The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	12704	57570	2995875	bacteriocin,protease,holin,transposase	Faecalibacterium_phage(30.0%)	45	NA	NA
WP_003574021.1|12704_13625_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016377483.1|13754_15233_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003662302.1|15225_16245_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_041091277.1|16347_17364_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	2.7e-35
WP_016383835.1|17460_17658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662299.1|18075_18294_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_016366383.1|18478_18694_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_016377058.1|18771_19455_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003584064.1|19851_20247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673935.1|20459_20762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577228.1|21285_22521_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_003662290.1|22724_25298_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003568488.1|25310_26012_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	3.9e-33
WP_016366194.1|26308_26860_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662288.1|26903_27710_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003662286.1|27714_28035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662284.1|28091_28865_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003600709.1|29042_29648_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003568507.1|29771_30665_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003662282.1|30713_31352_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568512.1|31580_32957_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003562527.1|33179_33524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562540.1|33599_33959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662276.1|34199_35642_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003662275.1|35836_36469_+	membrane protein	NA	NA	NA	NA	NA
WP_032781128.1|36641_37253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002816285.1|38134_38386_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_052470361.1|38439_39282_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	1.8e-157
WP_016383971.1|39801_40158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562576.1|40222_40543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577278.1|40731_41607_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	26.6	2.3e-11
WP_003662262.1|41698_43291_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	1.1e-11
WP_016365799.1|43627_45001_-	MFS transporter	NA	NA	NA	NA	NA
WP_003596308.1|45136_46153_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_016365800.1|46370_46694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662255.1|46874_50186_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003572929.1|50182_50785_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003572931.1|51035_51296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003562592.1|51508_52171_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003562594.1|52170_53100_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568628.1|53111_53741_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003662250.1|53743_54997_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	43.0	1.5e-14
WP_016365706.1|55048_55384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365705.1|55616_56270_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003596308.1|56553_57570_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
>prophage 2
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	129273	178593	2995875	transposase	unidentified_phage(20.0%)	46	NA	NA
WP_025375985.1|129273_130194_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_041091321.1|131579_132596_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	5.4e-36
WP_013245354.1|134186_134402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577348.1|134409_134694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003577349.1|134686_134971_-	DUF2089 family protein	NA	NA	NA	NA	NA
WP_016366148.1|135161_136142_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003662119.1|136358_137435_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_003562754.1|137656_137908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003562759.1|138061_139135_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003662117.1|139308_139800_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	39.7	2.6e-15
WP_003662115.1|139866_140868_+	D-2-hydroxyisocaproate dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	34.5	3.0e-47
WP_003592707.1|140950_141247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662113.1|141408_141915_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662112.1|142025_142958_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012490818.1|143082_143445_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_016365840.1|143518_143869_-	YisL family protein	NA	NA	NA	NA	NA
WP_003562776.1|144063_145521_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	28.9	4.4e-39
WP_003662109.1|145661_145985_+	DsrE family protein	NA	NA	NA	NA	NA
WP_016376777.1|146056_147031_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_003662107.1|147223_147520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662106.1|147774_148350_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003662105.1|148693_150748_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003662104.1|150763_151123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003577370.1|151126_151900_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003568704.1|152051_152795_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003662101.1|152919_153999_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_003562813.1|154223_154457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003596308.1|154600_155617_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_041091324.1|155648_157106_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003662097.1|157246_158233_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003573065.1|158305_158635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662096.1|158815_160162_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.8	2.3e-90
WP_003662094.1|160219_161410_+	acetate kinase	NA	NA	NA	NA	NA
WP_003583009.1|161511_162336_-	serine/threonine protein phosphatase	NA	A8AT52	Listeria_phage	29.5	2.6e-12
WP_003662090.1|162551_163280_+	endonuclease III	NA	NA	NA	NA	NA
WP_003562840.1|163334_163631_+	thiamine-binding protein	NA	NA	NA	NA	NA
WP_003662086.1|163681_166291_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_144340476.1|166824_167611_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003597463.1|167742_167967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662082.1|168057_171003_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003662080.1|171010_171580_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662076.1|173812_174181_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003601979.1|174257_174908_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	1.5e-18
WP_001748085.1|175060_176236_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_016376044.1|176415_176925_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_041091334.1|177672_178593_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	37.1	6.9e-22
>prophage 3
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	295799	400759	2995875	protease,holin,transposase	Lactobacillus_phage(20.0%)	91	NA	NA
WP_025376330.1|295799_296642_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.6	7.9e-158
WP_041091356.1|296695_296947_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	95.2	4.6e-37
WP_003563140.1|297607_298429_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003563142.1|298465_298846_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_016377049.1|299013_300012_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_003574021.1|300125_301046_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003661483.1|301284_302526_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_003661484.1|302644_303847_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_003661485.1|303833_304913_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003661488.1|305103_306429_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003661490.1|306465_306804_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003661492.1|306852_307185_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003573383.1|307339_308380_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_032781050.1|308364_310158_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003661496.1|310586_311834_-	peptidase T	NA	NA	NA	NA	NA
WP_003563175.1|311949_313590_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003661498.1|313824_314466_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003577536.1|315783_316350_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003661500.1|316356_317700_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.8e-15
WP_003661501.1|317704_318352_+	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_003592935.1|318439_319132_+	thiaminase II	NA	NA	NA	NA	NA
WP_003563188.1|319112_319613_+	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_003661503.1|319625_320468_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003568887.1|320464_321106_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003661504.1|321095_321923_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003586619.1|322307_323756_+	amino acid permease	NA	NA	NA	NA	NA
WP_011674050.1|324063_324309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661507.1|324689_325697_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003661509.1|325756_326149_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_016376967.1|326320_327823_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.3e-21
WP_003573417.1|327806_328787_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_003661512.1|328843_329803_+	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003563212.1|329942_330872_+	ribokinase	NA	NA	NA	NA	NA
