The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP013063	Serratia marcescens SM39	5225577	228449	264580	5225577	tail,integrase,transposase,capsid	Pseudomonas_phage(65.71%)	43	247954:247970	268020:268036
WP_052475377.1|228449_230414_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.2e-85
WP_070099205.1|230415_231219_-	hypothetical protein	NA	A0A2D1GNV9	Pseudomonas_phage	48.0	3.1e-71
WP_041033390.1|231215_233939_-	hypothetical protein	NA	A0A2D1GNP9	Pseudomonas_phage	67.6	6.7e-299
WP_041033392.1|233939_234137_-	hypothetical protein	NA	A0A2D1GNL8	Pseudomonas_phage	69.2	6.4e-18
WP_041033394.1|234146_234380_-	hypothetical protein	NA	A0A2D1GNV4	Pseudomonas_phage	80.5	1.7e-33
WP_041033396.1|234389_235205_-	phage BR0599 family protein	NA	A0A2D1GNT2	Pseudomonas_phage	70.5	8.0e-115
WP_041033398.1|235191_236376_-	hypothetical protein	NA	A0A2D1GNY4	Pseudomonas_phage	54.2	6.8e-115
WP_080335397.1|236372_239645_-|tail	phage tail length tape measure family protein	tail	A0A125RNI9	Pseudomonas_phage	35.3	3.4e-55
WP_052475380.1|239801_240293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041033400.1|240289_241042_-	hypothetical protein	NA	A0A2D1GNQ7	Pseudomonas_phage	57.0	2.2e-74
WP_041033402.1|241028_241229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041033404.1|241216_241663_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	34.0	5.0e-18
WP_041033406.1|241659_242184_-	DUF1320 domain-containing protein	NA	Q5ZQX5	Pseudomonas_phage	55.0	5.3e-43
WP_041033408.1|242195_243125_-|capsid	major capsid protein	capsid	J9SVQ2	Pseudomonas_phage	69.5	1.3e-124
WP_041033410.1|243192_243570_-	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	47.2	1.7e-19
WP_154232835.1|243566_244652_-	peptidase	NA	J9SGT4	Pseudomonas_phage	51.6	1.5e-76
WP_041033412.1|244948_245512_-	phage virion morphogenesis protein	NA	Q5ZQY1	Pseudomonas_phage	51.9	1.2e-48
WP_041033413.1|245511_246729_-	bacteriophage protein	NA	J9STS2	Pseudomonas_phage	55.1	2.2e-124
WP_080335398.1|246718_248233_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	54.6	9.3e-149
247954:247970	attL	GTTCACCACCGGCTTCG	NA	NA	NA	NA
WP_041033417.1|248229_249909_-	phage protein	NA	A0A219VH72	Ochrobactrum_phage	45.9	4.4e-115
WP_041033419.1|249908_250460_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	68.8	4.2e-43
WP_041033421.1|250461_250758_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	67.0	2.1e-28
WP_041033422.1|250769_251072_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_052475383.1|251176_251611_-	hypothetical protein	NA	Q6TM80	Pseudomonas_phage	40.3	2.4e-09
WP_041033424.1|251597_252218_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	61.6	3.6e-67
WP_041033426.1|252220_252589_-	membrane protein	NA	A4JWP3	Burkholderia_virus	54.3	7.2e-23
WP_041033428.1|252707_253907_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	31.7	3.0e-49
WP_041033430.1|253909_254917_-	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	36.9	4.2e-57
WP_041033432.1|255207_255975_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.9	6.0e-104
WP_154232790.1|256011_256398_-	hypothetical protein	NA	B5WZU2	Pseudomonas_phage	45.5	3.8e-06
WP_041033434.1|256441_256858_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041033437.1|256948_257173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033439.1|257176_257485_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	61.7	1.4e-24
WP_041033441.1|257498_258410_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.7	1.2e-82
WP_041033443.1|258411_260184_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	66.6	6.4e-226
WP_041033445.1|260192_261356_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	61.1	3.0e-123
WP_154232791.1|261383_261686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033448.1|261678_261903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033450.1|261928_262453_+	host-nuclease inhibitor Gam family protein	NA	A0A125RNF6	Pseudomonas_phage	58.9	2.6e-50
WP_041033454.1|262646_262940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033456.1|262923_263646_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	33.8	4.0e-25
WP_052475384.1|263778_264204_+	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	44.8	8.9e-25
WP_170865746.1|264229_264580_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	33.9	1.8e-10
268020:268036	attR	CGAAGCCGGTGGTGAAC	NA	NA	NA	NA
>prophage 2
NZ_AP013063	Serratia marcescens SM39	5225577	544161	589674	5225577	tail,integrase	Cronobacter_phage(27.91%)	62	545889:545935	590908:590954
WP_033637396.1|544161_545028_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	9.0e-32
WP_172668113.1|545233_545443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070099211.1|545439_545760_+	hypothetical protein	NA	NA	NA	NA	NA
545889:545935	attL	CTTCTAAGCCGTAGGTCATAGGTTCGAATCCTATAGGGCGTGCCATT	NA	NA	NA	NA
WP_041033733.1|545954_547115_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	69.5	3.9e-155
WP_041033735.1|547538_548186_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	75.9	3.2e-90
WP_041033738.1|548182_548371_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041033740.1|548385_548757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048796803.1|548980_549199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052475393.1|549176_549875_-	hypothetical protein	NA	R9W0X9	Serratia_phage	37.0	1.6e-23
