The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	15617	54424	2924929	transposase	unidentified_phage(57.14%)	32	NA	NA
WP_010620018.1|15617_16670_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013826.1|16890_17592_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	2.3e-33
WP_025013825.1|20378_21635_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_025013824.1|21829_22939_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025013823.1|22958_24032_-	ammonium transporter	NA	NA	NA	NA	NA
WP_025013820.1|24940_25174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041084699.1|25323_26376_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.9	6.6e-37
WP_025013819.1|26562_27114_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013818.1|27138_27945_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_025013817.1|27953_28274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010490228.1|28381_29155_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_025013816.1|29457_30096_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013815.1|31843_32455_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_025013814.1|32485_32830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039639761.1|33184_34975_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	22.6	1.6e-11
WP_039639765.1|35161_36214_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	1.7e-37
WP_025013883.1|36336_37104_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_025013884.1|37100_38006_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_025013885.1|38384_39536_-	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_025013886.1|39542_40247_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_039639758.1|40256_41606_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_025013853.1|42565_43945_+	aspartate kinase	NA	NA	NA	NA	NA
WP_025013854.1|43946_44954_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_025013855.1|44957_46016_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_039639756.1|46203_47619_-|transposase	IS5-like element ISLca2 family transposase	transposase	NA	NA	NA	NA
WP_025013856.1|47961_48291_+	YxeA family protein	NA	NA	NA	NA	NA
WP_025013857.1|48416_48629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039639753.1|48651_48921_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041084700.1|48969_50214_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	5.7e-11
WP_025014001.1|50697_51111_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_039639749.1|52206_52473_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010620018.1|53371_54424_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
>prophage 2
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	80995	122710	2924929	transposase	unidentified_phage(50.0%)	39	NA	NA
WP_052253378.1|80995_81574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025013475.1|81820_82045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041084701.1|82238_83300_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	1.0e-40
WP_039638697.1|83442_85050_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	5.1e-12
WP_025013998.1|85046_85349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013999.1|85677_86373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010620018.1|86512_87565_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_039639785.1|87775_88828_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013725.1|89560_90541_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_025013726.1|90650_91718_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_025013727.1|91878_92130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039639736.1|92285_93371_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_025013728.1|93565_94057_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EL10	Moumouvirus	44.6	2.4e-13
WP_025013729.1|94168_95170_+	D-2-hydroxyisocaproate dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	34.4	3.6e-48
WP_025013731.1|95546_95897_-	YisL family protein	NA	NA	NA	NA	NA
WP_039639733.1|96094_97552_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.3	1.8e-40
WP_025013732.1|97676_98000_+	DsrE family protein	NA	NA	NA	NA	NA
WP_039639731.1|98006_98981_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_025013734.1|99173_99470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013735.1|99592_100168_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080769636.1|100202_100337_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_010620018.1|101013_102066_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_107750378.1|102286_104212_+	cell surface complex protein	NA	NA	NA	NA	NA
WP_025013576.1|104227_104578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013577.1|104580_105348_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_025013578.1|105430_106519_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_039639729.1|108514_109498_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_025013579.1|109601_109931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013580.1|110090_111437_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	44.1	2.7e-91
WP_039639727.1|111632_112823_+	acetate kinase	NA	NA	NA	NA	NA
WP_025013581.1|112956_113709_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_025013582.1|113874_115371_+	xylulose kinase	NA	NA	NA	NA	NA
WP_025013583.1|115383_116253_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_025013584.1|116360_117692_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_025013585.1|117813_118635_-	serine/threonine protein phosphatase	NA	A8AT52	Listeria_phage	26.8	1.9e-10
WP_025013586.1|118759_119464_+	endonuclease III	NA	NA	NA	NA	NA
WP_010489927.1|119496_119793_+	thiamine-binding protein	NA	NA	NA	NA	NA
WP_010620018.1|120394_121447_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_039639675.1|121657_122710_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	3.5e-38
>prophage 3
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	197213	264629	2924929	transposase	unidentified_phage(45.45%)	50	NA	NA
WP_010620018.1|197213_198266_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_041084702.1|199546_201004_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_025013803.1|201181_201865_-	hydrolase	NA	C1KFL4	Lactobacillus_virus	64.4	3.5e-23
WP_010489757.1|202414_203173_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_025013802.1|203257_204040_+	glycosyltransferase family 2 protein	NA	A0A0N9R0I0	Chrysochromulina_ericina_virus	28.7	8.5e-05
WP_025013801.1|204058_204820_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_025013800.1|204902_205235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010489740.1|205319_205919_-	signal peptidase I	NA	NA	NA	NA	NA
WP_025013799.1|205991_206927_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_025013798.1|207353_208901_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	5.7e-45
WP_025013797.1|209037_209784_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025013992.1|215531_215852_+	thioredoxin family protein	NA	A0A1J0GW78	Streptomyces_phage	36.0	1.5e-11
WP_025013991.1|215848_216625_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_025013990.1|216642_217101_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_039639675.1|218618_219671_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	3.5e-38
WP_025013840.1|220126_221029_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_039639673.1|221021_222338_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_032959094.1|222677_223352_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_025013842.1|223353_224544_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_025013843.1|224570_225287_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_025013844.1|225478_226891_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	47.1	2.9e-19
WP_156129371.1|227342_227486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010620018.1|227567_228620_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_052253375.1|228670_230416_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_032958806.1|230471_231341_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_025013247.1|231358_231724_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_039639668.1|231749_233174_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_039639666.1|233294_234659_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025013248.1|234791_235628_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_025013249.1|235624_236305_-	hypothetical protein	NA	U5PU21	Bacillus_phage	33.8	4.9e-17
