_-	hypothetical protein	NA	Q9MCB1	Pseudomonas_phage	100.0	2.8e-19
WP_023098733.1|1659265_1660957_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	98.6	0.0e+00
WP_023098734.1|1660958_1661339_-	hypothetical protein	NA	Q9XJT7	Pseudomonas_phage	97.6	2.7e-65
WP_033936245.1|1661551_1661866_-	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	94.2	1.5e-53
WP_033936247.1|1662366_1662585_-	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	86.4	1.1e-23
WP_033936248.1|1662953_1663238_-|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	100.0	3.2e-47
WP_033936249.1|1663230_1663599_-	membrane protein	NA	A0A0S2SYH4	Pseudomonas_phage	99.2	2.3e-61
WP_023098737.1|1663954_1665178_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	60.2	7.5e-133
WP_023098998.1|1665736_1666423_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	97.8	2.0e-130
WP_033936255.1|1666419_1667004_-	recombination protein NinG	NA	A0A125RNK9	Pseudomonas_phage	92.3	5.8e-99
WP_033936256.1|1667000_1667471_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	71.8	1.7e-61
WP_033936257.1|1667463_1667670_-	TraR/DksA family transcriptional regulator	NA	A0A0S2SYW7	Pseudomonas_phage	92.5	1.1e-28
WP_169309828.1|1667671_1668154_-	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	98.1	7.6e-81
WP_023093580.1|1668293_1668980_-	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	86.8	2.6e-114
WP_023093581.1|1668979_1670320_-	replicative DNA helicase	NA	A0A0S2SYB4	Pseudomonas_phage	97.8	5.5e-246
WP_033936259.1|1670316_1671306_-	replication protein	NA	Q9MC55	Pseudomonas_phage	95.4	4.9e-175
WP_033936260.1|1671499_1672072_-	hypothetical protein	NA	A0A0S2SYA8	Pseudomonas_phage	97.4	4.8e-98
WP_012614002.1|1672107_1672305_-	helix-turn-helix domain-containing protein	NA	A0A2H4JF66	uncultured_Caudovirales_phage	59.0	3.4e-11
WP_033936270.1|1672420_1673227_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6Q0	uncultured_Caudovirales_phage	47.0	1.3e-48
WP_033936262.1|1673399_1674440_+	ParA family protein	NA	NA	NA	NA	NA
WP_169309827.1|1674825_1675479_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_169309826.1|1675831_1676134_+	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	95.0	2.0e-47
WP_023657539.1|1676143_1676350_+	hypothetical protein	NA	A0A0U4ISE6	Pseudomonas_phage	98.5	2.5e-33
WP_045404312.1|1676648_1677890_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	96.1	1.3e-63
WP_023098759.1|1678110_1678602_+	hypothetical protein	NA	H2BDH2	Pseudomonas_virus	81.1	4.4e-68
WP_123906742.1|1678895_1679228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098761.1|1679262_1679502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098762.1|1679719_1679944_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	100.0	3.7e-38
WP_023098763.1|1679940_1680306_+	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	90.1	3.3e-60
WP_010792309.1|1680340_1681486_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	74.1	5.9e-164
WP_023657541.1|1681616_1682129_+	hypothetical protein	NA	A0A291I9C8	Pseudomonas_phage	52.3	6.1e-44
WP_023098765.1|1682235_1683267_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	57.2	3.5e-107
WP_023098766.1|1683263_1683401_+	hypothetical protein	NA	A0A0S2SY24	Pseudomonas_phage	97.7	1.9e-16
WP_023657542.1|1683551_1683857_+	hypothetical protein	NA	A0A2H4JCG5	uncultured_Caudovirales_phage	56.2	2.9e-25
WP_023127333.1|1683899_1684709_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	57.6	1.9e-87
WP_023127334.1|1684705_1685536_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	46.6	9.2e-58
WP_023127335.1|1685532_1685994_+	single-stranded DNA-binding protein	NA	A0A0S2SY36	Pseudomonas_phage	90.7	7.6e-70
WP_023127336.1|1686057_1686657_+	hypothetical protein	NA	A0A0U4JEE7	Pseudomonas_phage	97.5	3.1e-108
WP_023127337.1|1686819_1687044_+	hypothetical protein	NA	A0A0U4J8X2	Pseudomonas_phage	100.0	1.6e-36
WP_023098773.1|1688182_1688632_+	hypothetical protein	NA	A0A0U2KZ33	Pseudomonas_phage	86.6	3.7e-53
WP_023098774.1|1688624_1689068_+	hypothetical protein	NA	A0A125RNQ6	Pseudomonas_phage	45.0	2.1e-16
WP_023098775.1|1689060_1689357_+	Lar family restriction alleviation protein	NA	H2BDE9	Pseudomonas_virus	71.4	4.6e-28
WP_031630072.1|1689669_1690119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098777.1|1690111_1690393_+	hypothetical protein	NA	A0A127KNQ8	Pseudomonas_phage	69.1	6.3e-27
WP_023098779.1|1691238_1691574_+	hypothetical protein	NA	J7HXK7	Pseudomonas_phage	50.4	1.2e-19
WP_162836351.1|1691570_1691732_+	hypothetical protein	NA	Q9MC85	Pseudomonas_phage	98.1	5.7e-25
WP_031630076.1|1692064_1693039_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	99.1	6.1e-178
WP_003086275.1|1693331_1694042_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.6	1.1e-40
1693148:1693211	attR	ATGGCGGAGAGATAGGGATTTGAACCCTAGGAGCCATTGCTGACTCAACGGATTTCGAATCCGT	NA	NA	NA	NA
>prophage 5
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	1912424	2005357	6814936	integrase,tRNA,terminase,head,protease,portal,lysis,tail,holin,capsid	Pseudomonas_phage(68.42%)	107	1912564:1912581	2011406:2011423
WP_003085891.1|1912424_1912838_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
1912564:1912581	attL	GCCAGGCGCTCCAGGGCA	NA	NA	NA	NA
WP_003085889.1|1912959_1913343_-	lysozyme inhibitor	NA	NA	NA	NA	NA
WP_003085884.1|1913495_1914914_-	amino acid permease	NA	NA	NA	NA	NA
WP_023657684.1|1915211_1916285_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_003085876.1|1916606_1917395_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003085873.1|1917478_1917652_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_003085871.1|1917677_1918637_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003085869.1|1918687_1919470_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_003134291.1|1919544_1922001_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.3	5.9e-20
WP_003085865.1|1922295_1924086_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	4.3e-36
WP_003145641.1|1924078_1924681_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003085861.1|1924720_1925659_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_003085859.1|1925823_1926129_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_003120754.1|1926142_1926691_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_003085857.1|1926858_1927878_+	DUF2804 domain-containing protein	NA	NA	NA	NA	NA