WP_041033742.1|549871_550105_-	hypothetical protein	NA	B1GS76	Salmonella_phage	48.2	7.1e-08
WP_154232793.1|550101_550455_-	hypothetical protein	NA	F1C5B5	Cronobacter_phage	42.0	2.1e-11
WP_041033744.1|550777_550978_-	hypothetical protein	NA	R9VYJ0	Serratia_phage	97.0	3.5e-32
WP_052475395.1|550970_551504_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	56.5	1.3e-41
WP_052475396.1|551500_551977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041033746.1|551960_552800_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	59.3	5.1e-80
WP_041033748.1|552802_553006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041033750.1|553055_553745_-	hypothetical protein	NA	A0A088C400	Shewanella_sp._phage	39.2	1.5e-24
WP_041033753.1|553744_554410_-	ATP-binding protein	NA	G9L667	Escherichia_phage	61.8	3.4e-71
WP_041033756.1|554409_555081_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.9	1.2e-18
WP_154232794.1|555240_555384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052475397.1|555923_556262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080335402.1|556764_557427_-	LexA family transcriptional regulator	NA	A0A1R3Y604	Salmonella_virus	57.1	1.3e-17
WP_041033757.1|557468_557681_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	75.4	1.4e-23
WP_041033759.1|557706_557997_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	44.0	7.2e-10
WP_154232795.1|558292_558451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033761.1|558443_559502_+	replication protein	NA	A0A2H4J2W5	uncultured_Caudovirales_phage	81.6	4.9e-56
WP_080335469.1|559501_560893_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	62.5	3.9e-154
WP_052475398.1|560892_561315_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	60.9	4.1e-46
WP_041033765.1|561311_561668_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	70.3	6.1e-43
WP_041033767.1|561664_562477_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	57.5	5.2e-82
WP_041033769.1|562959_563184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033771.1|563243_563504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033773.1|563503_564031_+	lysozyme	NA	H9C184	Pectobacterium_phage	83.0	2.2e-81
WP_080335470.1|564143_564506_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_154232796.1|564813_565437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033646503.1|565604_565859_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	65.5	2.0e-24
WP_041033779.1|565906_566167_+	DUF2560 family protein	NA	NA	NA	NA	NA
WP_041033781.1|566159_566810_+	hypothetical protein	NA	I6S676	Salmonella_phage	73.1	1.3e-88
WP_041033784.1|566841_567321_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	70.4	2.8e-59
WP_041033786.1|567307_568786_+	phage DNA Packaging protein	NA	G0ZND4	Cronobacter_phage	86.0	5.5e-255
WP_041033788.1|568807_570136_+	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	76.6	4.5e-200
WP_080335471.1|570119_571853_+	hypothetical protein	NA	G0ZND6	Cronobacter_phage	71.2	6.5e-231
WP_041033790.1|571856_573122_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	76.2	5.1e-185
WP_041033792.1|573134_573581_+	hypothetical protein	NA	A0A1V0E5Q8	Salmonella_phage	87.2	2.7e-64
WP_041033794.1|573598_574675_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	89.7	2.7e-187
WP_041033796.1|574684_574978_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	77.3	4.1e-37
WP_041033798.1|575044_575443_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	83.2	4.7e-60
WP_041033800.1|575614_575962_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	59.1	8.6e-34
WP_041033802.1|575964_576375_+	hypothetical protein	NA	A0A291AXD9	Shigella_phage	58.1	7.8e-34
WP_041033804.1|576371_576755_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	49.6	1.5e-31
WP_041033806.1|576815_577565_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	55.2	2.3e-63
WP_041033808.1|577616_578297_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.5	1.1e-61
WP_080335404.1|578569_578911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033810.1|578921_579644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041037905.1|579747_580332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154232797.1|580334_580679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041033812.1|580737_583890_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	51.4	3.4e-193
WP_041033814.1|583948_584416_+	hypothetical protein	NA	A0A173GC35	Salmonella_phage	64.7	8.5e-53
WP_041033816.1|584416_584887_+	DUF1833 family protein	NA	R9TPR6	Aeromonas_phage	57.5	5.4e-47
WP_041037907.1|584906_585299_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	65.5	5.0e-46
WP_041033818.1|585258_587748_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	55.6	9.2e-263
WP_080335405.1|587748_589674_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.0	1.6e-100
590908:590954	attR	CTTCTAAGCCGTAGGTCATAGGTTCGAATCCTATAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
NZ_AP013063	Serratia marcescens SM39	5225577	1262349	1296916	5225577	integrase,tail,holin,terminase,head	uncultured_Caudovirales_phage(31.03%)	47	1261199:1261214	1283646:1283661
1261199:1261214	attL	CATCACGTCCGGCATC	NA	NA	NA	NA
WP_041034468.1|1262349_1263420_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q9MCR4	Enterobacteria_phage	52.8	4.7e-107
WP_041034470.1|1263361_1263622_-	excisionase	NA	A0A1V0E5M4	Salmonella_phage	62.9	8.4e-18