WP_025013250.1|236282_238670_-	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_025013251.1|238895_240188_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025013252.1|240364_241015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052253394.1|241323_242997_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_025013254.1|243599_245534_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_025013255.1|245526_245982_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025013256.1|245997_247443_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039639662.1|247716_248688_+	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_025013257.1|249042_249759_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013258.1|249772_250954_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_025013259.1|251030_252191_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_039639660.1|252291_254088_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_010492740.1|254091_254574_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_025013260.1|254586_255498_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_025013261.1|255484_256306_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_010492747.1|256447_256828_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010620018.1|257263_258316_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013924.1|259240_260107_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_039639656.1|260144_262088_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_041084703.1|263576_264629_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	2.3e-37
>prophage 4
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	343225	415076	2924929	head,tail,transposase,protease,holin,capsid,integrase,terminase,portal	Lactobacillus_phage(77.59%)	82	362651:362669	401586:401604
WP_010620018.1|343225_344278_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_010620018.1|344919_345972_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013508.1|346409_347021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013509.1|347475_350010_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.3	4.0e-64
WP_025013510.1|350528_351971_+	amino acid permease	NA	NA	NA	NA	NA
WP_039639621.1|353434_353935_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_025013511.1|354095_354989_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013512.1|355143_356010_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_039639619.1|356115_356949_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025013513.1|357043_357913_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_025013514.1|359171_360071_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_039639618.1|360435_361266_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_025013515.1|361321_362251_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	63.0	1.7e-105
362651:362669	attL	GGGGACAAAAAGGGGACAA	NA	NA	NA	NA
WP_015975063.1|362675_363845_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	100.0	2.6e-223
WP_025013516.1|364019_364382_-	hypothetical protein	NA	A0A0P0I7G8	Lactobacillus_phage	95.8	3.4e-57
WP_015975065.1|364439_365213_-	helix-turn-helix transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	100.0	8.6e-143
WP_016366000.1|365370_365622_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	98.6	4.2e-30
WP_015975066.1|365618_366383_+	phage repressor protein/antirepressor Ant	NA	Q6J1W3	Lactobacillus_phage	100.0	1.6e-141
WP_032959348.1|366517_366763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015975068.1|367007_367364_+	DUF771 domain-containing protein	NA	Q6J1W1	Lactobacillus_phage	100.0	1.4e-63
WP_164476268.1|367448_367601_+	hypothetical protein	NA	U5U721	Lactobacillus_phage	98.0	1.5e-19
WP_015975069.1|367605_367809_+	hypothetical protein	NA	Q6J1W0	Lactobacillus_phage	100.0	4.7e-32
WP_015975070.1|367827_368313_+	siphovirus Gp157 family protein	NA	Q6J1V9	Lactobacillus_phage	100.0	3.1e-82
WP_015975071.1|368313_369021_+	AAA family ATPase	NA	Q6J1V8	Lactobacillus_phage	100.0	2.5e-133
WP_015975072.1|369024_369582_+	DUF669 domain-containing protein	NA	Q6J1V7	Lactobacillus_phage	100.0	7.9e-106
WP_015975073.1|369596_370394_+	hypothetical protein	NA	Q6J1V6	Lactobacillus_phage	100.0	2.3e-143
WP_015975074.1|370380_371163_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	100.0	6.0e-144
WP_025013903.1|371159_371492_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	96.3	1.5e-51
WP_025013904.1|371488_371938_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	91.8	5.3e-68
WP_039639614.1|372079_372481_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	70.8	7.6e-50
WP_025013905.1|372493_372958_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	97.4	5.0e-13
WP_025013906.1|372997_373249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013907.1|373245_373851_+	hypothetical protein	NA	A0A141HRB7	Flavobacterium_phage	57.1	1.4e-26
WP_025013908.1|373969_374254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013909.1|374250_374820_+	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	60.8	8.2e-50
WP_025013910.1|374806_375010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013911.1|374999_375203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013912.1|375192_375561_+	hypothetical protein	NA	C1KFT5	Lactobacillus_virus	49.2	1.1e-18
WP_025013913.1|375557_375827_+	hypothetical protein	NA	Q6J1U5	Lactobacillus_phage	94.4	7.8e-43
WP_039639611.1|375823_376147_+	hypothetical protein	NA	Q6J1U4	Lactobacillus_phage	94.7	2.6e-45
WP_025013954.1|376322_376742_+	hypothetical protein	NA	Q6J1U2	Lactobacillus_phage	100.0	1.0e-41
WP_025013953.1|376987_377431_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	90.5	2.7e-72
WP_025013952.1|377789_378938_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	96.9	8.4e-219
WP_039639606.1|378950_379481_+	HNH endonuclease	NA	Q8LTA0	Lactobacillus_phage	64.9	7.4e-61
WP_025013951.1|379483_379804_+	ribonucleoside-diphosphate reductase	NA	Q6J1T4	Lactobacillus_phage	91.4	3.8e-52
WP_025013950.1|379806_380535_+	hypothetical protein	NA	U5U409	Lactobacillus_phage	56.1	8.7e-28
WP_162483681.1|380568_380715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041084704.1|380734_381229_+	HNH endonuclease	NA	A8YQN7	Lactobacillus_phage	95.1	6.8e-93
WP_015975042.1|381368_381836_+|terminase	phage terminase small subunit P27 family	terminase	Q6J1Y7	Lactobacillus_phage	100.0	3.8e-85
WP_015975043.1|381822_383712_+|terminase	terminase large subunit	terminase	Q6J1Y6	Lactobacillus_phage	100.0	0.0e+00
WP_015975044.1|383711_383885_+	hypothetical protein	NA	Q6J1Y5	Lactobacillus_phage	100.0	4.4e-23
WP_015975045.1|383891_385049_+|portal	phage portal protein	portal	Q6J1Y4	Lactobacillus_phage	100.0	1.0e-216
WP_025013898.1|385038_385725_+|protease	Clp protease ClpP	protease	Q6J1Y3	Lactobacillus_phage	99.6	3.3e-122
WP_015975047.1|385724_386909_+|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	100.0	3.4e-215
WP_015975048.1|386979_387324_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	100.0	4.2e-57
WP_015975049.1|387313_387658_+|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	100.0	3.8e-58
WP_015975050.1|387660_388080_+	HK97 gp10 family phage protein	NA	Q6J1X9	Lactobacillus_phage	100.0	2.1e-71
WP_041084705.1|388076_388448_+	DUF806 family protein	NA	Q6J1X8	Lactobacillus_phage	99.2	3.8e-64
WP_015975052.1|388459_389092_+|tail	phage tail protein	tail	Q6J1X7	Lactobacillus_phage	100.0	1.3e-115
WP_015975053.1|389249_389600_+|tail	tail component	tail	Q6J1X6	Lactobacillus_phage	100.0	1.2e-56
WP_025014019.1|389577_389808_+	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	1.2e-36
WP_080769638.1|389837_394064_+	transglycosylase SLT domain-containing protein	NA	Q3L0S4	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.6	0.0e+00
WP_039639596.1|394064_395579_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	75.1	2.4e-269
WP_039639594.1|395579_398093_+|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	74.9	0.0e+00
WP_025014032.1|398102_398393_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	84.4	9.3e-42
WP_032959329.1|398385_398517_+	XkdX family protein	NA	A0A0P0HRS7	Lactobacillus_phage	95.3	2.5e-18
WP_080769576.1|398547_398946_+	hypothetical protein	NA	A8YQK4	Lactobacillus_phage	93.1	3.8e-62
WP_016369922.1|398914_399121_+	hypothetical protein	NA	A8YQK5	Lactobacillus_phage	92.3	3.2e-12
WP_039639592.1|399117_399564_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	96.6	9.9e-67
WP_015975061.1|399574_400756_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	100.0	4.1e-229
WP_015975062.1|400873_401374_+	hypothetical protein	NA	Q6J1W7	Lactobacillus_phage	100.0	1.3e-94
WP_025013995.1|401703_402489_+	hypothetical protein	NA	NA	NA	NA	NA
401586:401604	attR	GGGGACAAAAAGGGGACAA	NA	NA	NA	NA
WP_010620018.1|402651_403704_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013756.1|403848_404988_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_025013757.1|405082_405895_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039639589.1|405970_406684_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025013759.1|407922_408837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039639586.1|408992_410381_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_025013760.1|411282_411951_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_025013761.1|412138_413164_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_025013762.1|413144_413609_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_010620018.1|414023_415076_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
