The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007592	Escherichia coli O157:H16 strain Santai chromosome, complete genome	5104557	576345	617760	5104557	plate,integrase,terminase,tail,protease,head,portal,holin,capsid	Enterobacteria_phage(39.66%)	66	580202:580257	620082:620137
WP_000749881.1|576345_577401_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|577688_578792_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893267.1|578803_580057_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
580202:580257	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAA	NA	NA	NA	NA
WP_000051905.1|580261_581425_-|integrase	site-specific integrase	integrase	S5FNS2	Shigella_phage	100.0	4.1e-229
WP_000446903.1|581301_581652_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	99.1	1.6e-59
WP_000488409.1|581623_581902_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
WP_000763390.1|581949_582168_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001386642.1|582266_582548_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|582558_582750_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682311.1|582722_582905_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
WP_000186851.1|582901_583582_-	YqaJ viral recombinase family protein	NA	Q6H9Z0	Enterobacteria_phage	100.0	1.2e-132
WP_000100847.1|583578_584364_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995455.1|584369_584666_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_023148105.1|584741_585032_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_040234530.1|585431_585854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137467251.1|585855_586308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096268451.1|586310_586634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295669.1|586865_587558_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|587668_587896_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001400028.1|587926_588466_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	1.5e-61
WP_040235261.1|588552_589482_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-109
WP_040234533.1|589478_590180_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.3	2.4e-128
WP_074149992.1|590176_590350_+	MarR family transcriptional regulator	NA	M1FPD5	Enterobacteria_phage	89.1	2.7e-20
WP_001224618.1|590496_590991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001598055.1|591362_591689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040234534.1|591828_592374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074149993.1|592467_592569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040234535.1|592565_593021_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	2.3e-58
WP_000224907.1|593020_593191_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_021567489.1|593183_593474_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	3.3e-47
WP_040234537.1|593470_593833_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_040234538.1|593829_593970_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	5.0e-09
WP_040234542.1|593966_594656_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	7.6e-58
WP_000839572.1|595452_595668_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_040234544.1|595672_595987_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	96.2	1.2e-50
WP_001274718.1|596042_596576_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	9.6e-101
WP_032145233.1|596792_596975_+	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
WP_001140099.1|597079_597430_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001317918.1|597577_598060_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140902.1|598059_599817_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|599828_600011_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466247.1|600010_601252_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|601229_601880_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257489.1|601894_603100_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_000601364.1|603149_603350_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	8.4e-26
WP_040234548.1|603352_603676_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	99.1	1.5e-56
WP_024234445.1|603672_604083_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	99.3	1.5e-74
WP_000213502.1|604057_604564_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_040234549.1|604560_605121_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	98.4	4.4e-104
WP_000497751.1|605129_605300_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_040234551.1|605283_606780_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.2	3.5e-273
WP_000090998.1|606779_607136_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661054.1|607135_607405_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_040234552.1|607546_609382_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.3	1.5e-307
WP_040234554.1|609442_610771_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.2	1.3e-244
WP_000999510.1|610767_611847_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_021556502.1|611846_612395_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.2	6.2e-95
WP_000424732.1|612394_612820_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_040234556.1|612806_613865_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.6	1.1e-199
WP_000383552.1|613855_614440_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	4.1e-113
WP_029788947.1|614710_615106_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	4.4e-66
WP_001008234.1|615126_615570_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_071843975.1|615541_615949_-	hypothetical protein	NA	U5P0S4	Shigella_phage	86.3	1.0e-25
WP_052463147.1|615961_616345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040234557.1|616374_616929_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	85.6	5.9e-85
WP_000355484.1|616986_617760_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
620082:620137	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAA	NA	NA	NA	NA
>prophage 2
NZ_CP007592	Escherichia coli O157:H16 strain Santai chromosome, complete genome	5104557	2333182	2407585	5104557	integrase,terminase,tail,protease,transposase,head,portal,holin,capsid	Escherichia_phage(41.67%)	87	2386849:2386864	2414806:2414821
WP_052463158.1|2333182_2334346_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	2.6e-199
