The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014648	Methyloceanibacter caenitepidi strain Gela4	3424964	617961	637172	3424964		Ralstonia_phage(26.67%)	30	NA	NA
WP_082025755.1|617961_618927_-	acyltransferase family protein	NA	A0A142KBN9	Gordonia_phage	35.6	8.0e-05
WP_156137360.1|619298_619472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364351.1|619468_620017_-	3'-5' exoribonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	44.2	1.1e-38
WP_045364354.1|620013_620193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364356.1|620189_622394_-	hypothetical protein	NA	A0A221SAP2	Ralstonia_phage	40.0	1.7e-135
WP_045364359.1|622390_622885_-	hypothetical protein	NA	A0A142K9Y8	Gordonia_phage	50.9	6.5e-35
WP_052464071.1|622881_623295_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_156137667.1|623291_623828_-	phosphohydrolase	NA	B4UTT6	Rhizobium_phage	52.3	2.1e-47
WP_045364364.1|623938_624214_-	DUF2312 domain-containing protein	NA	A0A076YL00	Rhizobium_phage	62.0	2.1e-19
WP_045364367.1|624210_624516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364369.1|624521_625112_-	DUF2815 family protein	NA	NA	NA	NA	NA
WP_082025427.1|625112_625433_-	endonuclease VII domain-containing protein	NA	B6Z9I4	Kluyvera_phage	40.2	4.7e-10
WP_052464072.1|625551_626847_-	DUF2800 domain-containing protein	NA	A0A221SAN8	Ralstonia_phage	37.7	1.4e-44
WP_045364372.1|626843_627062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364375.1|627058_627274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364378.1|627273_627477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364381.1|627473_627662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364384.1|627760_628258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364387.1|628344_629625_-	DEAD/DEAH box helicase	NA	A0A221SAP7	Ralstonia_phage	36.9	1.6e-61
WP_156137362.1|629884_630121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156137363.1|630117_630948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364404.1|631570_631882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045364407.1|631894_632359_-	hypothetical protein	NA	E9P621	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	47.6	3.5e-30
WP_052464073.1|632526_633030_-	hypothetical protein	NA	A0A0K0NLG7	Gordonia_phage	45.7	3.0e-11
WP_156137668.1|633026_633209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172653278.1|633413_633872_+	bifunctional DNA primase/polymerase	NA	A0A173H0P8	Pseudoalteromonas_phage	36.5	5.3e-15
WP_052464075.1|633858_634632_+	AAA family ATPase	NA	A0A221SAP5	Ralstonia_phage	44.4	7.3e-17
WP_052464076.1|634628_635315_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	42.6	6.3e-20
WP_156137364.1|635333_635906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082025756.1|636782_637172_-	hypothetical protein	NA	I1TRH1	Cronobacter_phage	46.7	5.0e-22
>prophage 2
NZ_AP014648	Methyloceanibacter caenitepidi strain Gela4	3424964	1541667	1549355	3424964	terminase	uncultured_Mediterranean_phage(14.29%)	9	NA	NA
WP_045366089.1|1541667_1543776_-	hypothetical protein	NA	A0A1B1IQR4	uncultured_Mediterranean_phage	37.4	1.4e-107
WP_172653317.1|1543778_1544303_-	hypothetical protein	NA	A0A2I7RZM9	Vibrio_phage	28.8	7.4e-13
WP_045366094.1|1544310_1545882_-|terminase	terminase	terminase	B5WZR8	Pseudomonas_phage	59.5	1.1e-160
WP_045366097.1|1545826_1546336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045366100.1|1546474_1546837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045366102.1|1546808_1547270_-	hypothetical protein	NA	A0A1X9SH22	Bradyrhizobium_phage	36.6	3.1e-15
WP_045366105.1|1547266_1547533_-	DUF2829 domain-containing protein	NA	A0A1X9HVT2	Ruegeria_phage	46.3	8.9e-15
WP_082025544.1|1547556_1548606_-	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	36.6	2.8e-35
WP_082025545.1|1548566_1549355_-	site-specific DNA-methyltransferase	NA	A0A0A8ILE7	Aurantimonas_phage	55.2	3.5e-83
>prophage 3
NZ_AP014648	Methyloceanibacter caenitepidi strain Gela4	3424964	1915462	1924621	3424964	tRNA	uncultured_Mediterranean_phage(75.0%)	10	NA	NA
WP_082025583.1|1915462_1916320_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	38.3	8.9e-40
WP_082025784.1|1916671_1917466_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	46.8	3.8e-45
WP_045366751.1|1917542_1918670_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	1.4e-29
WP_045366752.1|1918792_1919020_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	71.1	2.1e-09
WP_052464277.1|1919083_1919590_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_045369838.1|1919622_1920417_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	45.9	3.0e-50
WP_045366753.1|1920524_1921820_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.4	2.1e-109
WP_045366754.1|1921867_1922641_+	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_045366755.1|1922764_1923373_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.1	5.2e-34
WP_172653327.1|1923502_1924621_+	M23 family metallopeptidase	NA	Q8SBN9	Clostridium_phage	40.5	1.5e-18
>prophage 4
NZ_AP014648	Methyloceanibacter caenitepidi strain Gela4	3424964	2072029	2119292	3424964	portal,head,integrase,capsid,protease,terminase	Geobacillus_phage(10.0%)	46	2070117:2070168	2079979:2080030
2070117:2070168	attL	CCGGTCTGGGGGACCGGGGGTCGGGAGTTCAAATCTCCCCGCTCCGACCACT	NA	NA	NA	NA