WP_003661514.1|331289_333281_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_016376831.1|333455_334838_+	MFS transporter	NA	NA	NA	NA	NA
WP_003573425.1|334818_335253_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003661516.1|335249_335813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003573429.1|335825_336041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661518.1|336855_337545_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_003661521.1|337835_338294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661524.1|338806_340333_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	5.6e-53
WP_003577841.1|340460_341705_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_016377049.1|341965_342964_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_003563240.1|343193_345290_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563244.1|345290_345602_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003661526.1|345866_347153_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003604285.1|347169_347592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563251.1|347613_348474_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_011674056.1|348587_349229_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003574021.1|349548_350469_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_032781052.1|351055_353590_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_003661531.1|353873_354311_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563323.1|354323_354818_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_011674177.1|354969_355836_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003563328.1|355838_356684_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003661535.1|356717_357050_+	PTS sugar transporter	NA	NA	NA	NA	NA
WP_003574021.1|358356_359277_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003596308.1|359898_360915_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_041091367.1|363594_365025_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003577841.1|366131_367376_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.6	8.8e-12
WP_003661539.1|367638_368301_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003604345.1|368338_369100_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003563340.1|369273_369921_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_003583219.1|369936_370500_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003661542.1|370557_372522_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_032781056.1|372550_373735_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_003661544.1|373970_375020_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016377399.1|375016_375766_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.1e-25
WP_003661546.1|375775_376654_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003563355.1|376668_377337_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003604355.1|377333_378020_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003574021.1|378792_379713_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003573566.1|381171_381702_+	DNA-directed RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_003661552.1|381776_381929_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_003661553.1|381938_382706_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	51.5	2.7e-48
WP_003583259.1|382916_383420_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003661554.1|383424_384486_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003563376.1|384490_385180_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.3e-29
WP_003573580.1|385341_386712_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	4.8e-11
WP_016376163.1|387075_387894_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003563382.1|388209_388479_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003661556.1|388719_389727_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003563385.1|389778_390270_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003563386.1|390312_391122_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016383538.1|391114_391966_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_016383539.1|391995_394239_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003661560.1|394328_394745_+	PTS N-acetylglucosamine transporter subunit IIBC	NA	NA	NA	NA	NA
WP_080543849.1|394737_396423_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003661564.1|396605_398417_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	3.9e-45
WP_003593027.1|398409_400119_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	8.0e-40
WP_076665317.1|400636_400759_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 4
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	440975	569331	2995875	integrase,transposase	Lactobacillus_phage(46.67%)	111	476127:476186	502280:503667
WP_041091378.1|440975_441992_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	3.2e-36
WP_167595906.1|442673_444473_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_167595907.1|444485_445403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661614.1|445395_446112_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003661615.1|446122_447127_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_016365381.1|447200_448277_+	class C sortase	NA	NA	NA	NA	NA
WP_003573657.1|448467_449202_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	6.1e-13
WP_003661619.1|449194_450811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661621.1|451106_451805_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.8	1.7e-28
WP_003661623.1|451792_452908_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003661624.1|453010_453892_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	6.6e-22
WP_003661625.1|453888_455037_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003661627.1|455065_455605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661628.1|455794_462493_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_025375959.1|463034_468305_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_032781062.1|468810_471345_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.7	1.0e-67
WP_016383681.1|471865_473308_+	amino acid permease	NA	NA	NA	NA	NA
WP_003661633.1|473416_473920_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003661634.1|474098_474992_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	3.0e-06
WP_003661635.1|475146_476013_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
476127:476186	attL	GGGCTCCTATGCTGTAATTACGGACAAAAATAGTTTGTGCGATAATTGACAGATGAGGAA	NA	NA	NA	NA
WP_079322958.1|476171_476468_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003663214.1|476464_477328_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
WP_032781064.1|478349_479246_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003661639.1|479531_480749_+	MFS transporter	NA	NA	NA	NA	NA
WP_003573692.1|480767_481667_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003573694.1|482111_482927_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_016365576.1|482960_483890_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	63.4	1.7e-105
WP_003661641.1|484079_484625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569067.1|484945_486115_-|integrase	site-specific integrase	integrase	Q6J1W6	Lactobacillus_phage	98.2	6.6e-219
WP_003573997.1|486227_486488_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	40.7	2.5e-09
WP_003586911.1|486577_487198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572177.1|487181_487418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661644.1|487610_488318_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003572182.1|488476_488899_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0IJN5	Lactobacillus_phage	39.1	7.8e-21
WP_003572184.1|488891_489245_-	helix-turn-helix transcriptional regulator	NA	A0A141E1M3	Streptococcus_phage	40.9	7.7e-14
WP_003574003.1|489488_489737_+	hypothetical protein	NA	A0A0P0ID24	Lactobacillus_phage	97.5	2.7e-37
WP_003572187.1|489778_489979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572188.1|489949_490783_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	37.8	2.8e-46
WP_003661647.1|490843_491602_+	ORF6C domain-containing protein	NA	A0A1B0YEA7	Lactobacillus_phage	55.7	6.0e-40
WP_003572193.1|491602_491782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003572196.1|491774_492026_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_003572199.1|492091_492448_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	98.3	2.0e-62
WP_003572201.1|492532_492736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003586921.1|492718_493264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661649.1|493444_493759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003589923.1|493751_494498_+	DnaD domain protein	NA	A0A0N7IRA7	Lactobacillus_phage	56.1	5.8e-35
WP_003589925.1|494512_495337_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	75.1	6.6e-117
WP_003574016.1|495336_495855_+	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003597560.1|495901_496324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661650.1|497073_497361_+	hypothetical protein	NA	Q8LTA8	Lactobacillus_phage	75.8	8.1e-38
WP_016383959.1|497430_497763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010493154.1|498277_498721_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	97.3	1.2e-77
WP_108299274.1|498968_499767_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003661653.1|500114_500762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663214.1|501137_502001_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
WP_079322958.1|501997_502294_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003661656.1|503061_505539_+	CHAP domain-containing protein	NA	A0A1X9SGZ2	Bradyrhizobium_phage	36.1	5.4e-13