>prophage 5
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	642987	779602	2924929	head,tail,transposase,tRNA,protease,holin,capsid,integrase,terminase,portal	Lactobacillus_phage(79.46%)	146	705691:705727	771258:771294
WP_041084710.1|642987_644040_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	37.3	3.4e-41
WP_039639503.1|644254_645238_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_032959189.1|645155_645527_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_129334725.1|645802_646129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013930.1|647055_647235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013931.1|647476_648061_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	39.9	6.1e-24
WP_032959192.1|648124_648508_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039639501.1|656969_658127_-|integrase	tyrosine-type recombinase/integrase	integrase	O64373	Lactobacillus_phage	97.9	1.7e-219
WP_021354153.1|658298_658919_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	35.8	7.9e-22
WP_025013977.1|658985_659408_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0Y2S4	Lactobacillus_phage	40.3	1.7e-23
WP_025013976.1|659400_659745_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y3N1	Lactobacillus_phage	41.7	1.5e-17
WP_025013975.1|660000_660246_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	95.1	1.2e-37
WP_039639497.1|660248_661019_+	phage antirepressor KilAC domain-containing protein	NA	Q6J1W3	Lactobacillus_phage	75.5	1.0e-98
WP_025014042.1|661136_661349_-	hypothetical protein	NA	Q9T0Z0	Lactobacillus_phage	98.6	5.8e-33
WP_003596708.1|661414_661705_+	DUF771 domain-containing protein	NA	Q9T0Y9	Lactobacillus_phage	99.0	1.8e-53
WP_164476271.1|661825_661978_+	hypothetical protein	NA	A0A2D1GP73	Lactobacillus_phage	98.0	8.9e-20
WP_039639494.1|661982_662186_+	hypothetical protein	NA	Q6J1W0	Lactobacillus_phage	98.5	5.2e-31
WP_025014062.1|662204_662690_+	siphovirus Gp157 family protein	NA	Q6J1V9	Lactobacillus_phage	99.4	7.0e-82
WP_025014013.1|662693_663221_+	HNH endonuclease	NA	A0A1P8BKS1	Lactococcus_phage	41.3	2.6e-26
WP_025014012.1|663220_663958_+	AAA family ATPase	NA	A8YQL5	Lactobacillus_phage	69.1	3.8e-87
WP_025014011.1|663961_664519_+	DUF669 domain-containing protein	NA	B4XYS5	Lactobacillus_phage	92.4	2.1e-98
WP_039639492.1|664533_665331_+	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	81.9	1.3e-114
WP_039639490.1|665317_666100_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	95.0	3.6e-136
WP_025013941.1|666096_666429_+	hypothetical protein	NA	Q6J1V4	Lactobacillus_phage	83.6	6.7e-44
WP_015975076.1|666425_666875_+	hypothetical protein	NA	Q6J1V3	Lactobacillus_phage	100.0	5.8e-75
WP_015975077.1|666877_667261_+	DUF1064 domain-containing protein	NA	Q6J1V2	Lactobacillus_phage	100.0	1.3e-67
WP_015975078.1|667280_668006_+	HNH endonuclease	NA	Q6J1V1	Lactobacillus_phage	100.0	3.6e-106
WP_015975079.1|668017_668203_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	100.0	7.5e-29
WP_015975080.1|668199_668607_+	hypothetical protein	NA	Q6J1U9	Lactobacillus_phage	100.0	5.6e-77
WP_015975081.1|668603_669131_+	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	100.0	5.2e-99
WP_025013942.1|669120_669495_+	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	46.9	4.5e-20
WP_025013943.1|669491_669701_+	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	94.2	2.2e-29
WP_025013944.1|669807_670077_+	hypothetical protein	NA	Q6J1U5	Lactobacillus_phage	91.0	1.1e-41
WP_039639486.1|670073_670397_+	hypothetical protein	NA	Q6J1U4	Lactobacillus_phage	93.6	2.2e-44
WP_025014026.1|670572_670998_+	hypothetical protein	NA	U5U4M8	Lactobacillus_phage	59.9	3.2e-38
WP_039639481.1|672023_673241_+	phage protein	NA	A8YQN3	Lactobacillus_phage	98.0	3.8e-238
WP_025014036.1|673227_673755_+	HNH endonuclease	NA	Q6J1T5	Lactobacillus_phage	97.1	2.3e-94
WP_015975095.1|673758_674082_+	hypothetical protein	NA	Q6J1T4	Lactobacillus_phage	100.0	7.9e-58
WP_039639479.1|674251_674746_+	HNH endonuclease	NA	A8YQN7	Lactobacillus_phage	96.3	6.2e-94
WP_025013901.1|674885_675353_+|terminase	phage terminase small subunit P27 family	terminase	Q6J1Y7	Lactobacillus_phage	95.5	3.0e-82
WP_039639477.1|675339_677229_+|terminase	terminase large subunit	terminase	A8YQI8	Lactobacillus_phage	98.3	0.0e+00
WP_164476273.1|677228_677402_+	hypothetical protein	NA	A8YQI9	Lactobacillus_phage	98.2	2.9e-22
WP_025013900.1|677408_678560_+|portal	phage portal protein	portal	A8YQJ0	Lactobacillus_phage	97.1	9.3e-210
WP_025013899.1|678556_679243_+|protease	Clp protease ClpP	protease	A8YQJ1	Lactobacillus_phage	96.1	6.5e-118
WP_039639475.1|679242_680427_+|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	92.4	3.8e-198
WP_015975048.1|680497_680842_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	100.0	4.2e-57
WP_015975049.1|680831_681176_+|head	phage head closure protein	head	Q6J1Y0	Lactobacillus_phage	100.0	3.8e-58
WP_015975050.1|681178_681598_+	HK97 gp10 family phage protein	NA	Q6J1X9	Lactobacillus_phage	100.0	2.1e-71
WP_025014015.1|681594_681966_+	DUF806 family protein	NA	Q6J1X8	Lactobacillus_phage	98.4	1.1e-63
WP_039639473.1|681977_682613_+|tail	phage tail protein	tail	Q6J1X7	Lactobacillus_phage	100.0	1.1e-111
WP_039639471.1|682770_683121_+|tail	tail protein	tail	Q6J1X6	Lactobacillus_phage	97.4	1.2e-54
WP_025014019.1|683098_683329_+	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.7	1.2e-36
WP_164476283.1|683358_687363_+	transglycosylase SLT domain-containing protein	NA	Q6J1X5	Lactobacillus_phage	96.7	0.0e+00
WP_039639467.1|687363_689346_+|tail	phage tail family protein	tail	Q6J1X4	Lactobacillus_phage	99.7	0.0e+00
WP_015975056.1|689413_689665_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	100.0	8.4e-39
WP_096772843.1|689670_690561_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.1e-157
WP_041084712.1|690796_693217_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	99.5	0.0e+00
WP_039638757.1|693218_693548_+	hypothetical protein	NA	A8YQK2	Lactobacillus_phage	60.2	2.5e-30
WP_003564877.1|693544_693670_+	XkdX family protein	NA	A8YQK3	Lactobacillus_phage	90.2	1.0e-13
WP_025014054.1|693718_694117_+	hypothetical protein	NA	A8YQK4	Lactobacillus_phage	92.4	4.2e-61
WP_016369922.1|694085_694292_+	hypothetical protein	NA	A8YQK5	Lactobacillus_phage	92.3	3.2e-12
WP_041084713.1|694288_694867_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.5	3.8e-50
WP_025014034.1|694877_696176_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	86.1	1.1e-201
WP_025013782.1|696649_696844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010493845.1|697625_698168_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_080769584.1|698618_700319_+	APC family permease	NA	NA	NA	NA	NA
WP_025013780.1|700553_701762_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_025013779.1|701764_702793_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_025013778.1|702805_703825_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_025013777.1|703959_705132_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010493839.1|705298_705574_+	YkuJ family protein	NA	NA	NA	NA	NA
705691:705727	attL	GCCATTTAGGCTTGAGGCCACTTACACTCCGATTTCT	NA	NA	NA	NA
WP_039638771.1|706069_708166_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	46.6	3.3e-152
WP_025013988.1|708466_708928_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_025013656.1|714717_715845_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	98.9	2.0e-212
WP_025013657.1|716098_716785_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_032959024.1|717030_717708_-	tcdA-E operon negative regulator	NA	O64371	Lactobacillus_phage	96.4	1.8e-88
WP_025013659.1|717762_718626_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GPK3	Lactobacillus_phage	67.8	7.2e-98
WP_003575669.1|718765_719002_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025013660.1|719002_719746_+	antA/AntB antirepressor family protein	NA	A0A2D1GPQ2	Lactobacillus_phage	91.5	1.4e-121
WP_025013661.1|719759_720032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013662.1|720028_720556_+	hypothetical protein	NA	D2XQ14	Bacillus_virus	46.1	1.1e-19
WP_025013663.1|720692_720905_-	hypothetical protein	NA	Q9T0Z0	Lactobacillus_phage	98.6	1.3e-32
WP_025013664.1|720970_721327_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	97.5	3.4e-62
WP_016375940.1|721411_721564_+	hypothetical protein	NA	U5U721	Lactobacillus_phage	100.0	3.1e-20
WP_025013665.1|721568_721772_+	hypothetical protein	NA	B4XYS2	Lactobacillus_phage	94.0	3.4e-30
WP_025013666.1|721790_722276_+	siphovirus Gp157 family protein	NA	B4XYS3	Lactobacillus_phage	98.1	1.3e-80
WP_032959027.1|722276_722999_+	AAA family ATPase	NA	Q9T0Y5	Lactobacillus_phage	98.3	3.8e-132
WP_025013668.1|722961_724329_+	DEAD/DEAH box helicase family protein	NA	Q9T0Y3	Lactobacillus_phage	97.8	3.2e-257