WP_003085854.1|1928006_1929401_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003085852.1|1929393_1930017_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003085850.1|1930296_1931466_+	chitin-binding protein CbpD	NA	NA	NA	NA	NA
WP_003085848.1|1931642_1932605_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_003085846.1|1932615_1933035_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_003085844.1|1933288_1934239_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.1	4.9e-55
WP_003085842.1|1934372_1934972_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_073660181.1|1934904_1937112_+	diguanylate cyclase	NA	A0A2K8I9Y5	Pseudomonas_phage	35.1	3.2e-09
WP_003085838.1|1937196_1937937_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_014603629.1|1938314_1940327_+	neutral/alkaline ceramidase	NA	NA	NA	NA	NA
WP_003085833.1|1940668_1942861_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_009315289.1|1942878_1943502_+	phospholipase C accessory protein PlcR	NA	NA	NA	NA	NA
WP_003085828.1|1943589_1944810_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_003085826.1|1944813_1945773_-	DegV family protein	NA	NA	NA	NA	NA
WP_003085824.1|1945963_1947076_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003085819.1|1947116_1947707_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085818.1|1947859_1948342_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003085816.1|1948547_1949033_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003109430.1|1949001_1949340_+	DUF3565 domain-containing protein	NA	NA	NA	NA	NA
WP_003085814.1|1949339_1950524_+	acetate kinase	NA	NA	NA	NA	NA
WP_003085813.1|1950586_1952701_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003085811.1|1952827_1953742_+	acyltransferase	NA	NA	NA	NA	NA
WP_003085808.1|1953811_1954525_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003085806.1|1954630_1955272_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003085802.1|1955373_1956393_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085801.1|1956517_1957351_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003085798.1|1957484_1958426_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.3	4.4e-08
WP_003085795.1|1958534_1959218_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085791.1|1959305_1960184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031293705.1|1960788_1961514_-	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	59.0	1.5e-56
WP_045404367.1|1962872_1966442_-|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	76.0	0.0e+00
WP_022580264.1|1966498_1967071_-|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	63.6	1.3e-58
WP_015649318.1|1967119_1967536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649319.1|1967532_1967775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085782.1|1967821_1968580_-	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	75.7	2.1e-117
WP_034064784.1|1968582_1969329_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.9	2.7e-117
WP_003085778.1|1969325_1969664_-|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	49.1	1.1e-28
WP_003085775.1|1969663_1972921_-|tail	phage tail tape measure protein	tail	A0A2D1GNQ1	Pseudomonas_phage	35.9	4.0e-80
WP_003085773.1|1972961_1973189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085771.1|1973185_1973530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085769.1|1973574_1974075_-	hypothetical protein	NA	A0A2D1GNF2	Pseudomonas_phage	79.3	2.8e-70
WP_003085767.1|1974107_1974494_-	DUF3168 domain-containing protein	NA	A0A2D1GNT4	Pseudomonas_phage	63.8	4.9e-38
WP_023103986.1|1974486_1975059_-	hypothetical protein	NA	A0A2D1GNN2	Pseudomonas_phage	48.9	1.3e-39
WP_172907803.1|1975062_1975254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022580265.1|1975262_1975589_-|head,tail	head-tail adaptor protein	head,tail	A0A2D1GNG1	Pseudomonas_phage	57.3	2.8e-18
WP_003085762.1|1975588_1975912_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	65.6	9.1e-30
WP_003085760.1|1975911_1976115_-	hypothetical protein	NA	A0A2H4JG33	uncultured_Caudovirales_phage	50.0	1.8e-07
WP_045404381.1|1976166_1977381_-|capsid	phage major capsid protein	capsid	A0A2H4J8D1	uncultured_Caudovirales_phage	67.1	1.5e-154
WP_003085756.1|1977377_1978022_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JA51	uncultured_Caudovirales_phage	75.7	3.5e-89
WP_023103987.1|1978005_1979223_-|portal	phage portal protein	portal	A0A2H4JFN7	uncultured_Caudovirales_phage	73.2	1.5e-170
WP_034064783.1|1979225_1980905_-|terminase	terminase large subunit	terminase	A0A2H4JDK9	uncultured_Caudovirales_phage	65.6	3.6e-194
WP_003085748.1|1980908_1981400_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	37.0	3.2e-10
WP_023103989.1|1981814_1982144_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	53.7	5.1e-28
WP_003085741.1|1982143_1982617_-|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	89.1	3.3e-68
WP_003085739.1|1982623_1982854_-	hypothetical protein	NA	A0A2C9CY14	Yersinia_phage	60.6	4.1e-16
WP_003085737.1|1982867_1983479_-	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	91.1	4.0e-103
WP_004353177.1|1983475_1983808_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_003085732.1|1983893_1984424_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	37.3	1.2e-26
WP_003085729.1|1984952_1985510_-	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	97.1	1.2e-74
WP_003085726.1|1985506_1985791_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	96.6	4.5e-41
WP_003085724.1|1985787_1987185_-	AAA family ATPase	NA	A0A1W6JTB3	Pseudomonas_phage	99.8	1.5e-265
WP_049272142.1|1987181_1987802_-	ATP-binding protein	NA	A0A1W6JTD8	Pseudomonas_phage	99.0	8.5e-109
WP_023110585.1|1987977_1988817_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	95.0	4.3e-148
WP_023124259.1|1988813_1989044_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	98.7	2.0e-39
WP_045404389.1|1989040_1989805_-	Rha family transcriptional regulator	NA	A0A1W6JTB2	Pseudomonas_phage	98.0	4.5e-136