502280:503667	attR	TTCCTCATCTGTCAATTATCGCACAAACTATTTTTGTCCGTAATTACAGCATAGGAGCCCATATCAACGCTATTTTGAGCAGCATACAGCGATGCCAACGATGGTTGATCTATCAAATACCCTTAAACAACAGCCCGAAGAAGAGGGAAAGCAAATTGCGCTTGAGCTTGAGCCATATATTGAAGGGTCGTTGTCTGTTTTTGCGCATCAAACGAACGTAGACAACGACAATTCAGTGGTTGTCTATGACGTCAAGGATTTAGGTAAGAACCTGCGGTCAATGGGTATGTTGATTGTGCTTGACCAAATCTGGAACCGGATTACAAAGAACCGGAACTCAGGCAAACGGACGTGGATTTACGTTGATGAAATGCAGCTGCTCTTGAGCAATGAATTTGCATCTAACTACTTCTTTGAACTGTGGTCGCGTGCCCGTAAATGGGGCGCGTTGCCTACTGGGATTACGCAAAACGTTGAAACCTTGCTACTGAGTGATAATGCCCGCCGCATGTTGTCTAACAGTGAATTTGTGCTTTTGCTTGACCAAGCTGCCAATGACCGTGATCAGCTCACAGAAATGCTGCATCTGTCTGAACAGGAGGAAGGCTATATCACCAATGCCGACTCCGGCCATGGCTTGATGATTGCGGGTGACGCCGTCATTCCATTTGAGAATGACTTTCCGAAAAAGACCAAGCTTTATAAGATTATGTCCACGAAACCAGAGGACATGGAGCAATATATTTCCCGCAAGAAACTGCATGAGGATGGGGGCGAGGTGAGTGGCGAATAATTGGAAAGACATGCTGCTTAATAAGCAGCATCATGACCCTAAAGACGCTTTAGTCAGTAGTGATCCGAGCCGGTTTAAGAAAGCCTTGCGCGGTAACAAATATCGCATACAAAGCGTTGGCGGCTTTGGTGGCAAACGTTTTGTCCGAAAAAAAGGGCAGTTTAGGCGTGGCCTTTTAGCACAAAACGCTAAGCATAAAAAGAAACAGACTAGTTGGGTCAAACGCTTTCGGCACCGTAGTAGAGAAGCGCTTCAACATGGCGCGATTGAAACGGCTAAGAAGAGTACCGTACTGGCAGCTACCAATGGTCAGCAAAATGAAGAGCAAAACGATCCAACCTACCAAACGTTGTCAAAGACAACGCAAGGAGGGAGCCGCTTAAAAGCCCGGTTGAAGCGCCATAGGAATCGTAAAGGCAAGCGACTAGCAAAAAAGTTAGGTAAGCCAGTTCAAACTTCATACAGCCGTAAATCCGTCAGAAAAATGATGAAGCAGCGTGCTTTAAAGGGTGCTACCTTCTCGTGGCGTCATCCTATTAGTTCAATCAGGCATCTGTTAAAGGCCATTCTGATGCTACCAGTCGTGATCAAGTCG	NA	NA	NA	NA
WP_003661657.1|505552_506077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661658.1|506094_506325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032781066.1|506360_507506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003589454.1|508584_508860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016363316.1|509106_509508_+	MobC family plasmid mobilization relaxosome protein	NA	NA	NA	NA	NA
WP_003661663.1|509479_511687_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_003589449.1|511731_513123_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_099973804.1|513513_514301_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016364952.1|514443_514929_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003587161.1|514943_515714_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003661665.1|515726_517400_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003587165.1|517517_518276_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080543852.1|518463_518655_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099973804.1|518929_519716_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003587154.1|519771_520302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003587152.1|520316_521276_+	D-2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	30.3	3.3e-27
WP_003587151.1|521393_521780_-	hypothetical protein	NA	E3W8I0	Leuconostoc_phage	31.8	2.4e-08
WP_016363695.1|521772_522093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003587146.1|522085_523393_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.1	7.9e-80
WP_003606688.1|523911_525171_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_003661670.1|525167_526784_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.3	6.2e-127
WP_003606687.1|526797_529965_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003587138.1|530099_531014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032781070.1|531528_532590_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	7.7e-41
WP_003587133.1|532841_533564_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_080543848.1|533665_533854_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_003661676.1|533939_534527_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	33.9	3.5e-19
WP_016388654.1|536263_537592_+	MFS transporter	NA	NA	NA	NA	NA
WP_003567312.1|537792_538350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144340477.1|538871_539659_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001748085.1|540392_541568_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_003663350.1|541786_541993_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_003587178.1|543420_544527_-	anion permease	NA	NA	NA	NA	NA
WP_002816285.1|545596_545848_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_003662769.1|546554_547691_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003662770.1|547792_548605_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003597676.1|548636_549350_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003662771.1|550176_551088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662772.1|551360_552749_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003662775.1|553837_554506_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003563532.1|554573_555593_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_003662776.1|555573_555951_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003662777.1|555947_556226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662778.1|556249_557944_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_003563543.1|558783_559485_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016365555.1|559636_559996_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_016365554.1|559979_560681_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016383865.1|560831_562853_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_016365906.1|562928_563903_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003662785.1|564070_565798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365907.1|565784_566579_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	1.6e-27
WP_003662787.1|566831_567380_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003662788.1|567427_568252_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_123837385.1|568410_569331_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	623729	693123	2995875	head,tail,transposase,capsid	unidentified_phage(18.18%)	58	NA	NA
WP_003574021.1|623729_624650_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003606766.1|624807_626541_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003589794.1|626567_627992_+	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_003589792.1|628040_628376_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003662836.1|628792_629959_+	galactokinase	NA	NA	NA	NA	NA
WP_003563715.1|630054_631050_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.4e-52
WP_003662837.1|631046_632507_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003662838.1|632542_633556_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.0	1.8e-10
WP_032781228.1|633705_634716_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_003573945.1|634942_635653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662841.1|635901_636633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563725.1|636937_637432_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003563727.1|637446_637755_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_003662843.1|637810_639262_+	PTS glucitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003569166.1|639472_639667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662844.1|640109_640790_-	DUF4867 family protein	NA	NA	NA	NA	NA
WP_003662845.1|640811_641750_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_003662846.1|641864_642866_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003662847.1|642904_643423_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_003573960.1|643467_643896_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_003563743.1|643900_644677_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.8	6.7e-18
WP_003563745.1|645120_645747_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003592493.1|645807_646929_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_003662849.1|646928_650054_+	SMC family ATPase	NA	A0A193GZI3	Escherichia_phage	22.8	6.2e-06
WP_003563758.1|650152_650296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003573966.1|650954_651431_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003659920.1|651424_651658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003592500.1|651830_652934_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003569189.1|653144_653930_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003563776.1|653932_654601_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003583702.1|654597_654777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003573971.1|654854_655379_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_011674244.1|655611_656244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003563790.1|656315_657137_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003563792.1|657310_658372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003569200.1|658364_659195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662858.1|659425_660076_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003662860.1|660792_663180_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003662862.1|663661_664618_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003574024.1|665176_666145_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003574026.1|666347_667319_+	permease component of an ABC superfamily transporter	NA	NA	NA	NA	NA
WP_003563800.1|667321_668125_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	3.4e-09
WP_003662865.1|668352_669312_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_003662867.1|669421_672085_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	30.8	1.1e-75
WP_032781231.1|672323_673301_-	glycosyltransferase	NA	I1TED8	Salmonella_phage	38.0	4.0e-52
WP_003593505.1|673336_675487_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003563810.1|675473_675881_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003662870.1|676038_676734_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.9	1.0e-33
WP_003604553.1|676730_678026_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003563820.1|678141_678522_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_003563824.1|680298_681159_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003583729.1|681234_682080_+	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_032781233.1|682124_682784_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_108299274.1|683341_684140_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003574021.1|685829_686750_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003662889.1|689094_690639_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.0	3.6e-39