WP_025013669.1|724325_724868_+	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	99.4	1.1e-99
WP_039638777.1|724886_727199_+	DNA primase	NA	Q9T0Y1	Lactobacillus_phage	99.2	0.0e+00
WP_025013670.1|727457_727811_+	hypothetical protein	NA	Q9T0Y0	Lactobacillus_phage	96.6	5.1e-58
WP_025013671.1|727807_728134_+	VRR-NUC domain-containing protein	NA	Q9T0X9	Lactobacillus_phage	99.0	4.3e-51
WP_025013672.1|728124_728310_+	hypothetical protein	NA	Q6J1V0	Lactobacillus_phage	88.5	3.0e-25
WP_025013673.1|728306_728816_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	69.8	1.6e-60
WP_015975082.1|728805_729174_+	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	100.0	2.3e-69
WP_025013674.1|729166_729439_+	hypothetical protein	NA	Q6J1U6	Lactobacillus_phage	97.8	1.2e-43
WP_025013675.1|729435_729705_+	hypothetical protein	NA	Q6J1U5	Lactobacillus_phage	98.9	1.7e-45
WP_039638780.1|729701_730025_+	hypothetical protein	NA	Q6J1U4	Lactobacillus_phage	98.9	7.4e-48
WP_025013978.1|730200_730653_+	hypothetical protein	NA	Q5ULU9	Lactobacillus_virus	62.9	2.4e-44
WP_025013980.1|730898_731351_+	autolysin regulatory protein arpU	NA	Q8LTA7	Lactobacillus_phage	96.7	1.4e-79
WP_025013981.1|731731_732388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013982.1|732380_732791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013983.1|733048_733267_-	CsbD family protein	NA	NA	NA	NA	NA
WP_039638785.1|733675_734893_+	phage protein	NA	A0A2D1GPQ9	Lactobacillus_phage	96.8	1.8e-235
WP_025014006.1|734879_735416_+	HNH endonuclease	NA	U5U4N5	Lactobacillus_phage	66.3	3.6e-63
WP_025014005.1|735419_735740_+	ribonucleoside-diphosphate reductase	NA	U5U741	Lactobacillus_phage	92.5	1.7e-52
WP_032959282.1|736090_736270_+	hypothetical protein	NA	B4XYU3	Lactobacillus_phage	78.0	1.5e-18
WP_025014003.1|736262_736598_+	HNH endonuclease	NA	A0A2H4J213	uncultured_Caudovirales_phage	53.8	6.4e-26
WP_039639334.1|736831_737050_+	hypothetical protein	NA	D2XR14	Bacillus_phage	39.7	2.1e-06
WP_010493863.1|737325_738003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010493862.1|737999_738893_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	22.7	3.4e-10
WP_025013893.1|740443_741751_+|portal	phage portal protein	portal	A8AT96	Listeria_phage	43.4	4.9e-82
WP_025013894.1|741728_742457_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	40.0	5.4e-38
WP_025013895.1|742478_743651_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	51.8	7.0e-104
WP_080648983.1|743647_743794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013896.1|743786_744077_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1S5SF81	Streptococcus_phage	47.3	1.2e-15
WP_003603962.1|744069_744450_+	hypothetical protein	NA	M9QX19	Staphylococcus_phage	32.7	6.1e-09
WP_010620018.1|744656_745709_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013788.1|746130_746508_+	hypothetical protein	NA	A0A059T681	Listeria_phage	43.2	1.1e-18
WP_025013787.1|746522_747113_+|tail	phage major tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	39.6	1.2e-32
WP_080769642.1|747130_747367_+	Ig domain-containing protein	NA	B8QTT6	Erwinia_phage	58.7	2.4e-11
WP_025013785.1|747442_747760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039638797.1|747939_751908_+|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	38.3	3.4e-09
WP_025013784.1|751904_753818_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	62.5	8.8e-221
WP_039638799.1|753818_756254_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	85.0	0.0e+00
WP_039638801.1|756255_756546_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	51.1	3.5e-20
WP_032959234.1|756538_756670_+	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	58.1	2.3e-08
WP_025013965.1|756700_757087_+	hypothetical protein	NA	U5U712	Lactobacillus_phage	96.1	1.5e-63
WP_025013966.1|757067_757277_+	hypothetical protein	NA	A0A2D1GPJ3	Lactobacillus_phage	97.4	5.5e-12
WP_025013967.1|757269_757716_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	96.6	9.9e-67
WP_039638802.1|757726_759025_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	94.0	1.5e-219
WP_025013969.1|759068_759293_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	97.3	1.4e-32
WP_025013970.1|759371_759872_+	hypothetical protein	NA	Q6J1W7	Lactobacillus_phage	86.1	3.2e-82
WP_025013971.1|759852_760485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025012482.1|760889_762533_-	membrane protein	NA	NA	NA	NA	NA
WP_025012483.1|766644_767691_+	DUF916 domain-containing protein	NA	NA	NA	NA	NA
WP_093997912.1|767721_767877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025012484.1|767983_768886_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_025012485.1|769169_769817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025012486.1|769996_771181_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.5	3.3e-141
WP_025012487.1|771562_773056_+	MFS transporter	NA	NA	NA	NA	NA
771258:771294	attR	AGAAATCGGAGTGTAAGTGGCCTCAAGCCTAAATGGC	NA	NA	NA	NA
WP_025012488.1|773221_773710_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025012489.1|773830_775309_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_025012490.1|775305_776031_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_025012491.1|776112_776787_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_025012492.1|777190_779602_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.2	0.0e+00
>prophage 6
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	803244	868617	2924929	holin,integrase,transposase,tRNA	Lactobacillus_phage(23.08%)	60	854679:854706	881278:881305
WP_025012508.1|803244_803754_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_010489470.1|803776_804184_+	DUF1149 family protein	NA	NA	NA	NA	NA
WP_025012509.1|804289_806608_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.4	2.9e-85
WP_025012510.1|806616_807879_+	insulinase family protein	NA	NA	NA	NA	NA
WP_039638820.1|807875_809171_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.6	1.8e-07
WP_025012511.1|809167_809896_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025012512.1|809982_810921_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025012513.1|810917_811511_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_025012514.1|811783_813025_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_025012515.1|813079_813997_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	53.2	6.7e-94
WP_010489446.1|814597_816169_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_025012516.1|816314_816968_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.5	5.2e-40
WP_039638822.1|816995_818258_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	38.9	4.5e-56
WP_025012517.1|818415_818934_+	ComF family protein	NA	NA	NA	NA	NA
WP_010489439.1|819058_819616_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_039638826.1|819884_822248_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_107750272.1|822506_823622_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_025012520.1|823700_824387_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	31.5	1.2e-26
WP_039638830.1|824376_825264_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039638831.1|825457_826567_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_010489426.1|826563_827271_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025012521.1|827263_828931_+	histidine kinase	NA	NA	NA	NA	NA
WP_025012522.1|829021_829888_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_025012523.1|830034_830958_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_010489412.1|830954_831839_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_025012524.1|831923_832742_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	7.5e-12
WP_010489407.1|832751_833516_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.9e-17
WP_010489405.1|833526_834204_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_025012525.1|834773_836264_+	daptomycin-sensing surface protein LiaX	NA	NA	NA	NA	NA
WP_010489401.1|836276_836537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025012526.1|836539_836875_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010489397.1|837078_838038_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_025012527.1|838039_838867_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_025012528.1|838877_839933_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010489391.1|839998_840946_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	47.9	3.0e-81
WP_039638835.1|841443_843171_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.9	8.6e-183
WP_010489378.1|843376_844024_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_039638837.1|844196_846212_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_025012530.1|846405_849294_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	1.7e-305
WP_025012531.1|849499_850039_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_010489370.1|850176_851064_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.2	2.2e-09