WP_032197943.1|2335716_2336514_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040234766.1|2336523_2337075_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2337243_2337576_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2337909_2338224_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994427.1|2338438_2340097_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_024238893.1|2340089_2341085_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282709.1|2341077_2341764_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2341763_2343137_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_040234770.1|2343155_2343599_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620098.1|2343595_2344723_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2344827_2345292_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2345296_2346301_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2346297_2346711_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295640.1|2346713_2347079_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|2347078_2347816_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2347825_2348095_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983976.1|2348103_2348889_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000104001.1|2349178_2349802_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2349845_2350088_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2350196_2350424_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_001422412.1|2350721_2351537_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_077632748.1|2351533_2353228_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	5.0e-18
WP_000009307.1|2353398_2353581_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2353659_2354577_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2354749_2355670_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785987.1|2355658_2356129_-	VSPR family DNA mismatch endonuclease	NA	NA	NA	NA	NA
WP_001157222.1|2356109_2357528_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_001422413.1|2357594_2358290_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	4.3e-08
WP_024224580.1|2359252_2360446_+	porin	NA	Q1MVN1	Enterobacteria_phage	54.2	1.0e-102
WP_001373147.1|2360569_2360782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001422415.1|2361037_2361889_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_001422416.1|2361996_2363355_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2363354_2364026_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|2364158_2364572_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740094.1|2364680_2365685_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001241499.1|2365685_2366321_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007759.1|2366577_2367228_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2367570_2368101_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_040234775.1|2369078_2369663_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	6.2e-101
WP_072769046.1|2369662_2372581_-	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	96.6	1.1e-57
WP_040234777.1|2372645_2373245_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	1.7e-109
WP_040234778.1|2373314_2376791_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.9	0.0e+00
WP_012311734.1|2376851_2377499_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_040234779.1|2377396_2378140_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	7.3e-147
WP_001152453.1|2378145_2378844_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
WP_001115183.1|2378843_2379185_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_040234780.1|2379177_2382417_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.0	0.0e+00
WP_063101268.1|2382462_2382723_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.8	7.1e-41
WP_001312914.1|2382764_2383151_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_000097533.1|2383150_2383855_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001209399.1|2383914_2384259_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001312916.1|2384255_2384705_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001147820.1|2384701_2385040_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|2385048_2385354_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|2385365_2385554_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000257489.1|2385605_2386811_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_001193631.1|2386825_2387476_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
2386849:2386864	attL	CATTCAGTGCAGAGCC	NA	NA	NA	NA
WP_000466247.1|2387453_2388695_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000478567.1|2388694_2388877_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_001140902.1|2388888_2390646_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_001317918.1|2390645_2391128_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140099.1|2391275_2391626_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_032145233.1|2391730_2391913_-	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
WP_001274718.1|2392129_2392663_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	9.6e-101
WP_040234544.1|2392718_2393033_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	96.2	1.2e-50
WP_000839572.1|2393037_2393253_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_040234784.1|2394049_2394739_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	3.4e-58
WP_001217424.1|2394735_2395095_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_024195967.1|2395107_2396157_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_024175747.1|2396158_2396437_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|2396733_2397126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|2397269_2397482_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001557860.1|2397526_2397634_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000161640.1|2398049_2398859_+	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_001151221.1|2399005_2399428_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	9.7e-64
WP_001262356.1|2399468_2400539_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.4e-63
WP_000693883.1|2400610_2401036_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001397087.1|2401654_2401993_+	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_040235278.1|2402285_2402441_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171946.1|2402600_2402819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2402822_2402987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854564.1|2403389_2403578_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070253.1|2403574_2403763_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234786.1|2403856_2406298_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	4.5e-113