WP_003593566.1|690702_690996_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003662893.1|691704_693123_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	822777	902878	2995875	capsid,integrase,head,portal,protease,holin,tRNA,terminase,tail	Lactobacillus_phage(86.27%)	92	812838:812856	898861:898879
812838:812856	attL	AGCAATCGTTGCTTCGATC	NA	NA	NA	NA
WP_032780979.1|822777_823905_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	98.7	9.8e-212
WP_003661439.1|824117_824744_-	hypothetical protein	NA	A0A0A0RSV1	Bacillus_phage	44.3	5.9e-09
WP_003661438.1|824834_825632_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_003661437.1|825687_826461_-	XRE family transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	94.9	1.5e-134
WP_016366000.1|826618_826870_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	98.6	4.2e-30
WP_003661435.1|826866_827631_+	phage repressor protein/antirepressor Ant	NA	Q6J1W3	Lactobacillus_phage	99.2	1.8e-140
WP_003661434.1|827765_828011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661433.1|828085_828331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032780976.1|828345_828615_-	DUF3892 domain-containing protein	NA	A0A059NT53	Lactococcus_phage	58.6	5.7e-09
WP_003661430.1|828853_829042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661429.1|829038_829719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661428.1|829785_830145_+	DUF771 domain-containing protein	NA	U5U4L9	Lactobacillus_phage	96.6	2.0e-62
WP_003661427.1|830226_830430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661426.1|830504_830819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661423.1|831640_832903_+	DNA helicase	NA	U5U3Y9	Lactobacillus_phage	97.9	7.0e-235
WP_003661422.1|832904_833249_+	hypothetical protein	NA	U5U420	Lactobacillus_phage	98.2	1.8e-60
WP_003661420.1|833535_833790_+	hypothetical protein	NA	U5U728	Lactobacillus_phage	95.2	6.5e-39
WP_003661419.1|833786_834152_+	endodeoxyribonuclease	NA	A0A0P0I7M2	Lactobacillus_phage	100.0	1.8e-66
WP_050396418.1|834166_834502_+	endonuclease	NA	U5U3Z2	Lactobacillus_phage	97.3	2.9e-34
WP_003661416.1|834541_834805_+	hypothetical protein	NA	B4XYT2	Lactobacillus_phage	98.9	1.7e-42
WP_003661415.1|834801_835323_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	70.9	3.1e-59
WP_003661414.1|835312_835603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661413.1|835592_835952_+	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	44.0	4.0e-18
WP_003595405.1|835948_836158_+	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	92.8	8.5e-29
WP_003661412.1|836316_836535_+	hypothetical protein	NA	U5U734	Lactobacillus_phage	93.1	3.5e-33
WP_032780973.1|836536_836755_+	helix-turn-helix transcriptional regulator	NA	U5U738	Lactobacillus_phage	84.7	3.4e-28
WP_032780971.1|836929_837358_+	DUF1492 domain-containing protein	NA	U5U7A6	Lactobacillus_phage	96.5	6.1e-74
WP_003661408.1|837666_838494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661407.1|838754_839903_+	hypothetical protein	NA	B4XYU0	Lactobacillus_phage	96.6	4.2e-218
WP_041091441.1|839915_840446_+	HNH endonuclease	NA	Q8LTA0	Lactobacillus_phage	95.4	8.7e-94
WP_041091443.1|840548_840872_+	hypothetical protein	NA	Q8LT99	Lactobacillus_phage	95.3	2.7e-50
WP_003661404.1|840884_841466_+	hypothetical protein	NA	Q96200	Lactobacillus_phage	92.2	6.4e-98
WP_003661403.1|841455_842250_+	HNH endonuclease	NA	U5U440	Lactobacillus_phage	98.1	2.0e-147
WP_003661401.1|842450_842906_+|terminase	P27 family phage terminase small subunit	terminase	U5U3Z1	Lactobacillus_phage	99.3	4.7e-80
WP_003661400.1|842927_844640_+|terminase	terminase large subunit	terminase	Q8LTC3	Lactobacillus_phage	98.8	0.0e+00
WP_003661399.1|844651_844843_+	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_003661397.1|844848_846102_+|portal	phage portal protein	portal	Q8LTC2	Lactobacillus_phage	99.0	1.7e-236
WP_003661395.1|846055_846685_+|head,protease	HK97 family phage prohead protease	head,protease	Q8LTC1	Lactobacillus_phage	98.6	2.4e-114
WP_003661392.1|846726_847929_+|capsid	phage major capsid protein	capsid	U5U3Z5	Lactobacillus_phage	94.2	3.7e-209
WP_016364528.1|847946_848186_+	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	94.9	2.7e-31
WP_003564855.1|848196_848556_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	97.5	1.6e-59
WP_003661388.1|848545_848875_+|head,tail	head-tail adaptor protein	head,tail	P94213	Lactobacillus_phage	97.2	3.4e-56
WP_003661386.1|848874_849261_+	HK97 gp10 family phage protein	NA	U5U769	Lactobacillus_phage	98.4	5.0e-67
WP_003661385.1|849260_849647_+	hypothetical protein	NA	U5U3W4	Lactobacillus_phage	95.3	2.3e-67
WP_003661384.1|849680_850289_+|tail	major tail protein	tail	P94216	Lactobacillus_phage	99.0	2.6e-110
WP_080543841.1|850315_850531_+	Ig-like domain-containing protein	NA	A0A2D1GPF6	Lactobacillus_phage	96.6	2.6e-20
WP_003661382.1|850601_851015_+	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_003661381.1|851137_856012_+|tail	phage tail tape measure protein	tail	A0A2D1GPD5	Lactobacillus_phage	92.1	0.0e+00
WP_003661380.1|856012_857944_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	62.6	5.4e-218
WP_041091447.1|857944_861160_+|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	76.8	0.0e+00
WP_003661377.1|861169_861466_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	86.5	2.8e-41
WP_003605834.1|861452_861584_+	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	97.7	3.2e-18
WP_032780964.1|861614_862013_+	hypothetical protein	NA	A8YQK4	Lactobacillus_phage	92.4	5.5e-61
WP_016376687.1|861981_862191_+	hypothetical protein	NA	A8YQK5	Lactobacillus_phage	92.3	3.3e-12
WP_032780962.1|862183_862630_+|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	94.6	2.1e-64
WP_003661374.1|862640_863939_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	93.3	1.9e-219
WP_003661373.1|863983_864208_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	94.6	5.2e-32
WP_003594455.1|864932_865580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003564111.1|865760_866945_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.5e-141
WP_003661371.1|867058_868552_+	MFS transporter	NA	NA	NA	NA	NA
WP_003564124.1|868647_869118_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003569431.1|869361_870840_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003578170.1|870836_871562_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_003661370.1|871662_872346_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003661368.1|872800_875212_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.4	0.0e+00
WP_003564130.1|875477_877121_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003593811.1|877125_877836_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003569458.1|877978_878194_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003569460.1|878309_879131_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003564134.1|879127_879631_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003593827.1|880094_881606_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003593829.1|881633_883193_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003564137.1|883289_883763_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003583932.1|884107_885313_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_003661363.1|885446_886775_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003564140.1|886964_887231_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003574245.1|887279_888623_+	PFL family protein	NA	NA	NA	NA	NA
WP_003564143.1|889976_890612_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003564144.1|890681_891275_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003564145.1|891468_892140_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_003564146.1|892141_892939_+	NAD kinase	NA	NA	NA	NA	NA
WP_003564147.1|892938_893841_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003569478.1|893949_895008_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003569480.1|895164_895800_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003564150.1|895821_896640_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_003661358.1|896842_897883_-	lactonase family protein	NA	NA	NA	NA	NA
WP_003593849.1|898154_898532_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564153.1|898644_898914_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
898861:898879	attR	AGCAATCGTTGCTTCGATC	NA	NA	NA	NA
WP_016365286.1|899041_900031_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.6	1.1e-137
WP_003564155.1|900258_901206_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003569501.1|901271_902114_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003564157.1|902368_902878_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 7
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	950729	960072	2995875		Streptococcus_phage(33.33%)	8	NA	NA
WP_003661316.1|950729_953621_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	4.2e-307
WP_003564246.1|953972_954512_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003564248.1|954674_955562_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	1.1e-08
WP_003564250.1|955558_956587_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.2	2.3e-90
WP_003593901.1|956591_957539_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.7	9.2e-54
WP_003569571.1|957924_958380_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003564255.1|958496_959087_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	52.3	1.1e-52
WP_003593905.1|959409_960072_-	Ltp family lipoprotein	NA	A0A097BY93	Leuconostoc_phage	75.0	1.1e-08
>prophage 8
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	1833934	1897521	2995875	capsid,head,integrase,portal,protease,holin,tRNA,terminase,transposase,tail	Lactobacillus_phage(75.47%)	68	1833789:1833808	1876615:1876634
1833789:1833808	attL	TTTGTCCCCTTTTTGTCCCC	NA	NA	NA	NA
WP_003660534.1|1833934_1835083_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	49.8	1.6e-76
WP_032780913.1|1835093_1835540_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	97.3	2.6e-67
WP_032780911.1|1835532_1835823_-	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	82.3	1.0e-35
WP_003660531.1|1835852_1835996_-	XkdX family protein	NA	A8YQK3	Lactobacillus_phage	100.0	4.6e-18
