The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007027	Mycobacterium tuberculosis H37RvSiena chromosome, complete genome	4410911	2940576	2975807	4410911	transposase,protease,capsid,tRNA,integrase,head,terminase	Tupanvirus(12.5%)	39	2969377:2969404	2980359:2980386
WP_003413486.1|2940576_2942655_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2942763_2942991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2942987_2944373_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2944717_2945218_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2945234_2945675_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2945770_2946499_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2946483_2946837_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2946849_2947275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2947271_2947946_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2948023_2948845_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2948980_2949874_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2949876_2950695_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2950709_2951891_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2951949_2952381_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2952894_2954136_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2954550_2954808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2955154_2956279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2956280_2956820_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2958296_2958578_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2958722_2959208_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2959234_2959489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2959492_2961829_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2961857_2962100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2962100_2962778_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2962973_2963630_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2963792_2964239_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2964413_2964746_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2964865_2965225_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2965326_2965785_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2965920_2966301_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2966297_2967794_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2968028_2968220_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2969377:2969404	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2969510_2969942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2969938_2970937_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2970950_2971415_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_087902221.1|2971547_2972808_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935349.1|2973182_2974622_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2974629_2975163_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2975315_2975807_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
2980359:2980386	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP007027	Mycobacterium tuberculosis H37RvSiena chromosome, complete genome	4410911	3709814	3795743	4410911	protease,tRNA,transposase	Burkholderia_virus(33.33%)	50	NA	NA
WP_087902221.1|3709814_3711075_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003905037.1|3711130_3712843_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009935306.1|3712775_3713714_-	sigma-70 family RNA polymerase sigma factor SigJ	NA	NA	NA	NA	NA
WP_003917150.1|3713722_3715090_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.0	3.1e-18
WP_003417415.1|3715158_3716376_+	D-alanyl-D-alanine carboxypeptidase DacB1	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3716471_3717980_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3717976_3719128_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3719318_3720164_-|protease	PDZ-interacting protease regulator Ppr1	protease	NA	NA	NA	NA
WP_003900026.1|3720638_3721079_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3721112_3721982_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3722002_3723013_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003905041.1|3723285_3723930_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3723996_3725226_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3725508_3726858_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3726869_3728009_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3728005_3728737_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010886163.1|3728745_3736317_-	PPE family protein	NA	NA	NA	NA	NA
WP_009938644.1|3736365_3737382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886165.1|3737539_3742156_-	PE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3742579_3742837_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_010886166.1|3743092_3752566_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3753191_3753638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003900675.1|3753674_3754415_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3754709_3754997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009939158.1|3755333_3766484_-	PPE family protein	NA	NA	NA	NA	NA
WP_003417745.1|3768492_3768882_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3768895_3769189_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3769185_3770031_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3770154_3770430_+	type II toxin-antitoxin system antitoxin RelJ	NA	NA	NA	NA	NA
WP_003417760.1|3770426_3770684_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3770725_3771916_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3772032_3772401_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3772397_3772949_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3772955_3773537_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3773517_3773886_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3773863_3774256_-	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_003900676.1|3774252_3776883_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003417878.1|3777118_3777583_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_010886167.1|3777949_3779716_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3779716_3780361_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003912209.1|3780383_3780794_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003417885.1|3780882_3784158_-	error-prone DNA polymerase DnaE2	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.7e-118
WP_003900036.1|3784313_3785654_+	diacyglycerol O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3785695_3786871_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3786924_3787029_+	PE family protein	NA	NA	NA	NA	NA
WP_003417900.1|3788002_3789430_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3789537_3790191_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3790229_3791735_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3791739_3792630_-	diterpene synthase	NA	NA	NA	NA	NA
WP_087902221.1|3794481_3795743_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