WP_173427253.1|1989801_1990293_-	hypothetical protein	NA	A0A1W6JTB9	Pseudomonas_phage	91.4	3.9e-80
WP_045404393.1|1990289_1990523_-	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	94.8	1.1e-32
WP_033955705.1|1990515_1990794_-	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	98.9	9.9e-41
WP_015648196.1|1990790_1991099_-	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	96.1	2.3e-46
WP_079380365.1|1991095_1991293_-	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	69.2	5.6e-14
WP_045404406.1|1991364_1991715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085704.1|1992020_1992413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023465045.1|1992409_1992748_-	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	49.4	7.9e-08
WP_014603618.1|1992836_1993628_+	helix-turn-helix transcriptional regulator	NA	A0A2K8HKD5	Pseudomonas_phage	81.2	2.5e-76
WP_019396631.1|1993740_1994034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012613694.1|1994030_1994390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236447.1|1994442_1994520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085698.1|1994710_1995097_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	95.8	8.3e-54
WP_014603617.1|1995099_1995333_+	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	98.7	1.5e-37
WP_003085694.1|1995432_1995687_+	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
WP_034064780.1|1995683_1996520_+	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	99.3	1.9e-127
WP_159108209.1|1996562_1997495_+	hypothetical protein	NA	Q775A9	Bordetella_phage	72.5	4.4e-40
WP_015648188.1|1997497_1997728_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	98.7	2.8e-33
WP_015648187.1|1997730_1998066_+	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	89.2	9.1e-49
WP_034014240.1|1998062_1998770_+	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	100.0	1.6e-47
WP_021205282.1|1998888_1999080_+	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	98.4	2.0e-29
WP_045404431.1|1999076_1999796_+	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	88.7	3.8e-116
WP_034064786.1|1999788_2000118_+	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	99.1	1.4e-57
WP_023083766.1|2000260_2001439_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	96.3	8.7e-211
WP_014603615.1|2001505_2001949_+	SocA family protein	NA	I6R0L8	Salmonella_phage	56.8	4.3e-46
WP_003085674.1|2002675_2004385_+	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_003085672.1|2004370_2005357_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	49.8	2.2e-90
2011406:2011423	attR	TGCCCTGGAGCGCCTGGC	NA	NA	NA	NA
>prophage 6
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	2586961	2625731	6814936	tail,integrase,transposase	Pseudomonas_phage(98.08%)	53	2588933:2588948	2626370:2626385
WP_003094179.1|2586961_2587321_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_023657063.1|2587323_2587887_-	regulatory protein GemA	NA	J9RWI3	Pseudomonas_phage	100.0	5.0e-100
WP_003129239.1|2587873_2588341_-	hypothetical protein	NA	J9SH82	Pseudomonas_phage	100.0	6.3e-56
WP_003148480.1|2588342_2588561_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_034066083.1|2588562_2589252_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	99.1	2.5e-125
2588933:2588948	attL	TCCGGCGCCGCCGCGC	NA	NA	NA	NA
WP_031638066.1|2589253_2589877_-	DUF3164 family protein	NA	J9SHK0	Pseudomonas_phage	100.0	4.5e-110
WP_033990702.1|2589869_2590070_-	bacteriophage protein	NA	J9RWL7	Pseudomonas_phage	100.0	1.3e-31
WP_003094193.1|2590062_2590437_-	hypothetical protein	NA	Q5ZR08	Pseudomonas_phage	94.4	3.9e-64
WP_003094195.1|2590436_2590718_-	hypothetical protein	NA	J9STZ0	Pseudomonas_phage	100.0	3.3e-44
WP_003094197.1|2590714_2591056_-	hypothetical protein	NA	J9SNT1	Pseudomonas_phage	100.0	9.3e-57
WP_003094200.1|2591057_2592224_-	AAA family ATPase	NA	J9SHF3	Pseudomonas_phage	100.0	1.8e-216
WP_034023955.1|2592223_2594008_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	99.3	0.0e+00
WP_034066084.1|2594011_2594989_-	hypothetical protein	NA	J9SND0	Pseudomonas_phage	99.7	3.4e-160
WP_003094211.1|2594998_2595313_-	hypothetical protein	NA	J9SH06	Pseudomonas_phage	100.0	1.2e-50
WP_003094213.1|2595309_2595570_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	100.0	1.6e-40
WP_023127890.1|2595562_2596051_-	hypothetical protein	NA	J9SVV8	Pseudomonas_phage	100.0	2.8e-91
WP_023127889.1|2596174_2596399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003094216.1|2596683_2596914_-	DNA-binding protein	NA	J9SNE2	Pseudomonas_phage	100.0	3.2e-37
WP_023127888.1|2597019_2597391_+	helix-turn-helix domain-containing protein	NA	J9SH16	Pseudomonas_phage	98.1	2.6e-20
WP_033990716.1|2598166_2598757_-	hypothetical protein	NA	A0A0S4L2W3	Pseudomonas_phage	89.2	7.2e-73
WP_003094225.1|2598969_2599227_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_003094227.1|2599229_2599388_+	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	100.0	3.4e-22
WP_042933672.1|2599384_2600014_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	98.6	2.1e-118
WP_023657073.1|2600194_2600806_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_003094234.1|2600809_2601199_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_003094236.1|2601188_2601497_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	1.7e-54
WP_003094238.1|2601502_2602078_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_023657074.1|2602079_2603783_+	phage protein gp28	NA	J9SHP2	Pseudomonas_phage	100.0	0.0e+00
WP_023657075.1|2603782_2605261_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	100.0	4.2e-287
WP_003139984.1|2605260_2606511_+	hypothetical protein	NA	A0A0S4L0Q0	Pseudomonas_phage	100.0	8.5e-241
WP_003139982.1|2606507_2607077_+	phage virion morphogenesis protein	NA	A0A0S4L546	Pseudomonas_phage	100.0	5.4e-102
WP_074198081.1|2607364_2608534_+	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	99.7	3.9e-187
WP_023102437.1|2608537_2608915_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	100.0	3.2e-58
WP_003139975.1|2608926_2609856_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	100.0	7.6e-178
WP_003094256.1|2609902_2610097_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|2610096_2610423_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_023442966.1|2610430_2610940_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	99.4	2.3e-91