WP_003660530.1|1835992_1836322_-	hypothetical protein	NA	A8YQK2	Lactobacillus_phage	79.8	1.4e-41
WP_041091530.1|1836337_1839541_-|tail	phage tail protein	tail	Q3L0S2	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	83.2	0.0e+00
WP_003660527.1|1839541_1841620_-|tail	phage tail family protein	tail	Q6J1X4	Lactobacillus_phage	84.8	0.0e+00
WP_003660525.1|1841620_1846306_-	tape measure protein	NA	Q3L0S4	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	54.6	2.6e-157
WP_032780909.1|1846510_1846870_-|tail	tail protein	tail	Q3L0S6	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	50.0	6.6e-21
WP_003660519.1|1847029_1847638_-|tail	phage tail protein	tail	A8YQJ7	Lactobacillus_phage	96.0	8.7e-106
WP_003660517.1|1847649_1848021_-	DUF806 family protein	NA	Q3L0S8	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	92.7	8.3e-59
WP_050396399.1|1848017_1848437_-	HK97 gp10 family phage protein	NA	A8YQJ5	Lactobacillus_phage	85.6	5.8e-61
WP_003660513.1|1848439_1848781_-|head	phage head closure protein	head	A8YQJ4	Lactobacillus_phage	98.2	4.6e-56
WP_003660512.1|1848773_1849118_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A8YQJ3	Lactobacillus_phage	93.9	3.7e-53
WP_003660510.1|1849190_1850360_-|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	86.0	1.0e-179
WP_003660508.1|1850359_1851046_-|protease	Clp protease ClpP	protease	A8YQJ1	Lactobacillus_phage	90.4	2.0e-111
WP_003660506.1|1851042_1852194_-|portal	phage portal protein	portal	Q6J1Y4	Lactobacillus_phage	98.2	5.0e-211
WP_003660505.1|1852200_1852374_-	hypothetical protein	NA	Q6J1Y5	Lactobacillus_phage	93.0	5.4e-21
WP_003660503.1|1852373_1854263_-|terminase	terminase large subunit	terminase	Q6J1Y6	Lactobacillus_phage	97.6	0.0e+00
WP_032780906.1|1854249_1854717_-|terminase	phage terminase small subunit P27 family	terminase	Q6J1Y7	Lactobacillus_phage	97.4	1.8e-82
WP_003660499.1|1854856_1855351_-	HNH endonuclease	NA	A8YQN7	Lactobacillus_phage	97.0	3.3e-95
WP_162259788.1|1855370_1855517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041091533.1|1855536_1855860_-	hypothetical protein	NA	Q8LT99	Lactobacillus_phage	93.5	2.3e-49
WP_041091535.1|1855962_1856493_-	HNH endonuclease	NA	Q8LTA0	Lactobacillus_phage	98.8	4.6e-95
WP_003660493.1|1856479_1857697_-	hypothetical protein	NA	U5U436	Lactobacillus_phage	97.3	4.3e-237
WP_032780904.1|1857715_1858627_-	DNA adenine methylase	NA	A8YQN2	Lactobacillus_phage	73.9	1.2e-119
WP_003663197.1|1858705_1859875_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	23.6	5.9e-18
WP_003663199.1|1859893_1860652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032780899.1|1861165_1861594_-	DUF1492 domain-containing protein	NA	A0A0P0IJK8	Lactobacillus_phage	96.5	7.3e-75
WP_032780896.1|1861667_1861886_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IJR0	Lactobacillus_phage	94.4	1.1e-31
WP_003660483.1|1861963_1862146_-	hypothetical protein	NA	U5U7A2	Lactobacillus_phage	64.3	2.9e-09
WP_003660482.1|1862142_1862592_-	hypothetical protein	NA	A0A2D1GPA7	Lactobacillus_phage	58.4	1.0e-39
WP_003660480.1|1862602_1862833_-	hypothetical protein	NA	U5U426	Lactobacillus_phage	82.9	1.0e-30
WP_003660479.1|1862829_1863204_-	hypothetical protein	NA	C1KFE5	Lactobacillus_virus	60.4	2.7e-33
WP_003660476.1|1863193_1863388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660474.1|1863380_1863581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162259789.1|1863567_1863708_-	hypothetical protein	NA	A0A2D1GPI6	Lactobacillus_phage	72.1	6.3e-12
WP_003660469.1|1863718_1864255_-	DUF1642 domain-containing protein	NA	C1KFF0	Lactobacillus_virus	60.0	1.5e-56
WP_003660468.1|1864251_1864437_-	hypothetical protein	NA	Q9T0X7	Lactobacillus_phage	98.3	7.0e-27
WP_003660466.1|1864427_1864754_-	VRR-NUC domain-containing protein	NA	A0A0P0IJK0	Lactobacillus_phage	100.0	1.7e-55
WP_003660465.1|1864999_1867297_-	primase	NA	A0A0P0IX98	Lactobacillus_phage	96.5	0.0e+00
WP_003660463.1|1867308_1867827_-	DUF669 domain-containing protein	NA	A0A0P0IQI1	Lactobacillus_phage	94.2	3.2e-93
WP_003660462.1|1867828_1868398_-	AP2 domain-containing protein	NA	Q7Y5K0	Xanthomonas_virus	44.1	4.3e-06
WP_003660460.1|1868398_1869775_-	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	91.7	6.7e-247
WP_003660458.1|1869737_1870460_-	AAA family ATPase	NA	Q9T0Y5	Lactobacillus_phage	96.7	2.1e-130
WP_003660456.1|1870469_1870961_-	siphovirus Gp157 family protein	NA	A0A0P0I392	Lactobacillus_phage	97.5	5.0e-80
WP_003660454.1|1870978_1871182_-	hypothetical protein	NA	Q9T0Y8	Lactobacillus_phage	89.6	2.4e-28
WP_003660452.1|1871186_1871339_-	hypothetical protein	NA	A8YQL2	Lactobacillus_phage	95.9	9.9e-19
WP_003660451.1|1871420_1871744_-	DUF771 domain-containing protein	NA	A0A0P0IJJ0	Lactobacillus_phage	82.4	6.2e-10
WP_003660449.1|1871814_1872342_-	hypothetical protein	NA	D2XQ14	Bacillus_virus	46.1	6.3e-20
WP_003575664.1|1872338_1872611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003660447.1|1872624_1873368_-	phage antirepressor Ant	NA	A0A2D1GPQ2	Lactobacillus_phage	91.1	5.2e-121
WP_003660445.1|1873402_1873642_-	pathogenicity island protein	NA	A0A1Q1PVY0	Staphylococcus_phage	51.3	2.3e-14
WP_003660444.1|1873779_1874613_+	helix-turn-helix domain-containing protein	NA	Q6J1W4	Lactobacillus_phage	67.0	4.0e-93
WP_003660443.1|1874678_1875269_+	SHOCT domain-containing protein	NA	Q5K5J0	Oenococcus_phage	38.5	8.6e-10
WP_003660441.1|1875439_1876609_+|integrase	site-specific integrase	integrase	A0A2D1GPE8	Lactobacillus_phage	97.7	6.1e-217
WP_003566819.1|1877059_1877698_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
1876615:1876634	attR	TTTGTCCCCTTTTTGTCCCC	NA	NA	NA	NA
WP_003575678.1|1877736_1878249_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003566817.1|1878401_1878926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562115.1|1884715_1885999_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.7	2.3e-84
WP_003591137.1|1886370_1887948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003566131.1|1888208_1889738_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003573317.1|1889801_1891256_-	amino acid permease	NA	NA	NA	NA	NA
WP_003566135.1|1892127_1892838_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003570709.1|1892896_1894573_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_003566139.1|1894883_1895435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566141.1|1895554_1896079_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003574021.1|1896600_1897521_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 9
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	1917487	1995027	2995875	head,integrase,protease,holin,transposase,terminase,tail	Lactobacillus_phage(46.67%)	82	1953377:1953395	1993476:1993494
WP_003574021.1|1917487_1918408_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003566205.1|1918665_1919004_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003599183.1|1919951_1920707_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004562095.1|1920979_1921897_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	1.3e-20
WP_004562094.1|1921883_1923500_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004562093.1|1923496_1924135_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004562092.1|1924226_1925639_-	MFS transporter	NA	NA	NA	NA	NA
WP_004562091.1|1925801_1926539_+	sulfite exporter TauE/SafE family protein	NA	Q6EVM7	Oenoccocus_phage	42.4	8.5e-47
WP_004562090.1|1926658_1927693_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003573233.1|1927777_1928635_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003566227.1|1928810_1929188_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004562089.1|1929177_1929894_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	1.2e-10
WP_016383581.1|1929886_1930627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016377170.1|1930694_1931246_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016365827.1|1931268_1932147_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_004562085.1|1932143_1933232_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-16
WP_004562084.1|1933282_1933594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003591198.1|1933697_1934681_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004562079.1|1934949_1935903_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016377171.1|1936007_1937678_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003573210.1|1938040_1938721_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003566249.1|1938717_1939050_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004562075.1|1939261_1939525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376093.1|1941277_1942879_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.6e-08
WP_016383585.1|1943301_1943700_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_016377290.1|1943791_1944634_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_016365960.1|1944884_1945088_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004562067.1|1945074_1945599_+	DUF3278 domain-containing protein	NA	NA	NA	NA	NA
WP_004562064.1|1949506_1950268_+|protease	matrixin family metalloprotease	protease	G9I094	Helicoverpa_zea_nudivirus	53.1	1.7e-05
WP_025376091.1|1950442_1951210_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002816285.1|1952557_1952809_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_040167375.1|1952838_1953054_-	hypothetical protein	NA	NA	NA	NA	NA
1953377:1953395	attL	ATTCCCACTCAATCGTTGC	NA	NA	NA	NA
WP_004562061.1|1953634_1954783_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	44.6	4.8e-65
WP_004562060.1|1954793_1955240_-|holin	phage holin	holin	A8YQK6	Lactobacillus_phage	95.9	1.3e-66
WP_004562059.1|1955236_1955443_-	hypothetical protein	NA	A0A1B0YE97	Lactobacillus_phage	100.0	1.4e-12
WP_032781205.1|1955423_1955810_-	hypothetical protein	NA	U5U712	Lactobacillus_phage	95.3	5.2e-64
WP_004562056.1|1957885_1959970_-|tail	phage tail protein	tail	Q597U4	Lactobacillus_virus	53.1	6.0e-215
WP_004562055.1|1959982_1960801_-|tail	phage tail family protein	tail	Q597U5	Lactobacillus_virus	38.5	1.2e-73
WP_004562054.1|1960804_1963801_-|tail	phage tail tape measure protein	tail	A0A097BYC3	Leuconostoc_phage	66.1	8.3e-125