WP_025012532.1|851060_852089_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.7	8.6e-90
WP_025012533.1|852093_853041_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	41.0	2.9e-55
WP_025012534.1|853341_853797_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005684526.1|853914_854505_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	8.3e-53
854679:854706	attL	CTGCGTGTAAGGACCTTGGTCGCAATGG	NA	NA	NA	NA
WP_025012535.1|855193_856357_-|integrase	site-specific integrase	integrase	Q8W767	Lactobacillus_phage	58.1	1.8e-131
WP_080769586.1|856488_857241_-	Abi family protein	NA	NA	NA	NA	NA
WP_052253329.1|857277_857547_-	Abi family protein	NA	NA	NA	NA	NA
WP_156129363.1|857620_857785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039638840.1|857884_858937_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025014052.1|859092_859806_-	LexA family transcriptional regulator	NA	A0A2D1GPK3	Lactobacillus_phage	49.4	2.0e-53
WP_039639281.1|860084_861134_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	4.6e-38
WP_032959118.1|862658_863009_+	hypothetical protein	NA	B4XYQ5	Lactobacillus_phage	43.7	1.3e-18
WP_025013870.1|863018_863330_+	hypothetical protein	NA	A0A0P0IZK1	Lactobacillus_phage	48.5	4.5e-18
WP_032959115.1|863326_863458_+	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	72.1	2.6e-12
WP_025013871.1|863487_863778_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	89.6	6.1e-41
WP_025013872.1|863770_864217_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	91.9	5.1e-63
WP_025013873.1|864227_865550_+	hypothetical protein	NA	A0A1P8BKY1	Lactococcus_phage	50.1	1.2e-96
WP_025013874.1|865797_867171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039638840.1|867564_868617_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
881278:881305	attR	CTGCGTGTAAGGACCTTGGTCGCAATGG	NA	NA	NA	NA
>prophage 7
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	1389728	1486252	2924929	head,tail,transposase,tRNA,holin,capsid,integrase,terminase,portal	Lactobacillus_rhamnosus_Lc-Nu-like_prophage(25.0%)	88	1383147:1383206	1465495:1465560
1383147:1383206	attL	CTGCGTGTAAGGACCTTGGTCGCAATGGCAAAGACCGCCATCACGCCCAAGGCCACTTAC	NA	NA	NA	NA
WP_025012398.1|1389728_1391027_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	27.8	2.2e-50
WP_025012399.1|1391057_1392233_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_025012400.1|1392285_1392777_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_025012401.1|1392957_1395738_-	ribonuclease H-like domain-containing protein	NA	A0A127AW80	Bacillus_phage	24.4	8.5e-31
WP_039639030.1|1395781_1399492_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	21.9	5.1e-15
WP_025012402.1|1399488_1403028_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_025012403.1|1403150_1404086_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_039639032.1|1404093_1405098_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_025012404.1|1405063_1406098_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_039639034.1|1406188_1407520_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_025012405.1|1407506_1408463_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039639036.1|1408617_1409361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025012406.1|1409468_1409816_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_025012407.1|1409851_1410040_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_025012408.1|1410218_1411013_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_025012409.1|1410999_1411710_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
WP_080769592.1|1411859_1413110_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	1.1e-38
WP_025012411.1|1413123_1414893_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.7	1.7e-56
WP_025012412.1|1415088_1417158_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_025012413.1|1417159_1418056_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_039639039.1|1418462_1419632_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	31.4	1.0e-41
WP_025012414.1|1419674_1419995_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_107750274.1|1420123_1420270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025012415.1|1420858_1421356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025012416.1|1421562_1422717_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6J1W8	Lactobacillus_phage	60.8	1.5e-127
WP_025012417.1|1422719_1423052_-|holin	phage holin	holin	Q3L0R7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.8	5.9e-32
WP_025012418.1|1423064_1423298_-	hemolysin XhlA family protein	NA	Q3L0R9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	97.4	5.8e-34
WP_005689480.1|1423322_1423454_-	XkdX family protein	NA	Q3L0S0	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	90.7	4.2e-18
WP_025012419.1|1423446_1423722_-	hypothetical protein	NA	A0A0P0IZK1	Lactobacillus_phage	41.2	5.2e-10
WP_041084723.1|1427335_1428868_-|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	43.9	1.4e-131
WP_080769648.1|1428868_1433107_-	transglycosylase SLT domain-containing protein	NA	Q3L0S4	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	98.0	0.0e+00
WP_025013714.1|1433136_1433367_-	hypothetical protein	NA	Q3L0S5	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	97.4	1.9e-37
WP_025013713.1|1433344_1433695_-|tail	tail protein	tail	Q3L0S6	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	99.1	3.1e-55
WP_025013712.1|1433857_1434460_-|tail	phage tail protein	tail	A8YQJ7	Lactobacillus_phage	94.4	1.7e-101
WP_025013711.1|1434460_1434841_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.9	2.4e-61
WP_025013710.1|1434837_1435257_-	HK97 gp10 family phage protein	NA	Q3L0S9	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	88.5	3.7e-63
WP_025013709.1|1435259_1435604_-|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	84.1	1.6e-48
WP_025013708.1|1435593_1435884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013707.1|1435955_1437881_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	46.0	1.1e-69
WP_025013706.1|1437880_1438981_-|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	43.3	1.6e-78
WP_025013705.1|1438977_1439160_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_003561810.1|1439297_1440227_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_025013704.1|1440328_1442230_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	44.0	4.3e-151
WP_010620018.1|1442398_1443451_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_039639048.1|1443503_1443977_-|terminase	phage terminase small subunit P27 family	terminase	A0A0M7REI3	Lactobacillus_phage	40.5	2.2e-24
WP_025013623.1|1444459_1445020_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.2	9.6e-35
WP_107750381.1|1445251_1445428_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_025013625.1|1446811_1447099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013626.1|1447131_1448130_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	8.8e-55
WP_032959009.1|1448199_1448745_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_025013628.1|1448741_1449149_-	single-stranded DNA-binding protein	NA	A0A2H4J7Q4	uncultured_Caudovirales_phage	34.6	1.0e-09
WP_025013629.1|1449141_1449921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013630.1|1449922_1450111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052253342.1|1450172_1450796_-	HNH endonuclease	NA	H9EFE8	Lactococcus_phage	34.9	2.7e-14
WP_025013631.1|1450892_1452029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013632.1|1454263_1454542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013633.1|1455206_1455518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013634.1|1455629_1456445_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_039639053.1|1456444_1457347_-	GTPase Era	NA	NA	NA	NA	NA
WP_025013636.1|1457343_1457733_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_025013637.1|1457735_1458134_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_025013638.1|1458117_1458576_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_025013639.1|1458579_1459566_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.4	1.4e-49
WP_171020834.1|1459982_1460417_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	36.9	6.8e-12
WP_005687665.1|1460444_1460621_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_039639057.1|1460836_1462294_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_039639059.1|1462555_1463386_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_025013564.1|1463382_1464270_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	27.0	5.6e-21
WP_010488175.1|1464384_1465305_-	YitT family protein	NA	NA	NA	NA	NA
WP_025013563.1|1465584_1466028_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
1465495:1465560	attR	CTGCGTGTAAGGACCTTGGTCGCAATGGCAAAGACCGCCATCACGCCCAAGGCCACTTACACTCCG	NA	NA	NA	NA
WP_025013562.1|1466121_1467927_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	34.4	1.0e-05