WP_168166355.1|1263838_1264015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041034472.1|1264056_1264557_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	68.7	5.7e-55
WP_041034474.1|1264553_1266719_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	40.5	1.7e-132
WP_041034476.1|1266770_1267049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041034479.1|1267059_1267377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154232805.1|1267415_1267850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080335416.1|1267866_1268268_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	59.4	9.3e-40
WP_041034483.1|1268346_1268547_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041034485.1|1268607_1269060_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.8	4.4e-30
WP_041034487.1|1269083_1269302_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	59.4	9.2e-18
WP_041034489.1|1269304_1270024_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	69.0	3.2e-30
WP_041034491.1|1270020_1271394_+	hypothetical protein	NA	Q76H51	Enterobacteria_phage	48.4	8.8e-114
WP_041034493.1|1271438_1271861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034495.1|1271864_1272110_+	hypothetical protein	NA	H9C167	Pectobacterium_phage	47.6	6.5e-12
WP_154232806.1|1272471_1272651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034500.1|1272647_1272908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052475410.1|1272897_1273431_+	ead/Ea22-like family protein	NA	R9W086	Serratia_phage	39.7	4.6e-18
WP_080335417.1|1273607_1273799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034502.1|1273869_1274466_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	66.7	1.2e-75
WP_041034504.1|1274474_1274780_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	56.8	2.0e-26
WP_154232807.1|1274767_1275055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034508.1|1275057_1275354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034510.1|1275382_1275880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034512.1|1275890_1276118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034514.1|1276121_1277747_+|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	58.4	7.3e-176
WP_041034516.1|1277743_1277977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034518.1|1277963_1278785_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	38.9	6.1e-38
WP_041034520.1|1278800_1279205_+	phage family protein	NA	Q716B1	Shigella_phage	68.0	2.2e-41
WP_041034522.1|1279416_1280328_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.3	1.4e-43
WP_041034525.1|1280382_1280946_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	50.8	1.3e-50
WP_041034527.1|1280948_1282937_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	46.9	1.1e-178
WP_041034529.1|1282939_1283389_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	45.0	6.8e-23
WP_041034530.1|1283391_1283919_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	45.7	6.5e-09
1283646:1283661	attR	CATCACGTCCGGCATC	NA	NA	NA	NA
WP_041034532.1|1283918_1286624_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	60.5	2.4e-304
WP_041034534.1|1286623_1289515_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	74.0	0.0e+00
WP_154232808.1|1289558_1289885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034538.1|1289922_1290306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034540.1|1290366_1290708_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	48.2	1.5e-19
WP_041034542.1|1290704_1292315_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	71.6	5.1e-230
WP_052475411.1|1292330_1294766_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.3	4.0e-101
WP_041034544.1|1294768_1295452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034546.1|1295570_1295804_+|holin	class II holin family protein	holin	H9C183	Pectobacterium_phage	69.6	1.6e-20
WP_041034548.1|1295787_1296303_+	lysozyme	NA	Q71TF3	Escherichia_phage	52.8	7.0e-48
WP_041034550.1|1296287_1296662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041034552.1|1296658_1296916_+	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	58.1	1.7e-15
>prophage 4
NZ_AP013063	Serratia marcescens SM39	5225577	1580153	1611376	5225577	coat,protease	Moraxella_phage(33.33%)	27	NA	NA
WP_033638278.1|1580153_1581089_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_172668115.1|1581109_1583530_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_041034821.1|1583597_1584362_-	molecular chaperone	NA	NA	NA	NA	NA
WP_086557004.1|1584386_1584935_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_072008406.1|1584940_1585444_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033638282.1|1585446_1585986_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_041034823.1|1586260_1587697_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033647432.1|1587798_1590429_-	PqiB family protein	NA	NA	NA	NA	NA
WP_041037977.1|1590397_1591645_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_033638286.1|1591900_1592398_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|1592494_1593205_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638289.1|1593224_1595273_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_033638291.1|1595582_1596461_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_041034825.1|1596698_1597406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033646331.1|1597506_1598901_-	MFS transporter	NA	NA	NA	NA	NA