WP_032781203.1|1963800_1964034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562052.1|1964105_1964546_-	hypothetical protein	NA	A0A2P0ZL56	Lactobacillus_phage	50.7	5.4e-25
WP_004562051.1|1964609_1965236_-|tail	phage major tail protein, TP901-1 family	tail	G8FV40	Pediococcus_virus	77.9	1.9e-87
WP_004562050.1|1965237_1965603_-	hypothetical protein	NA	Q597V0	Lactobacillus_virus	48.3	1.8e-21
WP_004562049.1|1965599_1965974_-	HK97 gp10 family phage protein	NA	G8FUY4	Pediococcus_virus	43.4	2.3e-16
WP_004562048.1|1965966_1966263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562047.1|1966259_1966601_-|head,tail	phage head-tail connector protein	head,tail	Q597V3	Lactobacillus_virus	58.4	1.9e-33
WP_004562046.1|1966597_1967476_-	hypothetical protein	NA	A0A0P0IJL6	Lactobacillus_phage	81.5	2.7e-148
WP_004562045.1|1967544_1968465_-	hypothetical protein	NA	A0A2P0ZL66	Lactobacillus_phage	74.9	1.7e-116
WP_004562044.1|1968478_1969021_-	DUF4355 domain-containing protein	NA	Q597V6	Lactobacillus_virus	54.5	4.2e-19
WP_004562043.1|1969161_1969428_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	65.9	2.3e-26
WP_004562042.1|1969444_1969792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562041.1|1969791_1970130_-	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	52.0	8.4e-26
WP_004562040.1|1970138_1970849_-	hypothetical protein	NA	Q597V7	Lactobacillus_virus	50.9	5.8e-61
WP_003663214.1|1971505_1972369_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	2.4e-24
WP_079322958.1|1972365_1972662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004562037.1|1973786_1975085_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P0ZL65	Lactobacillus_phage	68.9	5.1e-180
WP_004562034.1|1976122_1977271_-	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	96.1	2.7e-217
WP_003663197.1|1977592_1978762_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	23.6	5.9e-18
WP_003663199.1|1978780_1979539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032781195.1|1980199_1980637_-	hypothetical protein	NA	A0A2H4J7Z8	uncultured_Caudovirales_phage	28.6	5.6e-06
WP_003582423.1|1980719_1980872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562031.1|1980900_1981254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562029.1|1981771_1982188_-	hypothetical protein	NA	A0A0Y0AFD7	Bacillus_phage	38.3	4.8e-07
WP_004562027.1|1982530_1982746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562026.1|1982735_1983278_-	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	56.1	2.7e-42
WP_004562024.1|1983411_1983795_-	DUF1064 domain-containing protein	NA	A0A0P0IJU5	Lactobacillus_phage	95.3	8.0e-65
WP_004562023.1|1983797_1984247_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	87.2	2.7e-64
WP_004562022.1|1984243_1984459_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	100.0	1.3e-32
WP_003574538.1|1984793_1985174_+	DUF2513 domain-containing protein	NA	A0A0P0IV09	Lactobacillus_phage	96.8	3.9e-64
WP_004562020.1|1985300_1986266_-	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	94.1	1.8e-137
WP_080543878.1|1986281_1987082_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	92.1	2.9e-141
WP_004562018.1|1987062_1987926_-	recombinase RecT	NA	A0A0P0IJP1	Lactobacillus_phage	98.9	6.2e-158
WP_032781208.1|1987938_1988346_-	hypothetical protein	NA	A0A0P0IXE5	Lactobacillus_phage	97.0	5.8e-74
WP_004562015.1|1988586_1988796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562014.1|1988801_1989308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562013.1|1989365_1989524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011674686.1|1989520_1989766_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004562011.1|1989895_1990579_+	LexA family transcriptional regulator	NA	Q4ZD53	Staphylococcus_phage	33.3	2.2e-17
WP_004562010.1|1990594_1991389_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_004562009.1|1991457_1992036_+	hypothetical protein	NA	A0A1B0Y834	Lactobacillus_phage	92.2	1.2e-99
WP_004562008.1|1992145_1993309_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5C3	Streptococcus_phage	30.7	1.1e-43
WP_004562007.1|1993473_1995027_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.4	1.8e-14
1993476:1993494	attR	ATTCCCACTCAATCGTTGC	NA	NA	NA	NA
>prophage 10
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	2026742	2094958	2995875	protease,tRNA,transposase	Acidithiobacillus_phage(12.5%)	52	NA	NA
WP_004561985.1|2026742_2027732_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	40.5	9.9e-59
WP_004559524.1|2028012_2029686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003591285.1|2029840_2031580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004559522.1|2031775_2033857_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_004561984.1|2033995_2035483_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_004561983.1|2035733_2036774_+	acyltransferase	NA	NA	NA	NA	NA
WP_003663190.1|2037015_2038551_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.9	4.5e-66
WP_003663191.1|2038550_2039309_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	35.8	1.4e-41
WP_003663192.1|2039305_2039512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599319.1|2039714_2040707_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	35.1	1.1e-41
WP_003599322.1|2040778_2041921_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	30.2	6.8e-27
WP_003566356.1|2042182_2043049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566555.1|2043191_2044592_-	sugar transferase	NA	NA	NA	NA	NA
WP_003599324.1|2044722_2045463_-	mannosyltransferase involved in polysaccharide biosynthesis	NA	L7RBS6	Acanthamoeba_polyphaga_moumouvirus	31.2	4.9e-10
WP_003599326.1|2045484_2046240_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004561980.1|2046324_2047275_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.9	1.9e-35
WP_003575766.1|2047418_2048081_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003566566.1|2048096_2048741_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003566568.1|2048742_2049567_-	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004561979.1|2049694_2050426_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	2.7e-37
WP_041091558.1|2050933_2052178_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	4.3e-11
WP_003599329.1|2052318_2053305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566574.1|2053325_2053766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003566577.1|2054057_2054504_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_003662763.1|2054612_2054726_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003662762.1|2054795_2055398_-	guanylate kinase	NA	U5J9X2	Bacillus_phage	31.0	3.6e-11
WP_003566583.1|2055514_2055922_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003575783.1|2056028_2057243_-	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	37.0	1.1e-11
WP_003662758.1|2057549_2058824_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.1	3.6e-85
WP_003662757.1|2059357_2060302_-	cation transporter	NA	NA	NA	NA	NA
WP_003662756.1|2060477_2060813_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003580097.1|2060987_2061917_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_003585259.1|2062364_2064143_-	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_003662754.1|2064392_2066801_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.0	9.0e-13
WP_003662753.1|2067016_2068462_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_003662752.1|2068454_2069624_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_003662751.1|2069620_2070763_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_003662750.1|2070759_2072859_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_003566632.1|2073234_2074266_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003662748.1|2074532_2075447_-	sortase	NA	NA	NA	NA	NA
WP_003662746.1|2075804_2076635_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.5	3.2e-18
WP_003662744.1|2077101_2079033_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_003570841.1|2079463_2079865_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003662742.1|2080497_2082648_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	36.7	1.4e-121
WP_003570845.1|2082861_2083626_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003588306.1|2083803_2084697_+	LCP family protein	NA	NA	NA	NA	NA
WP_032781188.1|2086287_2086947_-	sugar transferase	NA	NA	NA	NA	NA
WP_025375985.1|2087940_2088861_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_025376021.1|2090818_2091310_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003662059.1|2091541_2092285_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003588334.1|2092300_2093218_-	tyrosine-protein kinase modulator	NA	NA	NA	NA	NA
WP_001748085.1|2093782_2094958_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	2361677	2489548	2995875	transposase,protease,tRNA,bacteriocin	Staphylococcus_phage(15.38%)	119	NA	NA
WP_003576207.1|2361677_2363171_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003588680.1|2363318_2364299_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003603236.1|2364414_2365086_-	ribose-5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003603237.1|2365269_2366100_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003603238.1|2366246_2367086_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003661808.1|2367098_2368115_-	membrane protein	NA	NA	NA	NA	NA
WP_003567242.1|2368121_2368496_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016371648.1|2368660_2369932_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_025376282.1|2370249_2371026_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003603253.1|2371043_2371931_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.5	1.5e-34
WP_003661805.1|2372233_2373349_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003599699.1|2373371_2374736_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003567256.1|2374752_2375295_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	8.1e-39
WP_003567258.1|2375515_2375806_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003661802.1|2375922_2376300_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003603256.1|2376544_2377864_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	34.5	7.0e-60
