The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014633	Thioploca ingrica DNA, complete genome	4810005	131148	188596	4810005	protease,tRNA,transposase	Bacillus_phage(15.38%)	51	NA	NA
WP_045471576.1|131148_132213_-|protease	membrane protease subunit, stomatin/prohibitin	protease	NA	NA	NA	NA
WP_052491611.1|132536_133592_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_052492207.1|134045_134201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045478495.1|134187_134433_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_083942402.1|134474_134969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491612.1|135445_136165_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_045471585.1|136190_136958_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_045471588.1|137106_137481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045471591.1|137729_139031_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_045471594.1|139136_140045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045471596.1|140441_141713_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_045471599.1|141724_142012_-	YggU family protein	NA	NA	NA	NA	NA
WP_045471602.1|142627_142999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045471605.1|143055_144024_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_045471608.1|144365_145343_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_045471611.1|145357_146554_-	DUF4350 domain-containing protein	NA	NA	NA	NA	NA
WP_045471614.1|146550_148878_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_045471617.1|150537_151491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045471621.1|151504_151873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045471624.1|151957_152551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045471627.1|152686_153145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491614.1|153158_154460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045478503.1|155287_155953_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.7e-33
WP_045471630.1|155949_157167_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_045471632.1|157159_157912_+	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_045471634.1|158040_159141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045471636.1|159306_161334_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	23.8	3.9e-25
WP_045471638.1|161643_163587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045471640.1|163999_164272_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	65.2	1.1e-20
WP_045471643.1|164407_166840_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.3	3.5e-214
WP_045471646.1|166995_168276_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	9.6e-131
WP_045471649.1|168335_168974_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.8	6.6e-56
WP_045471652.1|168983_170288_-	trigger factor	NA	NA	NA	NA	NA
WP_045471655.1|171344_171608_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	60.0	5.7e-22
WP_045471658.1|171708_172188_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.9	3.1e-26
WP_045471661.1|172285_173311_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_045471664.1|173464_174745_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_045471666.1|175222_177613_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_045471668.1|177615_177918_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	36.7	8.9e-11
WP_045471670.1|177895_178261_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045471673.1|178344_178701_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.7	2.1e-27
WP_045471675.1|178844_179057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083942687.1|179343_180573_+|transposase	transposase	transposase	A0A1V0SEV1	Hokovirus	24.9	7.3e-19
WP_045471679.1|180582_181005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045471682.1|181080_181680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045471685.1|181750_182884_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	42.4	2.0e-71
WP_045471687.1|184019_184478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045471689.1|184612_185077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083942403.1|185318_187274_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_045471692.1|187468_187696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045471695.1|187741_188596_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	40.6	1.7e-35
>prophage 2
NZ_AP014633	Thioploca ingrica DNA, complete genome	4810005	2411928	2462004	4810005	protease,tail,plate,transposase,integrase	Escherichia_phage(16.67%)	54	2410762:2410821	2459667:2459746
2410762:2410821	attL	ATTCACGATGAAAGGCAATGAGAGTGAAGAGGGTTAGACTCGGACTCCAGCAACCTTGAA	NA	NA	NA	NA
WP_045475113.1|2411928_2412672_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045475115.1|2412753_2413020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475116.1|2413117_2415421_-	hypothetical protein	NA	E3SIT4	Synechococcus_phage	26.9	3.4e-17
WP_045475118.1|2415465_2416020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475121.1|2416329_2418927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475123.1|2418929_2420723_-	hypothetical protein	NA	A0A1Q1PVP2	Phage_DP-2017a	25.2	2.4e-34
WP_045475125.1|2420894_2421293_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_045475127.1|2421298_2421532_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_045475129.1|2421714_2422032_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	39.1	7.1e-11
WP_045475131.1|2422031_2422310_-	peptidase	NA	A0A2L1IV28	Escherichia_phage	52.2	1.1e-20
WP_045475134.1|2422528_2422711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475136.1|2422707_2422911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475139.1|2423332_2423572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475141.1|2424212_2424578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475143.1|2424591_2426511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475146.1|2426524_2427052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475149.1|2427038_2429900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475151.1|2429903_2431820_-|plate	putative baseplate assembly protein	plate	A0A1B1IUR1	uncultured_Mediterranean_phage	35.4	1.1e-08