WP_025013561.1|1467928_1469212_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010488169.1|1469881_1471204_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	30.7	2.3e-10
WP_025013560.1|1471284_1471911_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_025013559.1|1471910_1472357_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_039639357.1|1472480_1474706_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.1	3.1e-07
WP_025013558.1|1475043_1475367_-	membrane protein	NA	NA	NA	NA	NA
WP_025013557.1|1475404_1476133_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_039639062.1|1476132_1477086_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_025013555.1|1477147_1477642_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_025013554.1|1477638_1478244_-	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_010488157.1|1478348_1478597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013553.1|1478761_1479148_-	YxeA family protein	NA	NA	NA	NA	NA
WP_025013552.1|1479532_1479736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010488153.1|1479735_1480122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039639065.1|1481213_1482446_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	45.0	2.2e-79
WP_010488150.1|1485417_1485735_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_025012480.1|1485751_1486252_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	1829076	1838129	2924929	integrase,transposase	Lactobacillus_phage(42.86%)	9	1822996:1823009	1843149:1843162
1822996:1823009	attL	TTGATGAAATGATC	NA	NA	NA	NA
WP_039638840.1|1829076_1830129_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013764.1|1830274_1831303_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025013765.1|1831407_1832262_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_052253354.1|1832657_1832954_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	98.0	7.5e-47
WP_025013766.1|1832985_1833405_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0YA58	Lactobacillus_phage	98.6	1.3e-76
WP_025013767.1|1833463_1834033_+	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	52.1	1.7e-47
WP_025013768.1|1834141_1835305_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5C3	Streptococcus_phage	30.6	3.6e-44
WP_025013769.1|1835469_1837023_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	6.8e-14
WP_025013770.1|1837202_1838129_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.1	2.4e-30
1843149:1843162	attR	TTGATGAAATGATC	NA	NA	NA	NA
>prophage 9
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	2219055	2271881	2924929	protease,transposase,tRNA	unidentified_phage(28.57%)	47	NA	NA
WP_039638840.1|2219055_2220108_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013919.1|2220651_2221338_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025013921.1|2223013_2223616_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.8	4.8e-08
WP_025013922.1|2223745_2225077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039639232.1|2225510_2226563_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	3.5e-38
WP_025013694.1|2226831_2227716_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_025013695.1|2227715_2228312_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_010492225.1|2228961_2229501_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_010492226.1|2229503_2230286_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_025013696.1|2230254_2230686_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_025013697.1|2230682_2232089_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.6	8.0e-54
WP_025013698.1|2232445_2232706_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025013699.1|2232752_2234147_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_039639326.1|2234318_2235812_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025013700.1|2235958_2236786_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_080769651.1|2236935_2238057_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_025013702.1|2238346_2239123_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025013703.1|2239148_2240027_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.0	1.0e-35
WP_010620018.1|2240359_2241412_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013300.1|2241584_2242475_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013301.1|2242578_2243694_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_010492253.1|2243714_2245079_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_025013302.1|2245098_2245638_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.0	2.0e-37
WP_025013303.1|2245904_2246195_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_025013304.1|2246555_2247875_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	36.3	8.8e-63
WP_025013305.1|2248005_2249352_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	28.8	1.4e-47
WP_025013306.1|2249564_2250665_+	ABC transporter	NA	NA	NA	NA	NA
WP_032958847.1|2250664_2251858_+	ABC transporter	NA	NA	NA	NA	NA
WP_025013308.1|2251872_2252751_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	2.3e-11
WP_032958848.1|2255077_2257705_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.3	1.5e-82
WP_080769610.1|2257866_2258454_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_025013311.1|2258760_2259432_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_025013312.1|2259594_2260701_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_025013313.1|2260772_2261057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107750341.1|2261216_2262212_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_025013314.1|2262672_2262882_-	CsbD family protein	NA	NA	NA	NA	NA
WP_025013315.1|2263060_2263318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010492293.1|2263420_2263627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013316.1|2263826_2264081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039639383.1|2264423_2265668_+	MFS transporter	NA	NA	NA	NA	NA
WP_025013317.1|2265769_2267026_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.1	3.9e-108
WP_025013318.1|2267117_2267957_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.7	7.4e-47
WP_025013319.1|2268242_2268785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010620018.1|2269178_2270231_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_010492305.1|2270335_2270893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052253364.1|2271107_2271299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080769611.1|2271323_2271881_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	2276920	2305615	2924929	transposase,bacteriocin	unidentified_phage(83.33%)	23	NA	NA
WP_039639765.1|2276920_2277973_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.2	1.7e-37
WP_039640087.1|2278060_2279032_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_039640003.1|2279318_2280674_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_010620018.1|2283894_2284947_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_156129380.1|2285960_2286107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013933.1|2286273_2287575_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_025013934.1|2287576_2288383_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025013935.1|2288563_2288848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013937.1|2289113_2289335_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_032959198.1|2289454_2289616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013939.1|2289644_2289842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080769614.1|2290083_2291136_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	3.9e-37
WP_010620018.1|2291346_2292399_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013721.1|2292607_2293561_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_039639998.1|2293775_2294507_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025013720.1|2294541_2295687_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_025013719.1|2295698_2296016_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_025013718.1|2296067_2297444_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_025013717.1|2297594_2298350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013716.1|2298694_2300302_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_039639996.1|2300991_2303709_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	27.9	2.0e-61
WP_010492426.1|2303997_2304363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010620018.1|2304562_2305615_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
>prophage 11
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	2397171	2405332	2924929		Streptococcus_phage(100.0%)	8	NA	NA
WP_003606383.1|2397171_2397393_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.6	1.7e-27
WP_039639973.1|2397396_2397894_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	43.4	5.5e-34
WP_025012570.1|2397955_2398348_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.5	1.4e-45
WP_039639972.1|2398331_2400797_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	64.8	0.0e+00