WP_041034827.1|1599132_1599924_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_041034829.1|1599970_1600774_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041034831.1|1600776_1601640_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041034833.1|1601641_1602778_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	1.3e-25
WP_041034835.1|1602774_1603785_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638301.1|1603960_1604680_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_041034837.1|1604835_1605939_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_033653909.1|1605948_1606758_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_033653910.1|1606821_1608213_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_033638305.1|1608394_1608943_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_033653911.1|1609365_1610031_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_033653912.1|1610095_1611376_-|protease	protease	protease	NA	NA	NA	NA
>prophage 5
NZ_AP013063	Serratia marcescens SM39	5225577	1628246	1643531	5225577	tRNA	Tupanvirus(40.0%)	15	NA	NA
WP_025159696.1|1628246_1630175_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_048233542.1|1630178_1630730_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_004931418.1|1630828_1631026_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004931417.1|1631069_1631426_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_151498502.1|1631492_1631588_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931416.1|1631834_1632818_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_041034859.1|1632832_1635220_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.4e-05
WP_004931414.1|1635224_1635521_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_039566415.1|1636070_1636487_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_033653920.1|1636665_1637673_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_041034862.1|1637718_1638270_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	35.0	1.5e-16
WP_041034864.1|1638275_1639031_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	3.3e-06
WP_033638335.1|1639427_1640582_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	25.2	1.2e-28
WP_033638338.1|1640568_1641549_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	B9UDL7	Salmonella_phage	32.4	3.1e-36
WP_041037979.1|1641548_1643531_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	1.1e-21
>prophage 6
NZ_AP013063	Serratia marcescens SM39	5225577	2901015	2921820	5225577	tail,holin	Klebsiella_phage(33.33%)	24	NA	NA
WP_080335440.1|2901015_2902518_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1I9SF20	Klebsiella_phage	41.3	3.0e-30
WP_052475425.1|2902539_2903739_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	34.7	1.6e-47
WP_152903591.1|2903788_2904760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041036001.1|2904779_2907986_-	host specificity protein J	NA	F1C571	Cronobacter_phage	64.2	0.0e+00
WP_041036003.1|2908039_2908666_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	54.2	8.2e-51
WP_154232821.1|2908708_2909059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041036005.1|2909096_2909801_-	C40 family peptidase	NA	K7PGR2	Enterobacteria_phage	75.3	1.8e-107
WP_170929876.1|2909810_2910563_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	65.2	2.4e-97
WP_033639815.1|2910572_2910911_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.4e-33
WP_041036008.1|2910910_2913244_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.2	1.0e-13
WP_004935830.1|2913236_2913458_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	47.9	1.7e-11
WP_041036010.1|2913475_2913841_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	43.6	2.6e-20
WP_033652513.1|2913967_2914423_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	75.5	2.5e-57
WP_041036013.1|2914463_2914856_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	46.0	1.4e-19
WP_041036015.1|2914852_2915242_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.1	1.8e-24
WP_041036017.1|2915299_2915740_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	61.6	4.4e-43
WP_041036019.1|2915726_2916047_-|holin	phage holin family protein	holin	F1C5D1	Cronobacter_phage	80.0	1.5e-40
WP_019453679.1|2916839_2917202_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
WP_041036021.1|2917412_2918090_+	peptidase S24	NA	K7PK07	Enterobacteria_phage	44.6	7.9e-07
WP_033635291.1|2918516_2918846_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_041036023.1|2918973_2919441_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_039565032.1|2919548_2920127_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041036025.1|2920120_2920537_-	VOC family protein	NA	NA	NA	NA	NA
WP_033635297.1|2920689_2921820_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.9	1.8e-104
>prophage 7
NZ_AP013063	Serratia marcescens SM39	5225577	4764726	4838781	5225577	integrase,plate,portal,protease,tRNA,capsid,tail,lysis,terminase,head	Erwinia_phage(33.33%)	79	4761072:4761091	4836935:4836954
4761072:4761091	attL	GCAGCAGCAGGCGGAAGGCG	NA	NA	NA	NA
WP_041037431.1|4764726_4765200_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_041037433.1|4765243_4766638_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.7	1.7e-19