WP_003603257.1|2378222_2379569_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	29.8	6.9e-47
WP_003599703.1|2379796_2380897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661801.1|2380893_2382090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567269.1|2382152_2383031_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.4	1.2e-12
WP_003599714.1|2383192_2385247_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	32.9	1.6e-63
WP_032781094.1|2385403_2388034_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.0	1.2e-87
WP_003576237.1|2388195_2388819_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003661795.1|2389318_2389990_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003599717.1|2390499_2391621_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003567280.1|2391634_2391919_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_003588738.1|2392109_2393225_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003567284.1|2393412_2393619_-	CsbD family protein	NA	NA	NA	NA	NA
WP_003567286.1|2393751_2394009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567288.1|2394079_2394286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567290.1|2394510_2394762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567292.1|2395089_2396322_+	MFS transporter	NA	NA	NA	NA	NA
WP_003599729.1|2396400_2397657_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	56.8	5.6e-99
WP_003599730.1|2397745_2398579_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	7.3e-47
WP_003571396.1|2399343_2399880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661784.1|2400068_2401292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661779.1|2402361_2403921_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_003661777.1|2403917_2405240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041091585.1|2405241_2408247_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003580832.1|2408524_2409082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365506.1|2409176_2410373_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003661774.1|2410581_2411637_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003599756.1|2411907_2412537_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	37.5	1.6e-06
WP_003567322.1|2412672_2413002_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003599757.1|2412998_2413787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661773.1|2413839_2414628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567328.1|2414672_2414951_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003599758.1|2414974_2415259_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003567335.1|2415846_2417202_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003580849.1|2417507_2417819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003596308.1|2418376_2419393_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.7	1.9e-36
WP_016366046.1|2419606_2420986_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_016383809.1|2420996_2423189_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	8.1e-37
WP_003571414.1|2423654_2423792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032775417.1|2424160_2425279_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003567351.1|2425283_2426090_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003661762.1|2426451_2426649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003603311.1|2427195_2427435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2427481_2428402_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003599800.1|2428763_2428937_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_016365869.1|2428975_2429149_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003567359.1|2429470_2429695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032781092.1|2430496_2431309_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_167595908.1|2431592_2431751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599808.1|2431866_2432199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016365872.1|2432450_2432642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599812.1|2432955_2433291_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003574021.1|2433909_2434830_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003661740.1|2435212_2435467_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003603324.1|2435468_2435876_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_003599822.1|2436027_2436981_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.6	8.2e-10
WP_016365947.1|2437185_2437920_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003661736.1|2437945_2439109_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_016365497.1|2439284_2440661_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_003599827.1|2440793_2441552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003599829.1|2441843_2443451_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003603333.1|2443838_2446556_+	HAD-IC family P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	28.5	1.7e-60
WP_003580900.1|2446855_2447221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599833.1|2447374_2448748_-	MFS transporter	NA	NA	NA	NA	NA
WP_003599835.1|2448787_2450317_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003567401.1|2450443_2450635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003599837.1|2450763_2451402_+	cation transporter	NA	NA	NA	NA	NA
WP_003599840.1|2451422_2451755_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003567408.1|2451874_2452816_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567411.1|2452812_2453709_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003567413.1|2453705_2454449_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	1.1e-12
WP_003661721.1|2454724_2456191_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003567416.1|2456391_2456661_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_003567418.1|2456749_2456869_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003576335.1|2457069_2457987_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032781090.1|2458225_2458867_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003661717.1|2458984_2459617_-	NUDIX hydrolase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003599857.1|2459773_2460298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003661711.1|2460560_2462396_+	membrane protein	NA	NA	NA	NA	NA
WP_003661709.1|2462543_2463446_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567431.1|2463688_2463838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032781088.1|2464443_2466576_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_016383967.1|2466750_2467938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003576369.1|2469125_2469290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003574021.1|2469367_2470288_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003661703.1|2470729_2471086_-	CrcB family protein	NA	NA	NA	NA	NA
WP_003567441.1|2471079_2471490_-	CrcB family protein	NA	NA	NA	NA	NA
WP_003661700.1|2472543_2472804_+	2-phosphoglycerate dehydratase	NA	W6LP63	Streptococcus_phage	63.6	1.3e-10
WP_003567447.1|2473185_2474133_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003567449.1|2474192_2474966_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.6e-24
WP_003661698.1|2474965_2475748_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003567453.1|2475744_2476548_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003567455.1|2476926_2477901_-	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003661694.1|2477890_2479423_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	30.3	2.0e-29
WP_003661693.1|2479379_2480612_-	acyltransferase	NA	NA	NA	NA	NA
WP_003661692.1|2480608_2481310_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	39.3	1.6e-31
WP_016383785.1|2481306_2482122_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003661688.1|2482416_2483196_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_003661686.1|2483199_2483970_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_060473860.1|2483966_2484863_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.3e-13
WP_019728331.1|2484976_2485993_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_144340480.1|2487040_2487961_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003567474.1|2488114_2488438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016377049.1|2488549_2489548_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
>prophage 12
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	2494511	2519025	2995875	transposase	Escherichia_phage(50.0%)	22	NA	NA
WP_003663190.1|2494511_2496047_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.9	4.5e-66
WP_003663150.1|2496324_2496576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080771322.1|2496834_2497704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003662893.1|2497760_2499179_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158423314.1|2499283_2499811_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041091594.1|2500201_2501620_+|transposase	IS5-like element ISLrh3 family transposase	transposase	NA	NA	NA	NA
WP_003663110.1|2501743_2502859_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_003663109.1|2502884_2503727_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.4	1.3e-30
WP_003663107.1|2503802_2504828_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	2.1e-67
WP_016363480.1|2504830_2505403_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	44.1	9.8e-35
WP_003663104.1|2505442_2506318_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.2	4.4e-95
WP_003663102.1|2506328_2507756_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003663100.1|2507819_2509556_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_003663099.1|2509548_2510679_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_003663097.1|2510728_2511544_-	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	24.8	1.5e-07