WP_083942547.1|2432127_2432523_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_045475155.1|2432497_2432854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491922.1|2432884_2433745_-	hypothetical protein	NA	J9PUM0	Bacillus_phage	37.3	1.4e-05
WP_045475157.1|2433879_2434989_-	phage late control D family protein	NA	NA	NA	NA	NA
WP_045475160.1|2434991_2435516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491923.1|2435520_2436243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475162.1|2436429_2436693_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_052491924.1|2436679_2436964_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_045475165.1|2437215_2437824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491925.1|2438038_2439139_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_052491926.1|2439191_2441279_-	ATP-binding protein	NA	K9MCS8	Sulfolobus_virus	33.8	3.6e-10
WP_045475167.1|2441275_2442106_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_045475169.1|2442108_2443488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475172.1|2443474_2444377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475175.1|2444554_2445058_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_083942548.1|2445077_2446907_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	31.8	1.0e-45
WP_045479663.1|2447297_2447528_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_045475178.1|2447524_2447887_+	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_045475181.1|2448089_2448308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475183.1|2448273_2448654_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_045475185.1|2448943_2450161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475187.1|2450212_2450980_-	hypothetical protein	NA	H7BV89	unidentified_phage	33.3	3.4e-06
WP_045475190.1|2451181_2451586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475193.1|2451585_2451897_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_045475196.1|2451921_2452131_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_045475198.1|2452330_2452588_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_045475201.1|2452571_2452799_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_045475203.1|2453098_2454067_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_045475206.1|2454193_2454409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083942549.1|2454606_2454972_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045475208.1|2455065_2455338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475210.1|2455410_2458005_+	DUF3987 domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	30.7	1.5e-26
WP_045475213.1|2458097_2458391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475216.1|2458387_2459566_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PGY7	Moraxella_phage	34.0	1.4e-48
WP_045475218.1|2459940_2460774_-	hypothetical protein	NA	NA	NA	NA	NA
2459667:2459746	attR	ATTCACGATGAAAGGCAATGAGAGTGAAGAGGGTTAGACTCGGACTCCAGCAACCTTGAACCGTTGCGGGTAGCTTCAGC	NA	NA	NA	NA
WP_052491930.1|2460939_2462004_-|protease	serine protease	protease	A0A1L3KJP6	Hubei_virga-like_virus	28.9	5.2e-13
>prophage 3
NZ_AP014633	Thioploca ingrica DNA, complete genome	4810005	2631617	2735615	4810005	transposase,integrase	Wolbachia_phage(25.0%)	47	2642402:2642420	2735613:2735631
WP_045475454.1|2631617_2632532_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	32.4	3.6e-23
WP_045475456.1|2632556_2633936_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_045475458.1|2633991_2635959_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_083942558.1|2636138_2637629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475462.1|2637885_2638119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045479773.1|2638121_2638397_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_052491956.1|2639629_2639950_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_083942559.1|2640046_2640469_-	hypothetical protein	NA	A0A218MNH3	uncultured_virus	30.0	2.6e-08
WP_083942560.1|2640484_2641363_-	hypothetical protein	NA	NA	NA	NA	NA
2642402:2642420	attL	TTATCTTGCCTTTGCTATA	NA	NA	NA	NA
WP_052491959.1|2643445_2644735_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_045475470.1|2644952_2658920_+	FkbM family methyltransferase	NA	D0R7J2	Paenibacillus_phage	26.1	2.0e-27
WP_083942710.1|2676670_2677930_+	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_045475474.1|2678003_2678795_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_045475476.1|2679143_2679998_+	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_045475478.1|2680013_2680256_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_045475480.1|2680286_2681450_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_045475482.1|2681446_2682475_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_052491960.1|2683175_2691953_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_083942711.1|2709869_2710979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475485.1|2711114_2711501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052491961.1|2712364_2712997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045475487.1|2714296_2716582_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_045475489.1|2717152_2718421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475491.1|2719299_2719527_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_045475492.1|2719803_2721063_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_045475493.1|2721062_2721818_+	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