WP_023657076.1|2610941_2611397_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	96.7	1.5e-78
WP_003139972.1|2611393_2611603_+	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094267.1|2611606_2612359_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_003139971.1|2612360_2612867_+	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	100.0	3.2e-90
WP_003094272.1|2612863_2613007_+	hypothetical protein	NA	J9SNX9	Pseudomonas_phage	100.0	2.4e-19
WP_023657077.1|2613093_2616936_+|tail	phage tail length tape measure family protein	tail	A0A0S4L7E6	Pseudomonas_phage	97.0	0.0e+00
WP_023657078.1|2616943_2617900_+	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	96.5	9.2e-187
WP_023657079.1|2617901_2618825_+	hypothetical protein	NA	A0A0A7DJR0	Pseudomonas_phage	98.7	1.2e-183
WP_023657080.1|2618824_2620528_+	hypothetical protein	NA	A0A076FRD9	Pseudomonas_phage	97.9	0.0e+00
WP_023657081.1|2620517_2621339_+	phage BR0599 family protein	NA	A0A0A7DJU6	Pseudomonas_phage	97.4	2.8e-160
WP_023657082.1|2621347_2621587_+	hypothetical protein	NA	A0A0U5KN06	unidentified_phage	98.7	1.4e-38
WP_023102217.1|2621583_2621802_+	hypothetical protein	NA	A0A125RNE0	Pseudomonas_phage	100.0	9.8e-36
WP_023657083.1|2621791_2623999_+	hypothetical protein	NA	Q6TM49	Pseudomonas_phage	99.2	0.0e+00
WP_023657084.1|2623995_2625144_+	DUF2793 domain-containing protein	NA	A0A076FRD5	Pseudomonas_phage	99.0	1.5e-223
WP_023657085.1|2625140_2625428_+	hypothetical protein	NA	A0A076FSS3	Pseudomonas_phage	97.9	1.9e-47
WP_022580010.1|2625506_2625731_+	hypothetical protein	NA	Q5ZQV7	Pseudomonas_phage	98.6	5.5e-34
2626370:2626385	attR	GCGCGGCGGCGCCGGA	NA	NA	NA	NA
>prophage 7
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	2747954	2756983	6814936		Bacillus_phage(33.33%)	8	NA	NA
WP_073660134.1|2747954_2748590_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.3e-40
WP_003092335.1|2748635_2749529_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|2749633_2750638_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|2751064_2751388_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003122151.1|2751454_2754022_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_003092265.1|2754147_2755155_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|2755302_2755809_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|2755942_2756983_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 8
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	3788345	3810611	6814936	integrase,protease,transposase	Virus_Rctr41k(100.0%)	26	3803616:3803630	3815664:3815678
WP_003090808.1|3788345_3788816_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_003090806.1|3789164_3789395_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_003090804.1|3789573_3789771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090802.1|3789836_3790166_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003090800.1|3790276_3790651_-	DUF5064 family protein	NA	NA	NA	NA	NA
WP_003090799.1|3790786_3791230_+	DedA family protein	NA	NA	NA	NA	NA
WP_003090798.1|3791382_3791700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090797.1|3791689_3792589_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003090796.1|3792811_3793045_+	DUF3509 domain-containing protein	NA	NA	NA	NA	NA
WP_003090795.1|3793110_3793341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003090794.1|3793315_3793834_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_003154870.1|3794428_3795568_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071534604.1|3795570_3797232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169309832.1|3797483_3799106_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_034082648.1|3799098_3799506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098552.1|3799893_3801000_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000179844.1|3801238_3802918_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|3802920_3803913_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
3803616:3803630	attL	GCGCCGGCCTTCCCC	NA	NA	NA	NA
WP_000376623.1|3803881_3804382_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|3804509_3805349_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|3805342_3805690_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_003159191.1|3805858_3806413_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_032492622.1|3806560_3807301_-	subclass B1 metallo-beta-lactamase IMP-34	NA	NA	NA	NA	NA
WP_003830719.1|3807419_3807752_-	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_000845048.1|3807990_3809004_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_023098450.1|3809180_3810611_+|transposase	IS1182-like element ISPa7 family transposase	transposase	NA	NA	NA	NA
3815664:3815678	attR	GCGCCGGCCTTCCCC	NA	NA	NA	NA
>prophage 9
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	4045090	4051984	6814936	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003090402.1|4045090_4046371_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	2.4e-97
WP_003108773.1|4046372_4047770_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003090397.1|4047774_4048749_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_023098569.1|4048836_4049820_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	73.4	1.0e-140
WP_003090393.1|4049816_4050152_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|4050148_4050454_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|4050453_4050813_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|4050809_4051205_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|4051315_4051984_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 10
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	4356311	4395572	6814936	tail,plate	Planktothrix_phage(33.33%)	32	NA	NA
WP_003089554.1|4356311_4357595_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_003089553.1|4357617_4358964_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_020750878.1|4359177_4360824_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_073660165.1|4360872_4362297_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_045404855.1|4362302_4364267_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	41.9	1.5e-34