WP_000096344.1|2406356_2406560_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|2406559_2407585_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
2414806:2414821	attR	CATTCAGTGCAGAGCC	NA	NA	NA	NA
>prophage 3
NZ_CP007592	Escherichia coli O157:H16 strain Santai chromosome, complete genome	5104557	2593994	2603439	5104557		Enterobacteria_phage(85.71%)	10	NA	NA
WP_040234810.1|2593994_2595131_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	5.5e-162
WP_040234811.1|2595127_2597131_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001373589.1|2597255_2597717_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|2597757_2598228_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2598274_2598994_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2598990_2600676_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_021556974.1|2600897_2601629_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2601688_2601796_+	protein YohO	NA	NA	NA	NA	NA
WP_021556975.1|2601776_2602508_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001625492.1|2602512_2603439_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 4
NZ_CP007592	Escherichia coli O157:H16 strain Santai chromosome, complete genome	5104557	3354476	3386590	5104557	transposase,integrase	Escherichia_phage(42.86%)	31	3358411:3358470	3376733:3377552
WP_040234906.1|3354476_3355847_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_014342212.1|3355845_3355995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|3355961_3357098_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|3357148_3357376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|3357399_3357591_+	hypothetical protein	NA	NA	NA	NA	NA
3358411:3358470	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067834.1|3358462_3359167_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000557454.1|3359332_3360193_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_052463150.1|3360205_3360445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429836.1|3362232_3362667_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|3362738_3363089_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|3363102_3363378_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|3363413_3363836_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|3363887_3365582_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277457.1|3365599_3365962_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|3365958_3366195_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|3366230_3366899_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_040234907.1|3366937_3368242_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_040234908.1|3369749_3370346_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000219391.1|3373006_3373912_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|3373908_3375147_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|3375146_3375731_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067834.1|3376784_3377489_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014839980.1|3377874_3378291_+	fosfomycin resistance glutathione transferase FosA3	NA	NA	NA	NA	NA
3376733:3377552	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGATATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_014839979.1|3378295_3378814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|3378813_3379602_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049824851.1|3379621_3380092_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_001067834.1|3380101_3380806_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_004896925.1|3381690_3382233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155092.1|3382591_3383476_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|3383531_3385007_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|3385405_3386590_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
>prophage 5
NZ_CP007592	Escherichia coli O157:H16 strain Santai chromosome, complete genome	5104557	3548038	3588703	5104557	transposase	Stx2-converting_phage(21.43%)	35	NA	NA
WP_131501864.1|3548038_3548152_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_001043260.1|3549809_3550625_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3550685_3551489_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3551488_3552325_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|3552630_3552873_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|3552904_3553555_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|3553660_3554860_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|3555126_3555432_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|3555459_3556674_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|3556890_3557775_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_021512463.1|3558395_3558662_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_000930062.1|3559096_3559411_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000271619.1|3560331_3561564_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_000878218.1|3561714_3562581_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_161954780.1|3562577_3562808_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000174035.1|3563043_3564024_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	7.3e-22
WP_040234958.1|3564020_3564965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637419.1|3564967_3566050_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_032153698.1|3566516_3566783_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
WP_000438165.1|3568204_3571618_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000627728.1|3571681_3573316_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_000742120.1|3573312_3574455_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000778955.1|3574463_3576086_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000499115.1|3576085_3576982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571844.1|3577603_3578350_+	porin family protein	NA	NA	NA	NA	NA
WP_000228490.1|3578769_3579666_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
WP_001207396.1|3579714_3580794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100182.1|3580840_3582412_+	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_000766274.1|3582408_3582675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000099202.1|3583005_3584544_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_000612626.1|3584592_3584940_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839181.1|3584936_3585341_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.1e-69