WP_052464335.1|2072029_2072719_+|head,protease	HK97 family phage prohead protease	head,protease	W8EBB3	Geobacillus_phage	43.2	1.8e-19
WP_052464337.1|2072723_2073890_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	47.5	3.6e-68
WP_045366977.1|2074646_2075558_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.7	4.9e-36
WP_045366979.1|2075535_2076159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045366981.1|2076901_2077705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045366983.1|2077866_2078433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045366985.1|2078425_2078653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082025600.1|2078649_2078952_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045366987.1|2078837_2079941_+|integrase	site-specific integrase	integrase	A0A076G7B8	Sinorhizobium_phage	56.2	1.3e-112
WP_156137502.1|2080558_2081734_-	hypothetical protein	NA	NA	NA	NA	NA
2079979:2080030	attR	CCGGTCTGGGGGACCGGGGGTCGGGAGTTCAAATCTCCCCGCTCCGACCACT	NA	NA	NA	NA
WP_045366989.1|2081843_2083391_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_045369894.1|2083564_2084692_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_045366991.1|2084767_2085439_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_052464341.1|2085669_2089005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045366993.1|2089079_2090258_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045369896.1|2090462_2091524_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_045366995.1|2091546_2091750_-	DUF2842 domain-containing protein	NA	NA	NA	NA	NA
WP_045369897.1|2091897_2092953_+	COX15/CtaA family protein	NA	NA	NA	NA	NA
WP_045366997.1|2092931_2094218_-	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	26.0	2.4e-12
WP_045366999.1|2094335_2094857_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_045367001.1|2094925_2095390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045367003.1|2095457_2096501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045367005.1|2096507_2097305_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_045367007.1|2097519_2097984_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_045367009.1|2097989_2098475_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_045367011.1|2098588_2099638_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_082025788.1|2099658_2101395_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_045367013.1|2101660_2101900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045367015.1|2102014_2103247_+	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_045367016.1|2103255_2104587_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_045367018.1|2104640_2105630_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_045369899.1|2105760_2107545_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.8	1.3e-45
WP_045367019.1|2107752_2108172_-	VOC family protein	NA	NA	NA	NA	NA
WP_082025603.1|2108642_2109230_+	CspA family cold shock protein	NA	A0A1W6JNX5	Morganella_phage	37.5	4.0e-07
WP_045369901.1|2109247_2109730_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_052464343.1|2110061_2110910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172653332.1|2110930_2111353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045367022.1|2111342_2112341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156137507.1|2112495_2112663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045369903.1|2112671_2113106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172653333.1|2113144_2113363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045367027.1|2113343_2115131_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	36.8	1.0e-98
WP_045367028.1|2115245_2115905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045367029.1|2115901_2116162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052464346.1|2116158_2117526_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	30.2	1.2e-51
WP_045367031.1|2117528_2119292_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7QSM3	Vibrio_phage	34.1	7.5e-41
>prophage 5
NZ_AP014648	Methyloceanibacter caenitepidi strain Gela4	3424964	2580979	2626416	3424964	head,tail,tRNA,protease	uncultured_Caudovirales_phage(14.29%)	44	NA	NA
WP_052464454.1|2580979_2581681_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_156137689.1|2581874_2582303_+|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_045367970.1|2582441_2583944_+	phosphomannomutase/phosphoglucomutase	NA	NA	NA	NA	NA
WP_052464457.1|2584028_2584652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156137577.1|2584720_2584951_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_045370065.1|2585124_2586063_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045367973.1|2586099_2587119_+	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.2	1.1e-39
WP_045367974.1|2587158_2588178_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_045367976.1|2588287_2588965_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	76.1	1.0e-86
WP_045367977.1|2589019_2589430_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	55.1	8.6e-33
WP_045367979.1|2589426_2589774_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156137578.1|2589901_2590858_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_082025643.1|2590977_2593308_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.2	1.5e-89