WP_025012569.1|2400783_2402877_+	conjugal transfer protein	NA	A0A1S5SF30	Streptococcus_phage	52.3	1.0e-145
WP_025012568.1|2402873_2403869_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	60.3	1.5e-110
WP_025012567.1|2403878_2404412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025012566.1|2404408_2405332_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	39.0	3.5e-58
>prophage 12
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	2448706	2519675	2924929	protease,transposase,tRNA	unidentified_phage(15.38%)	45	NA	NA
WP_039639785.1|2448706_2449759_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013845.1|2450785_2451349_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_039639955.1|2451499_2452546_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_025013846.1|2452690_2453536_-	Fic family protein	NA	NA	NA	NA	NA
WP_010492653.1|2453712_2455815_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.6	4.8e-63
WP_003567577.1|2455904_2456375_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_010492654.1|2456507_2456924_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_041084794.1|2457229_2458687_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_039639950.1|2467009_2470687_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	23.9	5.0e-63
WP_025013528.1|2470699_2474302_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	25.7	2.3e-52
WP_039639948.1|2474651_2477159_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	35.2	2.8e-126
WP_039639946.1|2477197_2477665_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013390.1|2484218_2485718_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.5	5.1e-91
WP_025013389.1|2485866_2486868_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_025013388.1|2486930_2487815_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_039639944.1|2488084_2488720_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025013386.1|2488801_2490949_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	50.1	2.4e-110
WP_025013385.1|2491010_2491556_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.8	4.2e-11
WP_025013384.1|2491555_2492863_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	25.2	2.0e-06
WP_025013383.1|2492966_2493455_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_025013382.1|2493663_2494065_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_010491289.1|2494157_2494421_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_039639941.1|2494425_2496000_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_025013381.1|2496072_2499600_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_025013380.1|2499673_2500231_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003662706.1|2500705_2501713_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_025013379.1|2502020_2503391_+	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_010491258.1|2503605_2504271_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_025013378.1|2504593_2505292_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_005686631.1|2505361_2505745_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9V2U7	Faecalibacterium_phage	36.1	1.2e-09
WP_025013377.1|2505763_2506012_-	antitoxin	NA	NA	NA	NA	NA
WP_025013376.1|2506110_2507250_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	32.6	1.5e-37
WP_039639939.1|2507236_2507611_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_039638840.1|2507797_2508850_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013796.1|2509085_2510597_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	38.8	2.3e-70
WP_162483685.1|2510903_2511080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039640078.1|2511274_2512663_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_107750393.1|2512934_2513135_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_025013794.1|2513276_2514035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032959070.1|2514120_2514762_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_025013792.1|2514773_2515451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013791.1|2515546_2515975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013790.1|2516328_2516580_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_039639933.1|2516676_2517936_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_041084794.1|2518217_2519675_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	2624133	2708992	2924929	transposase,bacteriocin	unidentified_phage(50.0%)	70	NA	NA
WP_107750408.1|2624133_2625054_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_025013463.1|2630827_2631145_-	YxeA family protein	NA	NA	NA	NA	NA
WP_025013462.1|2631141_2631804_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.7	1.5e-18
WP_025013461.1|2631815_2633801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013460.1|2633922_2634213_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_129334703.1|2634622_2635423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013458.1|2635528_2635972_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025013457.1|2636101_2637496_+	MFS transporter	NA	NA	NA	NA	NA
WP_025013456.1|2637634_2639095_-	catalase	NA	A0A2K9L0T1	Tupanvirus	40.2	1.2e-100
WP_025013455.1|2639365_2640121_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_025013454.1|2640316_2641117_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_025013453.1|2641519_2641957_-	fucose isomerase	NA	NA	NA	NA	NA
WP_025013464.1|2641969_2643313_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_025013452.1|2644863_2646651_-	L-fucose isomerase	NA	NA	NA	NA	NA
WP_052253396.1|2647219_2647498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191978683.1|2647622_2647916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2648021_2648942_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_025013336.1|2649567_2650434_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025013335.1|2651479_2652160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080769625.1|2652159_2652894_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_025013333.1|2652890_2653526_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.4e-21
WP_025013332.1|2653515_2654040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013331.1|2654136_2654736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013330.1|2654769_2655915_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	34.5	5.0e-54
WP_039639887.1|2655958_2657335_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_010490817.1|2657390_2657678_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_025013329.1|2657697_2658162_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025013328.1|2658178_2658805_-	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_025013327.1|2658844_2660890_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_052253383.1|2661439_2662042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052253382.1|2662031_2662631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013326.1|2662658_2662985_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_025013325.1|2663332_2664763_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_025013324.1|2664762_2665656_-	ROK family protein	NA	NA	NA	NA	NA
WP_025013323.1|2665652_2666945_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_039639883.1|2666946_2669586_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_025013322.1|2669627_2670953_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_039639881.1|2671176_2671902_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013321.1|2672240_2672969_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_039639879.1|2672965_2673202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039639877.1|2673194_2674781_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_025013320.1|2674878_2675199_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_039639785.1|2675356_2676409_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025013736.1|2676497_2676977_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025013737.1|2677184_2677967_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_025013738.1|2678049_2678940_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_025013739.1|2678969_2680250_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_025013740.1|2680313_2680628_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_025013742.1|2682264_2683443_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_025013743.1|2683987_2684677_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_025013744.1|2685018_2685789_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013745.1|2685891_2686692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013746.1|2686957_2687803_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_039638870.1|2687891_2688953_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	6.9e-42
WP_107750408.1|2689383_2690304_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_039638870.1|2690667_2691729_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	6.9e-42