WP_003089547.1|4364288_4365464_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_003089544.1|4365563_4366559_-	FecR family protein	NA	NA	NA	NA	NA
WP_003089542.1|4366719_4367199_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003089540.1|4367315_4368647_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_003139299.1|4368769_4371058_+	acylase	NA	NA	NA	NA	NA
WP_003114511.1|4371603_4372524_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003089528.1|4372620_4373772_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|4373838_4374081_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003089523.1|4374375_4374618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|4374883_4375354_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003089519.1|4375350_4377666_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003089517.1|4378082_4379288_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003089515.1|4379488_4380130_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|4380406_4380802_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003089510.1|4380824_4381361_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003089509.1|4381371_4383378_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	2.2e-41
WP_023098657.1|4383414_4384482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089506.1|4384520_4385054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014603835.1|4385127_4387677_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	5.5e-77
WP_003089501.1|4387678_4388695_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003089497.1|4388658_4390452_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003089496.1|4390435_4390861_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|4390873_4391371_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|4391444_4392929_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|4392951_4393497_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003089492.1|4393704_4394181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089486.1|4394240_4395572_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 11
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	4949441	5061286	6814936	integrase,tRNA,terminase,transposase,head,protease,portal,tail,holin,capsid	Pseudomonas_phage(61.8%)	126	4993225:4993284	5053877:5053937
WP_003087997.1|4949441_4950467_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	25.9	2.2e-21
WP_003087996.1|4950700_4951411_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003087993.1|4951471_4951786_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003087989.1|4952042_4953113_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003087987.1|4953137_4953905_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003087985.1|4954065_4954827_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	1.0e-10
WP_003087983.1|4954958_4955864_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003087981.1|4955860_4956505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003087979.1|4956605_4957385_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_003087976.1|4957352_4958189_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_045404950.1|4958188_4959877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003087972.1|4959916_4960729_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003087967.1|4960952_4962455_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_003087965.1|4962438_4963794_-	amino acid permease	NA	NA	NA	NA	NA
WP_003087961.1|4963817_4966073_-	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_003132809.1|4966266_4966656_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003087958.1|4966683_4967424_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.0	1.0e-39
WP_003087954.1|4967488_4967935_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	1.7e-34
WP_003087952.1|4967937_4968699_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003087949.1|4968800_4969577_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003120244.1|4969654_4971259_+	lytic transglycosylase domain-containing protein	NA	M1HNA7	Bacillus_virus	27.8	2.2e-07
WP_023098680.1|4971449_4973279_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003087944.1|4973275_4975123_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003087943.1|4975129_4976212_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_003087942.1|4976216_4977236_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003087940.1|4977237_4978848_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-20
WP_003087936.1|4978869_4979667_+	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_003087933.1|4979764_4981630_-	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003087931.1|4981861_4982134_-	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	60.7	2.5e-20
WP_003087926.1|4982269_4984666_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.5	4.5e-222
WP_003087924.1|4984797_4986078_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	1.1e-137
WP_003087922.1|4986182_4986824_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.5e-55
WP_003087920.1|4986917_4988228_-	trigger factor	NA	NA	NA	NA	NA
WP_003087915.1|4988459_4989167_+	response regulator	NA	W8CYM9	Bacillus_phage	33.2	3.5e-34
WP_003087912.1|4989167_4990454_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.0	6.1e-16
WP_003087908.1|4990558_4992391_+	serine hydrolase	NA	NA	NA	NA	NA
WP_003098121.1|4992677_4992893_-	hypothetical protein	NA	NA	NA	NA	NA
4993225:4993284	attL	GAAGGTGGTGCGGACGGAGAGACTCGAACTCTCACGCCTTGCGGCGCTGGAACCTAAATC	NA	NA	NA	NA
WP_023127344.1|4993415_4993679_-	hypothetical protein	NA	J7I447	Pseudomonas_phage	96.6	2.4e-44
WP_003088482.1|4993714_4993975_-	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	89.5	4.4e-35
WP_003088479.1|4993971_4994340_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	82.0	2.3e-45
WP_033990692.1|4994336_4994966_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	95.2	2.7e-110
WP_045405287.1|4995010_4995736_-	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	59.4	2.3e-57