WP_016363482.1|2511540_2512701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663093.1|2512706_2513690_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016363483.1|2513707_2514601_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003663089.1|2514828_2515329_-	multidrug MFS transporter	NA	NA	NA	NA	NA
WP_032781270.1|2515342_2515792_-	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_003663085.1|2516063_2517479_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041091597.1|2517618_2519025_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	2711422	2779502	2995875	transposase,protease,holin,tRNA	Streptococcus_phage(20.0%)	59	NA	NA
WP_003567794.1|2711422_2712439_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016383395.1|2712979_2714305_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003662635.1|2714310_2715270_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	7.4e-27
WP_003662634.1|2715269_2716802_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003662631.1|2717335_2719624_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003662629.1|2719763_2720597_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016376196.1|2720621_2721593_-	TDT family transporter	NA	NA	NA	NA	NA
WP_003662626.1|2722028_2722673_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003662625.1|2723196_2723871_-	HD domain-containing protein	NA	S4W232	Pandoravirus	30.5	6.6e-14
WP_032781163.1|2723998_2724415_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662623.1|2724627_2727156_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.9	3.2e-109
WP_003662622.1|2727220_2728225_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003662620.1|2728526_2729339_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567827.1|2729401_2729746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567829.1|2730053_2730317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567831.1|2730605_2731283_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_003662616.1|2731288_2731975_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003662615.1|2732019_2732832_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003567838.1|2732928_2733411_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	38.1	1.8e-21
WP_003567840.1|2733416_2734319_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016383391.1|2734568_2735771_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.9	5.6e-24
WP_016365408.1|2736075_2737269_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.8	1.9e-104
WP_003662610.1|2737668_2738367_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003567848.1|2738523_2738997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662605.1|2739703_2741686_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003662604.1|2741689_2742619_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003567854.1|2742744_2743497_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662599.1|2743601_2745116_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003577790.1|2745716_2746919_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	46.3	3.3e-88
WP_025376307.1|2747156_2747270_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003567861.1|2747643_2747886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003603520.1|2747910_2748081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567866.1|2748169_2748772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004271180.1|2748823_2749969_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	34.8	1.0e-54
WP_003603524.1|2750006_2751383_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003662593.1|2751439_2751727_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003662592.1|2751777_2752245_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025376308.1|2752260_2752887_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003662590.1|2753010_2755050_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_003662589.1|2755269_2755584_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003567884.1|2755667_2755982_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003662588.1|2755974_2757405_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_003662587.1|2757479_2758355_-	ROK family protein	NA	NA	NA	NA	NA
WP_041091378.1|2759014_2760031_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	3.2e-36
WP_003662581.1|2760835_2763475_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_016365850.1|2763523_2764849_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003567895.1|2765074_2765800_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003662576.1|2766057_2766786_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_003567899.1|2766782_2767019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003567901.1|2767011_2768604_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003576630.1|2768987_2769467_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_016365829.1|2769672_2770470_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032781161.1|2770725_2771574_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003662562.1|2772080_2773763_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003662559.1|2774223_2774976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003567918.1|2775643_2775802_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_032781159.1|2776056_2777982_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_003662554.1|2777920_2778268_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_003574021.1|2778581_2779502_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
>prophage 14
NZ_AP012541	Lactobacillus paracasei subsp. paracasei JCM 8130	2995875	2805987	2871611	2995875	transposase	unidentified_phage(18.18%)	55	NA	NA
WP_003574021.1|2805987_2806908_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_003574021.1|2808956_2809877_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	5.3e-22
WP_016377049.1|2810140_2811139_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.5	3.0e-55
WP_003576723.1|2814394_2814754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662503.1|2814933_2815290_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003662501.1|2815264_2817136_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_003662499.1|2817658_2818330_-	transaldolase	NA	C7BV14	Synechococcus_phage	23.2	1.3e-14
WP_016376134.1|2818458_2818839_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003662492.1|2818865_2819984_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_003568023.1|2820125_2820695_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003662491.1|2820712_2821222_-	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_032781153.1|2823117_2823918_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003568027.1|2824170_2824899_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_003568028.1|2825098_2825920_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003662486.1|2826013_2826883_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003568030.1|2827072_2827852_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_003568031.1|2827881_2828523_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_003568032.1|2828639_2828933_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003568034.1|2828963_2830484_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_003568036.1|2830503_2830962_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003571790.1|2831099_2832170_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_003662483.1|2832597_2833287_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_025376083.1|2834846_2836487_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003662478.1|2837134_2837614_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003662476.1|2837727_2838231_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_003662475.1|2838444_2838762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003576821.1|2838970_2839198_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_003662474.1|2839220_2839778_-	helix-turn-helix domain-containing protein	NA	A0A1B1P888	Bacillus_phage	44.1	5.8e-08
WP_003576828.1|2841279_2841693_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	48.9	8.1e-31
WP_003568103.1|2841859_2843236_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003568106.1|2843232_2844048_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003662470.1|2844044_2844977_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_016365304.1|2844939_2846085_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	40.4	4.1e-16
WP_003662466.1|2846341_2847778_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.6	2.6e-100
WP_003662465.1|2847811_2848372_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.8	7.1e-30
WP_003662464.1|2848465_2849197_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_041091620.1|2850045_2851062_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	34.5	6.4e-37
WP_011674977.1|2851912_2852929_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.4	2.4e-36
WP_071798850.1|2857515_2857695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003662456.1|2857706_2858492_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003662454.1|2858481_2859549_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_003662453.1|2859536_2860559_-	serine hydrolase	NA	NA	NA	NA	NA
WP_080543870.1|2860545_2861463_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003585938.1|2861389_2862322_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003568129.1|2862318_2862804_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003568131.1|2862870_2863707_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_003568133.1|2863699_2864536_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003568135.1|2864863_2865931_-	hydrolase	NA	NA	NA	NA	NA
WP_003662450.1|2866033_2866966_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_016365311.1|2867545_2868295_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003662448.1|2868374_2868695_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_003568143.1|2868865_2869120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003662444.1|2869292_2869952_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003662443.1|2869988_2870489_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_108299274.1|2870812_2871611_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