WP_039639874.1|2692387_2693632_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	4.3e-11
WP_003603298.1|2693833_2695513_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_010620018.1|2697612_2698665_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_003662080.1|2698919_2699489_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039639870.1|2699496_2702442_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025013972.1|2702532_2702757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144340550.1|2702887_2703675_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003606447.1|2704247_2704496_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_144340551.1|2704954_2705875_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	6.9e-22
WP_025014030.1|2706367_2706553_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_025014031.1|2706580_2707102_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_016378630.1|2707116_2707368_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_107750403.1|2707379_2707520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041084820.1|2707747_2708992_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.9	1.1e-09
>prophage 14
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	2767152	2820094	2924929	head,tail,transposase,protease,holin	unidentified_phage(44.44%)	44	NA	NA
WP_039638870.1|2767152_2768214_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	6.9e-42
WP_025013776.1|2769379_2770399_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013775.1|2770556_2771405_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025013774.1|2771401_2772277_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025013773.1|2772508_2772883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080769628.1|2772928_2773189_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_039639843.1|2773704_2775306_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010490455.1|2775309_2776056_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	7.3e-30
WP_025013772.1|2776379_2776625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039639841.1|2778201_2779254_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	4.6e-38
WP_025014021.1|2779388_2780102_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_025014022.1|2780173_2780512_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_025014023.1|2780663_2780987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039639839.1|2781592_2782063_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_025013566.1|2782055_2783585_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_039639837.1|2783613_2784390_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_025013567.1|2784522_2785410_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_010490433.1|2785567_2786308_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	2.0e-32
WP_032958965.1|2786304_2787759_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025013569.1|2788035_2789496_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025013570.1|2789701_2790250_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039639834.1|2790316_2790511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013571.1|2790694_2791318_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_039639832.1|2791557_2792493_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_039639830.1|2792499_2793492_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_025013572.1|2793484_2795644_+	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_025013573.1|2796174_2797284_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_039639828.1|2797447_2798842_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_025013574.1|2798982_2799573_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_010620018.1|2799747_2800800_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_025014061.1|2800950_2801370_-	YjdF family protein	NA	NA	NA	NA	NA
WP_039639827.1|2801635_2803093_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032959206.1|2803407_2803884_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107750397.1|2804080_2804572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577148.1|2804843_2805212_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003568375.1|2805323_2805572_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003568371.1|2805587_2805728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013947.1|2806525_2806819_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q38218	Leuconostoc_phage	39.3	4.9e-06
WP_010620018.1|2807965_2809018_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_080769629.1|2809184_2809976_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021353390.1|2810162_2810252_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_032959341.1|2812294_2813437_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_144340552.1|2813509_2814658_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	1.4e-157
WP_032958944.1|2817100_2820094_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.7	8.7e-207
>prophage 15
NZ_AP012544	Lactobacillus casei DSM 20011 = JCM 1134 = ATCC 393	2924929	2833838	2876965	2924929	holin,transposase	unidentified_phage(28.57%)	45	NA	NA
WP_107750367.1|2833838_2834033_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025013536.1|2834074_2835424_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	49.4	5.6e-121
WP_021353390.1|2835890_2835980_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_144340554.1|2836735_2837523_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_014566853.1|2837583_2837943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013804.1|2837948_2838842_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_003582058.1|2839800_2840091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013805.1|2840104_2840554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003582061.1|2840546_2840690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025013806.1|2840692_2841082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080769633.1|2841236_2841374_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_039639813.1|2841680_2844224_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_016383854.1|2844210_2844456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013808.1|2844497_2845742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589992.1|2845734_2846172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003589991.1|2846210_2846456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144340555.1|2846537_2847699_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.5	2.5e-29
WP_025013621.1|2847756_2847936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013620.1|2848529_2849351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013619.1|2849340_2849748_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_025013618.1|2849744_2850389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013617.1|2850404_2851415_-	C40 family peptidase	NA	A0A1X9SGZ2	Bradyrhizobium_phage	38.6	4.0e-15
WP_025013616.1|2851416_2853345_-	type IV secretory pathway, VirB4 protein	NA	NA	NA	NA	NA
WP_025013615.1|2853325_2853922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003582234.1|2853905_2854241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039639803.1|2856299_2858759_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_025013614.1|2858785_2859364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013613.1|2859372_2859792_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_025013612.1|2859801_2861361_-	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_025013611.1|2861338_2862580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572360.1|2862622_2862850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003572358.1|2862851_2863028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025013610.1|2863046_2863313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003586951.1|2863324_2863603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003592570.1|2863983_2864172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016388575.1|2864246_2864501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014566855.1|2864719_2864995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016383248.1|2864981_2865212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080769658.1|2865204_2865423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144340556.1|2865521_2866442_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_010620018.1|2867451_2868504_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.5	6.0e-38
WP_039639792.1|2870477_2871227_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	44.0	2.1e-45
WP_041084700.1|2871603_2872848_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	5.7e-11
WP_025013993.1|2873217_2875920_-	family 15 glucoamylase	NA	NA	NA	NA	NA
WP_144340557.1|2876044_2876965_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.0	1.0e-20