WP_045404958.1|4997094_5000706_-|tail	phage tail protein	tail	A0A2D1GNE3	Pseudomonas_phage	56.1	0.0e+00
WP_003088475.1|5000761_5001340_-|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	64.4	2.3e-63
WP_003088474.1|5001336_5002119_-	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	74.8	2.9e-122
WP_003088473.1|5002121_5002823_-|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	74.4	8.5e-105
WP_031632697.1|5003380_5003728_-|tail	phage tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	51.3	3.2e-28
WP_045404964.1|5003728_5007118_-	tape measure protein	NA	B7SE05	Pseudomonas_virus	43.0	5.6e-69
WP_003088470.1|5008034_5008301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003088469.1|5008330_5008681_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_031632701.1|5008690_5009194_-|tail	phage major tail protein	tail	Q9MCA5	Pseudomonas_phage	71.7	9.5e-66
WP_031632703.1|5009257_5009623_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	96.7	2.4e-63
WP_031632705.1|5009622_5010096_-	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	53.0	1.3e-32
WP_031632706.1|5010088_5010646_-	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	94.6	3.6e-106
WP_045404966.1|5010656_5011469_-	hypothetical protein	NA	D4FUL8	Pseudomonas_phage	97.4	1.3e-160
WP_043084922.1|5011547_5012048_-	KilA-N domain-containing protein	NA	Q9XJS9	Pseudomonas_phage	100.0	7.4e-95
WP_033942774.1|5012164_5012521_-|head	phage head closure protein	head	Q9XJT0	Pseudomonas_phage	89.0	1.1e-57
WP_043084926.1|5012729_5013050_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H2BDB3	Pseudomonas_virus	88.7	5.3e-46
WP_170842737.1|5013030_5013435_-	hypothetical protein	NA	D4FUL7	Pseudomonas_phage	96.3	6.4e-73
WP_043084931.1|5013792_5014980_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	99.2	2.9e-214
WP_023657532.1|5014976_5015867_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	99.7	6.4e-166
WP_023657533.1|5015998_5017261_-|portal	phage portal protein	portal	Q9XJT5	Pseudomonas_phage	97.4	4.4e-237
WP_023657534.1|5017253_5017418_-	hypothetical protein	NA	Q9MCB1	Pseudomonas_phage	98.1	1.1e-18
WP_023657535.1|5017414_5019106_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	98.6	0.0e+00
WP_023108931.1|5019107_5019488_-	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	98.4	1.0e-64
WP_045404979.1|5019700_5020015_-	HNH endonuclease	NA	D4FUN2	Pseudomonas_phage	97.1	1.8e-54
WP_045404982.1|5020007_5020268_-	hypothetical protein	NA	Q9MC37	Pseudomonas_phage	95.3	3.2e-41
WP_045404984.1|5020264_5020516_-	hypothetical protein	NA	Q9MC38	Pseudomonas_phage	95.2	2.6e-40
WP_033985920.1|5020515_5020818_-	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	76.0	1.4e-35
WP_045404990.1|5020935_5021220_-|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	98.9	8.5e-48
WP_020989315.1|5021212_5021581_-	hypothetical protein	NA	A0A0S2SYH4	Pseudomonas_phage	99.2	6.7e-61
WP_024007940.1|5022355_5022928_-	hypothetical protein	NA	H2BDI9	Pseudomonas_virus	36.9	2.9e-26
WP_045404995.1|5022924_5023566_-	recombination protein NinG	NA	Q9MC46	Pseudomonas_phage	93.4	2.7e-110
WP_025297840.1|5023783_5023993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045404998.1|5023989_5024277_-	hypothetical protein	NA	Q9MC48	Pseudomonas_phage	42.0	6.5e-11
WP_045404999.1|5024273_5024861_-	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	99.5	2.8e-109
WP_170869356.1|5024853_5025261_-	hypothetical protein	NA	Q9MC50	Pseudomonas_phage	98.5	5.3e-75
WP_045405001.1|5025475_5025688_-	TraR/DksA family transcriptional regulator	NA	H2BDI2	Pseudomonas_virus	80.0	1.2e-25
WP_170986999.1|5025689_5026172_-	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	99.4	5.3e-82
WP_052484316.1|5026195_5026963_-	HNH endonuclease	NA	A0A2I7S653	Vibrio_phage	39.0	4.9e-21
WP_023081923.1|5026959_5028345_-	replicative DNA helicase	NA	A0A127KNK8	Pseudomonas_phage	52.3	2.7e-123
WP_079396315.1|5028337_5029033_-	helix-turn-helix domain-containing protein	NA	H2BD69	Pseudomonas_phage	63.5	6.1e-31
WP_052484317.1|5029044_5029641_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_015980312.1|5030148_5030370_-	helix-turn-helix domain-containing protein	NA	A0A125RNS7	Pseudomonas_phage	100.0	5.8e-36
WP_024007928.1|5030457_5031126_+	helix-turn-helix transcriptional regulator	NA	A0A125RNS6	Pseudomonas_phage	99.1	2.7e-124
WP_049821776.1|5031173_5031662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033991093.1|5031756_5032230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033867552.1|5032307_5033222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033991091.1|5033625_5034168_+	hypothetical protein	NA	A0A0S2SYL8	Pseudomonas_phage	97.8	6.6e-89
WP_033991089.1|5034176_5034617_+	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	97.9	7.7e-80
WP_020750346.1|5034730_5035384_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_169309826.1|5035757_5036060_+	hypothetical protein	NA	A0A0U4B0I0	Pseudomonas_phage	95.0	2.0e-47
WP_023657539.1|5036069_5036276_+	hypothetical protein	NA	A0A0U4ISE6	Pseudomonas_phage	98.5	2.5e-33
WP_045405013.1|5036574_5037843_+	hypothetical protein	NA	A0A0U3TGV3	Pseudomonas_phage	96.1	1.3e-63
WP_023098759.1|5038063_5038555_+	hypothetical protein	NA	H2BDH2	Pseudomonas_virus	81.1	4.4e-68
WP_123906742.1|5038848_5039181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098761.1|5039215_5039455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098762.1|5039672_5039897_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	100.0	3.7e-38
WP_023098763.1|5039893_5040259_+	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	90.1	3.3e-60
WP_010792309.1|5040293_5041439_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	74.1	5.9e-164
WP_023657541.1|5041569_5042082_+	hypothetical protein	NA	A0A291I9C8	Pseudomonas_phage	52.3	6.1e-44
WP_023098765.1|5042188_5043220_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	57.2	3.5e-107
WP_023098766.1|5043216_5043354_+	hypothetical protein	NA	A0A0S2SY24	Pseudomonas_phage	97.7	1.9e-16
WP_023657542.1|5043504_5043810_+	hypothetical protein	NA	A0A2H4JCG5	uncultured_Caudovirales_phage	56.2	2.9e-25
WP_023127333.1|5043852_5044662_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	57.6	1.9e-87
