The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010523	Klebsiella variicola strain DSM 15968 chromosome, complete genome	5521203	1199944	1244794	5521203	integrase,portal,tRNA,plate,capsid,lysis,head,terminase,tail	Salmonella_phage(86.05%)	58	1198732:1198778	1233437:1233483
1198732:1198778	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_040968809.1|1199944_1200964_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	5.6e-190
WP_004151019.1|1200966_1201596_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_000102104.1|1201718_1201958_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_040968808.1|1201993_1202503_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	86.4	2.2e-78
WP_071891526.1|1202510_1202711_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	67.2	1.3e-18
WP_004144796.1|1202674_1203013_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_024623053.1|1203080_1203314_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	92.2	3.5e-31
WP_023318930.1|1203313_1203541_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	2.5e-34
WP_040968807.1|1203537_1204389_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	74.3	2.4e-114
WP_040968806.1|1204385_1206791_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.8	0.0e+00
WP_004144689.1|1206963_1207152_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_040968805.1|1207166_1207400_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	6.0e-31
WP_040968804.1|1207475_1207733_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	47.7	4.1e-17
WP_071891529.1|1207996_1208701_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_040968803.1|1208719_1209751_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	1.5e-174
WP_040968802.1|1209750_1211514_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	92.6	0.0e+00
WP_040968801.1|1211654_1212488_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	74.4	6.3e-99
WP_040968800.1|1212504_1213569_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	1.9e-185
WP_040968799.1|1213572_1214223_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.1	2.8e-102
WP_019704961.1|1214319_1214784_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.0	2.1e-75
WP_004144701.1|1214783_1214987_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
WP_004144702.1|1214990_1215206_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_040968798.1|1215186_1215696_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	9.5e-82
WP_040968797.1|1215700_1216084_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	4.3e-18
WP_040968796.1|1216080_1216509_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.2	1.2e-48
WP_072145348.1|1216483_1216642_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	73.1	2.0e-14
WP_040968795.1|1216604_1217036_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	81.1	8.4e-63
WP_040968794.1|1217028_1217475_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	75.7	6.9e-52
WP_040226931.1|1217519_1218809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040226929.1|1218894_1219467_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	73.3	2.5e-78
WP_040968793.1|1219463_1219826_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.9	3.7e-48
WP_040968792.1|1219812_1220721_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	69.5	3.2e-112
WP_040968791.1|1220713_1221316_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	61.0	1.2e-59
WP_040968790.1|1221319_1224205_+	hypothetical protein	NA	A0A0S1S5D9	Klebsiella_phage	51.7	2.2e-239
WP_040968789.1|1224212_1225049_+	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	66.2	1.5e-103
WP_136071178.1|1225064_1226135_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.9	1.7e-32
WP_040968786.1|1226273_1227446_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	4.7e-209
WP_002896201.1|1227455_1227971_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004144716.1|1228023_1228323_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|1228337_1228457_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_162500023.1|1228683_1231077_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	37.3	1.3e-107
WP_004185683.1|1231073_1231559_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_040025413.1|1231555_1232653_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.7	2.1e-174
WP_071891531.1|1232719_1232938_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	73.6	1.1e-26
WP_040025415.1|1232964_1233342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1233945_1234428_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1233437:1233483	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_071549035.1|1234538_1235015_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1235004_1235295_+	RnfH family protein	NA	NA	NA	NA	NA
WP_008806098.1|1235364_1235706_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_022066198.1|1235853_1237515_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1237601_1238480_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_008806096.1|1238604_1239195_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_012540838.1|1239315_1240602_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1240621_1241413_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1241576_1242941_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_012540839.1|1243179_1243428_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_008806093.1|1243446_1243995_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_008806092.1|1244026_1244794_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP010523	Klebsiella variicola strain DSM 15968 chromosome, complete genome	5521203	1705514	1712471	5521203	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_040975965.1|1705514_1706378_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.9	6.9e-08
WP_040968730.1|1706388_1707162_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	1.9e-25
WP_162499946.1|1707401_1708325_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	27.7	1.0e-12