WP_045367980.1|2593323_2595975_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_045367982.1|2596231_2598415_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	34.3	1.2e-27
WP_052464464.1|2598422_2601344_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_156137580.1|2601340_2602897_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_172653351.1|2602781_2603462_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	6.6e-30
WP_045367984.1|2603577_2605143_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.8	4.3e-24
WP_045367986.1|2605311_2605809_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_045367987.1|2605811_2607800_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_045367988.1|2607796_2608267_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_045367990.1|2608263_2609415_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_156137581.1|2609535_2609907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045367992.1|2610039_2611404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045367995.1|2611408_2612080_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_156137583.1|2612187_2612487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045368001.1|2612556_2612808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172653352.1|2612880_2613207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045368005.1|2613412_2614009_+	sulfotransferase family 2 domain-containing protein	NA	NA	NA	NA	NA
WP_082025646.1|2614005_2615706_-	DUF2793 domain-containing protein	NA	F4YXU6	Roseobacter_phage	42.9	1.2e-14
WP_045368008.1|2615782_2619850_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	42.7	1.1e-260
WP_045368011.1|2620116_2620551_-	C40 family peptidase	NA	F4YXU4	Roseobacter_phage	52.9	3.2e-38
WP_045368013.1|2620890_2621781_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	45.7	7.8e-71
WP_045368015.1|2621777_2622413_-	DUF2460 domain-containing protein	NA	A0A0K1Y6G4	Rhodobacter_phage	51.4	7.8e-49
WP_045368018.1|2622443_2623010_-|tail	phage tail tape measure protein	tail	G9JXH3	Shigella_phage	46.6	1.1e-06
WP_045368020.1|2622999_2623182_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_045368021.1|2623214_2623586_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_045368022.1|2623595_2624009_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_052464468.1|2624095_2624560_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_045370077.1|2624685_2625108_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_045368023.1|2625173_2625524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045368024.1|2625520_2625844_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_045368025.1|2625840_2626416_-|head,tail	phage head-tail connector protein	head,tail	I3UM02	Rhodobacter_phage	36.5	2.7e-16
>prophage 6
NZ_AP014648	Methyloceanibacter caenitepidi strain Gela4	3424964	2938721	2946580	3424964		Pseudomonas_phage(33.33%)	11	NA	NA
WP_045368399.1|2938721_2939096_-	hypothetical protein	NA	I6WCB5	Pseudomonas_phage	36.8	2.6e-12
WP_052464576.1|2939095_2939623_-	hypothetical protein	NA	A0A2D0W9N0	Bordetella_phage	41.0	8.2e-12
WP_156137626.1|2939632_2939800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045368400.1|2939836_2940220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045368401.1|2940286_2941270_-	hypothetical protein	NA	R9TJ64	Synechococcus_phage	67.9	9.0e-121
WP_156137627.1|2941364_2942162_-	hypothetical protein	NA	A0A0A1IX11	Pseudomonas_phage	32.6	2.9e-16
WP_045368402.1|2942240_2942792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045368403.1|2942770_2943700_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_156137628.1|2943696_2944434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045368407.1|2944430_2945135_-	hypothetical protein	NA	K4JRP9	Caulobacter_phage	39.1	2.0e-37
WP_045370211.1|2945134_2946580_-	DUF4055 domain-containing protein	NA	W6E8D1	Rhizobium_phage	45.0	6.4e-99
>prophage 7
NZ_AP014648	Methyloceanibacter caenitepidi strain Gela4	3424964	2959213	2967846	3424964	capsid	Pseudomonas_phage(25.0%)	14	NA	NA
WP_156137632.1|2959213_2959591_+	hypothetical protein	NA	A0A2H4YHG9	Raoultella_phage	37.3	7.4e-15
WP_172653364.1|2960056_2960419_+	HNH endonuclease	NA	Q94MV4	Myxococcus_phage	52.1	2.6e-09
WP_052464586.1|2960415_2960718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045368457.1|2961010_2961442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045368460.1|2961928_2962132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156137692.1|2962200_2962971_+	ERF family protein	NA	K4NWX3	Pseudomonas_phage	31.4	6.0e-19
WP_082025682.1|2962967_2963660_+	YqaJ viral recombinase family protein	NA	A0A076G6X1	Sinorhizobium_phage	53.2	1.6e-55
WP_045368462.1|2963653_2964169_+	hypothetical protein	NA	B0VK83	Azospirillum_phage	43.9	2.0e-31
WP_052464589.1|2964165_2964537_+	HNH endonuclease	NA	A0A0U2C107	Paracoccus_phage	41.3	4.4e-12
WP_045368465.1|2965113_2965599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172653365.1|2965732_2966446_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	40.2	1.2e-10
WP_045368470.1|2966450_2966756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045368472.1|2966756_2967212_+	Fic family protein	NA	NA	NA	NA	NA
WP_045368476.1|2967495_2967846_+	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	57.3	4.0e-23