WP_023127334.1|5044658_5045489_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	46.6	9.2e-58
WP_023127335.1|5045485_5045947_+	single-stranded DNA-binding protein	NA	A0A0S2SY36	Pseudomonas_phage	90.7	7.6e-70
WP_023127336.1|5046010_5046610_+	hypothetical protein	NA	A0A0U4JEE7	Pseudomonas_phage	97.5	3.1e-108
WP_023127337.1|5046772_5046997_+	hypothetical protein	NA	A0A0U4J8X2	Pseudomonas_phage	100.0	1.6e-36
WP_023098773.1|5048135_5048585_+	hypothetical protein	NA	A0A0U2KZ33	Pseudomonas_phage	86.6	3.7e-53
WP_023098774.1|5048577_5049021_+	hypothetical protein	NA	A0A125RNQ6	Pseudomonas_phage	45.0	2.1e-16
WP_023098775.1|5049013_5049310_+	Lar family restriction alleviation protein	NA	H2BDE9	Pseudomonas_virus	71.4	4.6e-28
WP_031630072.1|5049622_5050072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098777.1|5050064_5050346_+	hypothetical protein	NA	A0A127KNQ8	Pseudomonas_phage	69.1	6.3e-27
WP_043103929.1|5051191_5051515_+	hypothetical protein	NA	A0A125RNP7	Pseudomonas_phage	86.9	2.2e-47
WP_033983778.1|5051514_5051754_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	60.8	3.8e-17
WP_034019798.1|5051753_5051948_+	hypothetical protein	NA	B5WZV0	Pseudomonas_phage	89.1	3.0e-28
WP_033980821.1|5051928_5052384_+	hypothetical protein	NA	A0A0U4IIZ7	Pseudomonas_phage	99.3	6.5e-82
WP_077828780.1|5052484_5052877_+	helix-turn-helix domain-containing protein	NA	Q9MC86	Pseudomonas_phage	100.0	6.3e-49
WP_023104132.1|5052762_5053872_+|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	99.2	5.1e-213
WP_003087898.1|5054502_5055357_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	3.0e-27
5053877:5053937	attR	GAAGGTGGTGCGGACGGAGAGACTCGAACTCTCACGCCTTGCGGCGCTGGAACCTAAATCC	NA	NA	NA	NA
WP_003087895.1|5055414_5056797_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	6.9e-42
WP_023098681.1|5056806_5058477_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	60.3	1.4e-198
WP_003087890.1|5058599_5059097_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.4e-13
WP_003087888.1|5059101_5059824_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_003087885.1|5059954_5061286_+	hypothetical protein	NA	A0A0F6WCV7	Sinorhizobium_phage	28.1	5.3e-39
>prophage 12
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	5599860	5651744	6814936	coat,tail,integrase,transposase	Pseudomonas_phage(94.44%)	61	5599251:5599268	5629428:5629445
5599251:5599268	attL	CGGTCACCGTGTCGGCGG	NA	NA	NA	NA
WP_003086768.1|5599860_5601699_-	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	26.9	4.8e-06
WP_033894987.1|5603831_5604194_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	85.0	2.8e-51
WP_023657608.1|5604196_5604760_-	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	97.3	1.4e-97
WP_023657609.1|5604746_5605214_-	hypothetical protein	NA	J9STM8	Pseudomonas_phage	78.1	1.2e-54
WP_003148480.1|5605215_5605434_-	hypothetical protein	NA	J9STW0	Pseudomonas_phage	97.2	2.8e-30
WP_003094188.1|5605435_5606125_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
WP_003094190.1|5606126_5606750_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	100.0	2.0e-110
WP_014603989.1|5606742_5606943_-	hypothetical protein	NA	J9SVU3	Pseudomonas_phage	98.5	2.3e-31
WP_023657611.1|5607458_5608094_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	90.4	1.2e-49
WP_014603990.1|5608093_5608378_-	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_023657612.1|5608374_5608716_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	98.2	1.3e-55
WP_003094200.1|5608717_5609884_-	AAA family ATPase	NA	J9SHF3	Pseudomonas_phage	100.0	1.8e-216
WP_023657613.1|5609883_5611668_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9SGQ3	Pseudomonas_phage	97.8	0.0e+00
WP_023657614.1|5611671_5612646_-	hypothetical protein	NA	J9SW46	Pseudomonas_phage	98.7	9.8e-152
WP_023123661.1|5612655_5612970_-	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	99.0	1.0e-49
WP_023123662.1|5612966_5613227_-	hypothetical protein	NA	J9SNT9	Pseudomonas_phage	100.0	9.3e-41
WP_023123663.1|5613219_5613708_-	hypothetical protein	NA	J9SHM0	Pseudomonas_phage	100.0	7.5e-92
WP_023657615.1|5613835_5614327_-	hypothetical protein	NA	J9SGQ9	Pseudomonas_phage	78.5	2.1e-62
WP_023123664.1|5614340_5614571_-	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	100.0	3.2e-37
WP_023657617.1|5615176_5616310_-	hypothetical protein	NA	J9SWJ3	Pseudomonas_phage	100.0	3.4e-188
WP_003094225.1|5616522_5616780_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_162835947.1|5616782_5616941_+	hypothetical protein	NA	J9SP18	Pseudomonas_phage	100.0	1.5e-22
WP_023657072.1|5616937_5617567_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	100.0	2.9e-120
WP_023657073.1|5617747_5618359_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_003094234.1|5618362_5618752_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_003094236.1|5618741_5619050_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	1.7e-54
WP_003094238.1|5619055_5619631_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_023657074.1|5619632_5621336_+	phage protein gp28	NA	J9SHP2	Pseudomonas_phage	100.0	0.0e+00
WP_023657075.1|5621335_5622814_+	DUF935 family protein	NA	A0A0S4L5M4	Pseudomonas_phage	100.0	4.2e-287
WP_003139984.1|5622813_5624064_+	hypothetical protein	NA	A0A0S4L0Q0	Pseudomonas_phage	100.0	8.5e-241
WP_003139982.1|5624060_5624630_+	phage virion morphogenesis protein	NA	A0A0S4L546	Pseudomonas_phage	100.0	5.4e-102
WP_074198081.1|5624917_5626087_+	peptidase	NA	A0A0S4L0J5	Pseudomonas_phage	99.7	3.9e-187
WP_023102437.1|5626090_5626468_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	100.0	3.2e-58
WP_003139975.1|5626479_5627409_+	hypothetical protein	NA	A0A0S4L2T7	Pseudomonas_phage	100.0	7.6e-178
WP_003094256.1|5627455_5627650_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|5627649_5627976_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_023442966.1|5627983_5628493_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	99.4	2.3e-91
WP_023657076.1|5628494_5628950_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	96.7	1.5e-78
WP_003139972.1|5628946_5629156_+	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094267.1|5629159_5629912_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
5629428:5629445	attR	CCGCCGACACGGTGACCG	NA	NA	NA	NA