WP_008804076.1|1708567_1709929_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_004201558.1|1710249_1710972_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_008804077.1|1710968_1712471_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 3
NZ_CP010523	Klebsiella variicola strain DSM 15968 chromosome, complete genome	5521203	2801143	2812022	5521203		Escherichia_phage(87.5%)	9	NA	NA
WP_040968492.1|2801143_2804251_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
WP_008804978.1|2804305_2805571_+	MFS transporter	NA	NA	NA	NA	NA
WP_012541789.1|2805599_2806688_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	98.6	2.8e-208
WP_008804980.1|2806774_2807035_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_039103359.1|2807329_2808190_+	class A beta-lactamase LEN-17	NA	A0A077SL40	Escherichia_phage	90.9	1.8e-144
WP_040968491.1|2808207_2808969_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.8	6.1e-133
WP_008804983.1|2809229_2810132_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
WP_016160981.1|2810143_2811409_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.4	1.7e-228
WP_012541792.1|2811401_2812022_+	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
>prophage 4
NZ_CP010523	Klebsiella variicola strain DSM 15968 chromosome, complete genome	5521203	3135620	3174868	5521203	integrase,lysis,terminase	Salmonella_phage(33.33%)	51	3129616:3129632	3176321:3176337
3129616:3129632	attL	CCCCAGCGTCACCGGCA	NA	NA	NA	NA
WP_077254381.1|3135620_3135962_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
WP_004190640.1|3138142_3138535_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_012967909.1|3138531_3139083_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_032410241.1|3139084_3139468_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_040975900.1|3139454_3139688_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	1.3e-09
WP_040975898.1|3139697_3139952_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	3.6e-21
WP_040975896.1|3139953_3140349_-	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.8	7.3e-13
WP_158280597.1|3140389_3140662_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_040975894.1|3140670_3141624_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.7	1.9e-131
WP_040975892.1|3141634_3142420_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.4	2.3e-66
WP_040975890.1|3142504_3143617_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.2	2.8e-110
WP_040975888.1|3143600_3145001_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.7	1.1e-127
WP_040975887.1|3145000_3146308_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	2.1e-149
WP_040975885.1|3146285_3147290_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.5	2.7e-35
WP_015958303.1|3147384_3147879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071891570.1|3147846_3148164_-	hypothetical protein	NA	I6S676	Salmonella_phage	66.7	5.3e-14
WP_040975882.1|3148767_3149247_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	46.1	5.7e-12
WP_040975880.1|3149593_3149887_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.1	1.4e-29
WP_071891575.1|3149972_3150155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162848989.1|3150192_3150357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071891615.1|3150335_3150551_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	54.3	2.0e-12
WP_040975876.1|3150581_3151049_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	72.9	8.2e-56
WP_040975874.1|3151045_3151570_-	lysozyme	NA	I6PBN2	Cronobacter_phage	60.0	7.1e-48
WP_052470379.1|3151553_3151874_-	hypothetical protein	NA	O64361	Escherichia_phage	51.1	3.1e-22
WP_071891578.1|3152509_3153136_-	YagU family protein	NA	NA	NA	NA	NA
WP_032732960.1|3153387_3154203_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	74.1	1.4e-106
WP_038421389.1|3154199_3154496_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	1.3e-35
WP_040975872.1|3154704_3155301_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.6	1.9e-89
WP_071891583.1|3155336_3155570_-	hypothetical protein	NA	A0A0M4R5D9	Salmonella_phage	57.1	1.3e-17
WP_032754145.1|3156239_3156473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052470378.1|3157004_3157751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040975869.1|3157939_3158182_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	86.7	4.4e-29
WP_040975867.1|3158174_3158378_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	2.0e-30
WP_040975865.1|3158374_3158743_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.6	1.8e-10
WP_040975863.1|3158750_3159500_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	81.1	1.8e-116
WP_174545384.1|3159502_3160390_-	hypothetical protein	NA	Q8HA96	Salmonella_phage	53.1	1.4e-24
WP_040975861.1|3160407_3161202_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.3	3.7e-64
WP_040975860.1|3161331_3161868_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	68.7	2.3e-62
WP_071891584.1|3161870_3162098_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.9	1.9e-21
WP_040975858.1|3162167_3162581_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	79.0	9.5e-48
WP_077139161.1|3162614_3163082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040975856.1|3163189_3163489_+	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	55.9	1.5e-13
WP_040217592.1|3164041_3164233_+	YebW family protein	NA	NA	NA	NA	NA
WP_040975854.1|3164534_3167660_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	56.1	1.1e-289
WP_022631173.1|3167672_3168782_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
WP_022631172.1|3168822_3169062_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_040975850.1|3169282_3170500_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	4.3e-120
WP_008807805.1|3170646_3171537_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_008807804.1|3171536_3172529_+	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_004140269.1|3172530_3173340_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_022065867.1|3173368_3174868_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.6	2.3e-59