WP_004931124.1|4766634_4767333_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	2.4e-06
WP_004931122.1|4767481_4767961_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_041037435.1|4768160_4769141_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	95.7	2.5e-179
WP_001099751.1|4769210_4769504_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_001583792.1|4769640_4769913_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001670778.1|4770082_4770583_+	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_041037442.1|4770646_4770880_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	79.7	5.4e-24
WP_040229177.1|4770870_4771167_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	71.7	1.6e-28
WP_016243384.1|4771171_4771396_+	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	5.2e-24
WP_016243385.1|4771392_4771668_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	75.8	2.9e-32
WP_041037451.1|4771657_4773949_+	replication endonuclease	NA	Q858T4	Yersinia_virus	83.6	0.0e+00
WP_041037458.1|4774632_4775655_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	99.1	4.7e-197
WP_041037460.1|4775651_4776398_-	hypothetical protein	NA	O80303	Escherichia_phage	94.0	1.3e-135
WP_041037462.1|4776397_4778167_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	99.5	0.0e+00
WP_032448423.1|4778332_4779187_+|capsid	capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	99.3	1.6e-158
WP_001248605.1|4779262_4780330_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	99.4	2.9e-197
WP_032448424.1|4780333_4781083_+|terminase	terminase endonuclease subunit	terminase	A0A218M4L0	Erwinia_phage	96.9	7.4e-115
WP_041037468.1|4781176_4781686_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	97.6	4.7e-89
WP_000870101.1|4781685_4781889_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	95.5	9.8e-30
WP_001437784.1|4781879_4782101_+	primosomal protein	NA	A0A218M4L5	Erwinia_phage	98.6	8.4e-35
WP_041037473.1|4782084_4782594_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	92.9	2.4e-85
WP_032237124.1|4782590_4783004_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	69.3	1.1e-43
WP_041037477.1|4783111_4783579_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	99.4	5.5e-84
WP_032237126.1|4783571_4784021_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	98.0	1.3e-71
WP_032448428.1|4784089_4784725_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	97.6	2.1e-110
WP_000127178.1|4784721_4785069_+	GPW/gp25 family protein	NA	A0A218M4K8	Erwinia_phage	99.1	5.5e-57
WP_041037482.1|4785075_4785984_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	98.0	1.9e-157
WP_041037484.1|4785976_4786585_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	97.0	1.1e-111
WP_041037486.1|4787627_4788056_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	37.8	1.2e-16
WP_041037488.1|4788187_4789366_+|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	97.2	3.1e-216
WP_001207674.1|4789381_4789900_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	6.5e-94
WP_041037492.1|4789963_4790299_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	97.3	1.5e-51
WP_000763323.1|4790331_4790451_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	100.0	1.4e-15
WP_041037494.1|4790443_4792885_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	85.4	9.6e-305
WP_041038173.1|4792896_4793382_+|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	90.7	3.2e-79
WP_041037496.1|4793378_4794548_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	98.5	1.4e-208
WP_000468311.1|4794625_4794844_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_032448435.1|4794879_4795296_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.0e-33
WP_041037498.1|4795552_4796455_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_004931116.1|4796686_4797649_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_033636447.1|4797835_4798825_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004931113.1|4798890_4799658_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_033636444.1|4799785_4800370_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_033639143.1|4800569_4800989_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_041037503.1|4801000_4801747_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_041037505.1|4801750_4802362_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_033649888.1|4802659_4803844_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.3	4.1e-11
WP_033654536.1|4804036_4805047_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_033654537.1|4805177_4806686_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004931095.1|4806728_4807574_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.7	2.0e-15
WP_004931092.1|4808098_4808338_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_004931090.1|4808398_4808884_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_033636436.1|4808959_4809877_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_033636435.1|4809973_4811308_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GFL6	Erwinia_phage	29.0	3.8e-45