WP_025492097.1|3585526_3587200_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_032153697.1|3587343_3588378_-	tetratricopeptide repeat family protein	NA	NA	NA	NA	NA
WP_023181049.1|3588427_3588703_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
>prophage 6
NZ_CP007592	Escherichia coli O157:H16 strain Santai chromosome, complete genome	5104557	3670064	3738670	5104557	transposase,tRNA,integrase	Escherichia_phage(16.67%)	60	3702155:3702169	3734547:3734561
WP_001625883.1|3670064_3671045_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_000354046.1|3671287_3671554_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_000244777.1|3671534_3671942_+	toxin CptA	NA	NA	NA	NA	NA
WP_001055874.1|3671981_3672503_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_000806638.1|3672614_3673511_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715213.1|3673535_3674246_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_040234964.1|3674251_3675985_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	2.1e-59
WP_001701073.1|3676075_3677173_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|3677183_3678701_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192818.1|3678743_3679292_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3679346_3679418_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|3679414_3679540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3679541_3680990_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_021557181.1|3681425_3683345_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_021557180.1|3683344_3683833_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3683868_3685236_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001299798.1|3685271_3686588_-	guanine deaminase	NA	NA	NA	NA	NA
WP_021557179.1|3686605_3688006_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001625874.1|3688170_3691041_-	molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit	NA	NA	NA	NA	NA
WP_000572462.1|3691037_3691817_-	molybdopterin-dependent oxidoreductase FAD-binding subunit	NA	NA	NA	NA	NA
WP_021557178.1|3691867_3693196_-	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_021557177.1|3693198_3696297_-	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_001272850.1|3696618_3697197_-	molybdenum cofactor cytidylyltransferase	NA	NA	NA	NA	NA
WP_001307989.1|3697299_3698070_+	putative selenium-dependent hydroxylase accessory protein YqeC	NA	NA	NA	NA	NA
WP_001020381.1|3698117_3699743_+	EF2563 family selenium-dependent molybdenum hydroxylase system protein	NA	NA	NA	NA	NA
WP_000037995.1|3699963_3700896_-	carbamate kinase	NA	NA	NA	NA	NA
WP_021557176.1|3700943_3702329_-	dihydropyrimidinase	NA	NA	NA	NA	NA
3702155:3702169	attL	GGACATCCACGCCGC	NA	NA	NA	NA
WP_001107125.1|3702381_3703593_-	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_000110493.1|3703650_3704847_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000859787.1|3704904_3706092_-	knotted carbamoyltransferase YgeW	NA	NA	NA	NA	NA
WP_000417792.1|3706570_3708349_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_001016605.1|3708388_3708868_-	xanthine dehydrogenase iron sulfur-binding subunit XdhC	NA	NA	NA	NA	NA
WP_000459172.1|3708864_3709743_-	xanthine dehydrogenase FAD-binding subunit XdhB	NA	NA	NA	NA	NA
WP_021557175.1|3709753_3712051_-	xanthine dehydrogenase molybdenum-binding subunit XdhA	NA	NA	NA	NA	NA
WP_001625866.1|3712466_3713222_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_021557174.1|3713463_3715407_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	23.7	8.3e-09
WP_021557172.1|3716154_3717171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021557171.1|3717596_3718160_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	38.5	5.5e-22
WP_040234971.1|3718246_3719545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021557167.1|3720422_3721295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021557168.1|3721470_3721935_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021557169.1|3722052_3722805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040234973.1|3723206_3723641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000412211.1|3724627_3725287_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|3725487_3725865_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|3725931_3728898_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|3728900_3729461_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|3729586_3729937_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|3730139_3731153_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|3731297_3731795_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|3731906_3732197_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|3732202_3732994_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|3733157_3733505_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|3733498_3734338_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376616.1|3734465_3734669_+	hypothetical protein	NA	NA	NA	NA	NA
3734547:3734561	attR	GCGGCGTGGATGTCC	NA	NA	NA	NA
WP_000184001.1|3734824_3736030_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|3736040_3736346_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000129159.1|3736572_3736863_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	72.7	1.1e-34
WP_001067834.1|3736899_3737604_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_071843985.1|3737683_3738670_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.6	7.1e-166
>prophage 7
NZ_CP007592	Escherichia coli O157:H16 strain Santai chromosome, complete genome	5104557	4972841	5020695	5104557	transposase	Enterobacteria_phage(50.0%)	39	NA	NA
WP_071843992.1|4972841_4974461_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000554934.1|4974846_4975572_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000575589.1|4975694_4976492_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_001596154.1|4976523_4977873_+	MFS transporter	NA	NA	NA	NA	NA
WP_040235188.1|4977878_4978934_+	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_000700703.1|4978948_4979245_+	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_000622357.1|4979241_4980150_+	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_040235191.1|4980160_4981693_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_000550406.1|4981696_4982248_+	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_001596152.1|4982222_4983110_+	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_001596151.1|4983135_4985733_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_162540014.1|4985981_4986488_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.1	5.2e-48