3176321:3176337	attR	CCCCAGCGTCACCGGCA	NA	NA	NA	NA
>prophage 5
NZ_CP010523	Klebsiella variicola strain DSM 15968 chromosome, complete genome	5521203	3372504	3427384	5521203	integrase,portal,tRNA,capsid,head,transposase,terminase,tail	Klebsiella_phage(48.65%)	54	3377691:3377705	3427560:3427574
WP_136071160.1|3372504_3373604_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.4e-48
WP_004892953.1|3373827_3373980_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023297392.1|3374629_3375322_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023297391.1|3375678_3376737_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.7	8.0e-14
WP_023339907.1|3377159_3378584_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.4	6.6e-96
3377691:3377705	attL	GGTCGATGATGCTGT	NA	NA	NA	NA
WP_040975758.1|3378645_3387129_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	50.0	0.0e+00
WP_023159867.1|3387191_3387785_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.6	2.2e-77
WP_032429394.1|3387836_3388184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317958.1|3388216_3388927_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	2.5e-136
WP_023339905.1|3388928_3389684_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	3.6e-125
WP_014228916.1|3389680_3390019_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	8.3e-58
WP_040975753.1|3390018_3393354_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.2	0.0e+00
WP_014228914.1|3393586_3393952_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|3394009_3394471_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|3394502_3394904_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014228910.1|3395269_3395608_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_040975750.1|3395604_3395922_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	88.8	4.4e-45
WP_014907814.1|3395902_3396163_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_014228907.1|3396221_3397508_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_040975743.1|3397585_3398506_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.6	6.2e-148
WP_004148010.1|3398542_3399802_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	6.2e-223
WP_032418045.1|3399801_3399981_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_012542167.1|3399974_3401696_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
WP_012542168.1|3401695_3402130_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023289184.1|3402378_3402810_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_023297386.1|3402806_3403130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032737090.1|3403081_3403444_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	8.9e-58
WP_023297385.1|3403427_3403592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048330562.1|3403673_3404150_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_048964999.1|3404182_3404719_-	lysozyme	NA	G9L6J6	Escherichia_phage	82.6	1.5e-85
WP_023297382.1|3404696_3404966_-	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	81.5	1.9e-33
WP_064160814.1|3405991_3406327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129675911.1|3407452_3407662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023297381.1|3407898_3408501_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_040975739.1|3408517_3409549_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	3.6e-96
WP_040975733.1|3409748_3410141_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_071583399.1|3410181_3410421_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.5e-16
WP_040975731.1|3410483_3410717_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	69.7	1.1e-24
WP_048333319.1|3411371_3412733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040975727.1|3413076_3414840_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021462584.1|3415152_3415593_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_174545385.1|3415606_3416278_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	69.5	2.5e-61
WP_023297375.1|3417098_3417653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147982.1|3417655_3417877_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
WP_025861419.1|3418012_3418402_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	64.3	5.5e-37
WP_016160636.1|3419219_3419414_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3419456_3419801_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016160634.1|3419942_3422081_+	exonuclease	NA	S4TNL0	Salmonella_phage	43.0	5.0e-100
WP_012542206.1|3422133_3422379_+	excisionase	NA	NA	NA	NA	NA
WP_023297374.1|3422359_3423487_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	4.4e-119
WP_008806032.1|3423604_3424855_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_023339894.1|3425095_3425746_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_008806030.1|3425762_3426221_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012542211.1|3426277_3427384_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3427560:3427574	attR	ACAGCATCATCGACC	NA	NA	NA	NA
>prophage 6
NZ_CP010523	Klebsiella variicola strain DSM 15968 chromosome, complete genome	5521203	3680335	3689783	5521203	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_012968624.1|3680335_3682057_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	4.5e-14
WP_008805841.1|3682096_3682801_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3683152_3683371_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012542332.1|3683489_3685769_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_002896520.1|3685799_3686117_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3686442_3686664_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_040974017.1|3686730_3688671_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
WP_008805838.1|3688667_3689783_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