WP_033649891.1|4811320_4811851_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_041037508.1|4811953_4812886_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_004931082.1|4812951_4813980_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_033654545.1|4814271_4816467_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_004931078.1|4816666_4816882_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_006317756.1|4816959_4817277_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_041037511.1|4817581_4818742_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_041037513.1|4818744_4821180_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_033636430.1|4821408_4822305_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_033638623.1|4822416_4825053_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_041037515.1|4825310_4826456_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_033636428.1|4826672_4827677_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_033636427.1|4827697_4828471_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_019452247.1|4828496_4829717_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_041037518.1|4829785_4831159_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_033654540.1|4831195_4831522_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_041037519.1|4831704_4833153_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_019452251.1|4833225_4833957_-	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	57.2	1.4e-46
WP_033636422.1|4834108_4835026_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_004931047.1|4835008_4836406_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_004931044.1|4836623_4837256_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
4836935:4836954	attR	CGCCTTCCGCCTGCTGCTGC	NA	NA	NA	NA
WP_033649905.1|4837271_4837643_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_033636420.1|4837677_4838781_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_AP013063	Serratia marcescens SM39	5225577	5037217	5085083	5225577	tRNA,transposase,integrase	Shigella_phage(23.08%)	40	5039996:5040014	5090855:5090873
WP_015376459.1|5037217_5037982_+|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_033636871.1|5037997_5039605_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9J5	Catovirus	30.3	3.2e-59
WP_041037659.1|5039831_5040335_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
5039996:5040014	attL	CCAGCGCCTGCAGCGCCAG	NA	NA	NA	NA
WP_033648627.1|5040535_5043412_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	3.0e-140
WP_033631663.1|5043424_5043874_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_033636874.1|5043958_5045470_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	1.3e-46
WP_041037661.1|5045752_5046847_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_033636876.1|5046846_5047917_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_033636877.1|5047979_5048738_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_033636878.1|5048938_5049655_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080289878.1|5049655_5050348_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_041037663.1|5051558_5051951_-	VOC family protein	NA	NA	NA	NA	NA
WP_041037665.1|5051952_5053284_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_041037667.1|5053280_5054810_-	pentose kinase	NA	NA	NA	NA	NA
WP_041037669.1|5054876_5055626_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_033636884.1|5055781_5057164_-	gluconate permease	NA	NA	NA	NA	NA
WP_033652796.1|5057166_5058132_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041037671.1|5058162_5058930_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	46.0	3.2e-49
WP_154232829.1|5058985_5059240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172668124.1|5061205_5061439_-|transposase	transposase	transposase	U5P429	Shigella_phage	49.3	2.5e-13
WP_154232831.1|5061410_5061812_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	44.3	2.2e-17
WP_080335461.1|5062148_5062352_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_041037674.1|5062584_5065740_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.4	7.5e-68
WP_034917146.1|5065774_5066821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041037676.1|5066825_5068166_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_041037678.1|5068155_5069712_-	SAM-dependent DNA methyltransferase	NA	A0A2H4UVW8	Bodo_saltans_virus	22.1	2.0e-05
WP_154232832.1|5070307_5071443_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.0	7.6e-79
WP_080335462.1|5071520_5072261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041037685.1|5073378_5075175_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_041037687.1|5075267_5076137_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_041037689.1|5077557_5078766_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	2.4e-46
WP_041037691.1|5078855_5079974_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_041037693.1|5080209_5080518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080335463.1|5080412_5080655_-	ash family protein	NA	NA	NA	NA	NA
WP_041037695.1|5081038_5081863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128884582.1|5081867_5082179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041037699.1|5082305_5082605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041037701.1|5082777_5083170_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	68.1	7.2e-45
WP_041037703.1|5083166_5083514_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	93.0	1.7e-58
WP_041037705.1|5083544_5085083_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	89.8	5.9e-268
5090855:5090873	attR	CTGGCGCTGCAGGCGCTGG	NA	NA	NA	NA