WP_003139971.1|5629913_5630420_+	hypothetical protein	NA	A0A0S4L2X3	Pseudomonas_phage	100.0	3.2e-90
WP_003094272.1|5630416_5630560_+	hypothetical protein	NA	J9SNX9	Pseudomonas_phage	100.0	2.4e-19
WP_023657077.1|5630646_5634489_+|tail	phage tail length tape measure family protein	tail	A0A0S4L7E6	Pseudomonas_phage	97.0	0.0e+00
WP_023657078.1|5634496_5635453_+	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	96.5	9.2e-187
WP_023657079.1|5635454_5636378_+	hypothetical protein	NA	A0A0A7DJR0	Pseudomonas_phage	98.7	1.2e-183
WP_023657080.1|5636377_5638081_+	hypothetical protein	NA	A0A076FRD9	Pseudomonas_phage	97.9	0.0e+00
WP_023657081.1|5638070_5638892_+	phage BR0599 family protein	NA	A0A0A7DJU6	Pseudomonas_phage	97.4	2.8e-160
WP_023657082.1|5638900_5639140_+	hypothetical protein	NA	A0A0U5KN06	unidentified_phage	98.7	1.4e-38
WP_023102217.1|5639136_5639355_+	hypothetical protein	NA	A0A125RNE0	Pseudomonas_phage	100.0	9.8e-36
WP_023657083.1|5639344_5641552_+	hypothetical protein	NA	Q6TM49	Pseudomonas_phage	99.2	0.0e+00
WP_023657084.1|5641548_5642697_+	DUF2793 domain-containing protein	NA	A0A076FRD5	Pseudomonas_phage	99.0	1.5e-223
WP_023657085.1|5642693_5642981_+	hypothetical protein	NA	A0A076FSS3	Pseudomonas_phage	97.9	1.9e-47
WP_022580010.1|5643059_5643284_+	hypothetical protein	NA	Q5ZQV7	Pseudomonas_phage	98.6	5.5e-34
WP_003094968.1|5643689_5644328_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003094970.1|5644330_5645614_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	39.1	1.1e-60
WP_003094972.1|5645946_5646495_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003135089.1|5646525_5647059_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_023098841.1|5647058_5647601_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003094976.1|5647619_5648408_+	molecular chaperone	NA	NA	NA	NA	NA
WP_003094977.1|5648424_5650800_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003094979.1|5650796_5651744_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 13
NZ_AP014622	Pseudomonas aeruginosa strain NCGM1900	6814936	6464952	6520427	6814936	integrase,holin,transposase	Shigella_phage(33.33%)	48	6484871:6484886	6505414:6505429
WP_003299771.1|6464952_6467946_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003089113.1|6467958_6468171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150552.1|6468178_6468454_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089115.1|6468466_6468817_-	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003089120.1|6468891_6469290_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003464995.1|6469592_6470438_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003464991.1|6470467_6470986_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_003100847.1|6471492_6472050_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|6472043_6472415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|6472411_6472912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|6472908_6473235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|6473489_6473846_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100872.1|6474082_6474469_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|6474465_6474756_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_023098897.1|6475044_6476550_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_031347193.1|6476560_6477688_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_086221909.1|6477687_6478845_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023098898.1|6478847_6480617_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	5.6e-20
WP_021250124.1|6480641_6481634_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_021250123.1|6481739_6482396_+	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011222094.1|6482520_6483144_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	47.6	2.2e-35
WP_023657929.1|6483205_6484423_-	TniQ family protein	NA	NA	NA	NA	NA
WP_023098901.1|6484419_6485328_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
6484871:6484886	attL	TCGTCGATCACCAGCA	NA	NA	NA	NA
WP_023098902.1|6485330_6487010_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077575469.1|6487243_6488404_-	TniQ family protein	NA	NA	NA	NA	NA
WP_023098904.1|6488422_6489328_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_023098905.1|6489334_6491269_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_049878009.1|6491265_6492054_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_003096496.1|6493494_6495480_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	29.1	1.5e-26
WP_003096497.1|6495522_6496572_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_014604122.1|6496722_6497640_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003096500.1|6497788_6499255_+	NorM family multidrug efflux MATE transporter	NA	NA	NA	NA	NA
WP_003121292.1|6499166_6500843_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_003110454.1|6501030_6503040_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	36.5	6.0e-111
WP_003096506.1|6503173_6504892_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_003096508.1|6505055_6505628_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
6505414:6505429	attR	TGCTGGTGATCGACGA	NA	NA	NA	NA
WP_073660206.1|6505635_6507495_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_003098270.1|6507704_6508115_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_003096513.1|6508336_6508885_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003096515.1|6509035_6510109_-	alanine racemase	NA	NA	NA	NA	NA
WP_023098907.1|6510199_6510553_-	RidA family protein	NA	NA	NA	NA	NA
WP_003096519.1|6510527_6511826_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_003096521.1|6512182_6512527_-	YdbL family protein	NA	NA	NA	NA	NA
WP_003096523.1|6512539_6512731_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_023098908.1|6512751_6515319_-	YdbH domain-containing protein	NA	NA	NA	NA	NA
WP_003096535.1|6515472_6515961_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_003096537.1|6516138_6517458_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_023098450.1|6518996_6520427_+|transposase	IS1182-like element ISPa7 family transposase	transposase	NA	NA	NA	NA