WP_001167450.1|4986984_4987497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235193.1|4987659_4988295_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_040235195.1|4988313_4988814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040235196.1|4988876_4989701_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_040235197.1|4989883_4990288_+	aldolase	NA	NA	NA	NA	NA
WP_001596146.1|4990401_4991973_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000459229.1|4991984_4993160_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_040235199.1|4993173_4995063_+	enterotoxin	NA	NA	NA	NA	NA
WP_000625622.1|4996208_4996559_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	2.9e-37
WP_040235200.1|4996555_4996990_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	57.6	2.8e-18
WP_040235201.1|4997335_4998646_-	amidohydrolase	NA	NA	NA	NA	NA
WP_040235202.1|4998658_4999930_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_040235204.1|5000065_5000983_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052463151.1|5003490_5003697_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.3	4.6e-11
WP_040235206.1|5005224_5006007_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_040235207.1|5006309_5007098_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040235339.1|5007102_5008008_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_040235208.1|5008018_5009986_+	xylonate dehydratase YjhG	NA	NA	NA	NA	NA
WP_040235209.1|5010092_5011442_+	GntP family permease	NA	NA	NA	NA	NA
WP_040235211.1|5011788_5012775_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_040235213.1|5012815_5013820_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_040235215.1|5013923_5014565_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_040235217.1|5014595_5015711_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_040235219.1|5015720_5016980_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_040235221.1|5018178_5019291_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	97.8	2.9e-200
WP_040235223.1|5019544_5020399_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.9	3.8e-51
WP_000165820.1|5020395_5020695_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP007592	Escherichia coli O157:H16 strain Santai chromosome, complete genome	5104557	5028930	5090564	5104557	transposase,integrase	Stx2-converting_phage(26.67%)	50	5027471:5027485	5039476:5039490
5027471:5027485	attL	ATTCTGGTATTCATG	NA	NA	NA	NA
WP_040235229.1|5028930_5030196_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_000779483.1|5030659_5030986_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_025492088.1|5030982_5031246_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_032153714.1|5031317_5032184_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839265.1|5032268_5032466_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_040234948.1|5032477_5032969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854735.1|5032965_5033343_-	toxin	NA	NA	NA	NA	NA
WP_032153712.1|5033389_5033764_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692345.1|5033843_5034065_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186715.1|5034133_5034610_-	RadC family protein	NA	NA	NA	NA	NA
WP_040235230.1|5034625_5035111_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	3.4e-12
WP_040235233.1|5035202_5036021_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	4.7e-46
WP_040235235.1|5036110_5036344_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000099202.1|5036492_5038031_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_000612626.1|5038079_5038427_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839181.1|5038423_5038828_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.1e-69
WP_052463156.1|5038856_5039489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010392.1|5039607_5040492_-	GTPase	NA	NA	NA	NA	NA
5039476:5039490	attR	ATTCTGGTATTCATG	NA	NA	NA	NA
WP_021572008.1|5040676_5041807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000778605.1|5043004_5043535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023181049.1|5045201_5045477_-|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
WP_001470106.1|5045688_5046072_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001547044.1|5046188_5047883_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_001547043.1|5047970_5049347_-	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_001470102.1|5049630_5050518_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001470100.1|5050571_5051942_-	adenylosuccinate lyase family protein	NA	NA	NA	NA	NA
WP_001470099.1|5052360_5053410_+	porin	NA	NA	NA	NA	NA
WP_001470098.1|5053420_5054185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001360336.1|5055810_5059308_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
WP_000610829.1|5061810_5063088_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.2	3.0e-84
WP_029396327.1|5063100_5064135_-	permease	NA	NA	NA	NA	NA
WP_000349485.1|5064246_5064561_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000624717.1|5064935_5065286_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_000823671.1|5066813_5067338_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	62.4	3.0e-62
WP_024210520.1|5067466_5067691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001334006.1|5068938_5069259_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_072649614.1|5069932_5070520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|5072009_5073518_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001696166.1|5074672_5077360_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001696167.1|5077369_5079727_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_001767848.1|5079787_5080792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077250607.1|5080836_5082294_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_001696169.1|5082327_5083362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001696170.1|5083442_5083880_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001767853.1|5083889_5084756_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_001696172.1|5084745_5085516_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001696173.1|5085534_5086008_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001696174.1|5086125_5086914_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001339175.1|5087758_5088967_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
WP_105076398.1|5089336_5090564_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	7.7e-170