WP_045475495.1|2722248_2722440_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_045475497.1|2722507_2722798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475499.1|2723019_2723319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083942561.1|2723897_2724155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083942562.1|2724295_2724526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475501.1|2724567_2724789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475502.1|2724884_2725082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083942563.1|2725123_2725366_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_045475504.1|2725429_2725711_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_045475507.1|2725905_2726091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475508.1|2726407_2727118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045474052.1|2727995_2728178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045473895.1|2728174_2728441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475510.1|2728798_2729077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083942475.1|2729184_2729448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491779.1|2729535_2729808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491964.1|2730271_2730814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475512.1|2730948_2731140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475514.1|2731739_2734076_+	hypothetical protein	NA	A0A1V0SGR7	Hokovirus	29.2	3.8e-16
WP_045475516.1|2735030_2735219_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083942564.1|2735207_2735615_-|transposase	transposase	transposase	NA	NA	NA	NA
2735613:2735631	attR	TATAGCAAAGGCAAGATAA	NA	NA	NA	NA
>prophage 4
NZ_AP014633	Thioploca ingrica DNA, complete genome	4810005	2851327	2921597	4810005	protease,integrase,tRNA,transposase	Lake_Baikal_phage(14.29%)	50	2893550:2893565	2922160:2922175
WP_045475758.1|2851327_2851843_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_045475761.1|2851856_2852723_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_052491974.1|2852706_2854644_+	adenylate/guanylate cyclase domain-containing protein	NA	A0A2H4N7Z5	Lake_Baikal_phage	26.0	1.4e-19
WP_045475764.1|2854737_2855466_+	DUF928 domain-containing protein	NA	NA	NA	NA	NA
WP_045475766.1|2855881_2856781_-	cation transporter	NA	NA	NA	NA	NA
WP_045475768.1|2856796_2858107_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_045475769.1|2858236_2863600_-	tandem-95 repeat protein	NA	M1ID94	Pelagibacter_phage	25.7	5.1e-08
WP_045475770.1|2864229_2864808_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_045475771.1|2864826_2865444_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_045475772.1|2865497_2867771_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	1.1e-174
WP_045475774.1|2867898_2868219_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.3	2.5e-11
WP_045475776.1|2868452_2868884_+	RDD family protein	NA	NA	NA	NA	NA
WP_045475777.1|2869381_2875528_-	choice-of-anchor D domain-containing protein	NA	NA	NA	NA	NA
WP_045475779.1|2876535_2877396_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.5	1.6e-41
WP_045475781.1|2877547_2878555_+	phosphotransferase	NA	NA	NA	NA	NA
WP_045475782.1|2878596_2879265_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_045475784.1|2879411_2879768_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_045475786.1|2879780_2879978_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_045475790.1|2882806_2883529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052491975.1|2883546_2884530_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_045475791.1|2884750_2885368_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_045475793.1|2885427_2890908_-	AAA family ATPase	NA	A0A1V0SGX0	Hokovirus	36.1	4.1e-29
WP_045475795.1|2891153_2892050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475796.1|2892147_2892681_-	hypothetical protein	NA	NA	NA	NA	NA
2893550:2893565	attL	CACTGCCATTAAGTTA	NA	NA	NA	NA
WP_052491976.1|2894067_2894499_+	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045475798.1|2894683_2897530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052491977.1|2897609_2898008_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_045475799.1|2898257_2899202_+	histone deacetylase	NA	NA	NA	NA	NA
WP_045475801.1|2899311_2899890_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_045475802.1|2900019_2901429_-	CSLREA domain-containing protein	NA	NA	NA	NA	NA
WP_045475804.1|2902172_2902592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475806.1|2902667_2903063_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_083942713.1|2903059_2903278_-	DUF2281 domain-containing protein	NA	NA	NA	NA	NA
WP_045475809.1|2903431_2905351_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_045475811.1|2905433_2907863_-	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_045475813.1|2908016_2908952_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_045475815.1|2909065_2909344_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_045475816.1|2909428_2910730_+	GTPase HflX	NA	NA	NA	NA	NA
WP_045475818.1|2910940_2912098_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_083942714.1|2912100_2913084_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_045475820.1|2913224_2913410_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_045475822.1|2913448_2914696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045475824.1|2914749_2916042_+	adenylosuccinate synthase	NA	A0A291AUF9	Pandoravirus	31.7	1.7e-58
WP_045479865.1|2916322_2917018_+	pirin family protein	NA	NA	NA	NA	NA
WP_083942570.1|2917132_2918047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475827.1|2918085_2919792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491978.1|2920223_2920478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052491979.1|2920571_2920982_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083942715.1|2921032_2921179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045475828.1|2921198_2921597_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2922160:2922175	attR	TAACTTAATGGCAGTG	NA	NA	NA	NA
