The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	225503	233281	4069641		Bacillus_phage(33.33%)	9	NA	NA
WP_014419157.1|225503_226439_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	9.8e-24
WP_014419158.1|226440_227139_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.8	3.2e-35
WP_014419159.1|227330_228197_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_014419160.1|228217_228922_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025649399.1|228987_229914_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
WP_003150986.1|230272_230728_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_014419162.1|230724_231573_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
WP_014419163.1|231593_232541_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	1.3e-68
WP_014419164.1|232543_233281_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
>prophage 2
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	1206608	1216499	4069641		Synechococcus_phage(50.0%)	9	NA	NA
WP_014417100.1|1206608_1207901_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_014417101.1|1207976_1208696_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.3	1.7e-47
WP_014417102.1|1208695_1208950_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_014417103.1|1208946_1209630_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_014417104.1|1209613_1211842_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	4.2e-158
WP_014417105.1|1211817_1213248_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_014417106.1|1213339_1214380_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	1.8e-63
WP_007408902.1|1214376_1214964_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_014417107.1|1214960_1216499_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	3.3e-77
>prophage 3
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	1673542	1707146	4069641	coat,protease,tRNA	Planktothrix_phage(16.67%)	38	NA	NA
WP_014417415.1|1673542_1674535_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_014417416.1|1675278_1676913_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014417417.1|1677019_1677955_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409113.1|1677958_1678876_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|1678888_1679965_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_014417419.1|1679957_1680875_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_014417420.1|1680981_1682178_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_007409110.1|1682286_1682865_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|1683043_1683439_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_014417421.1|1683495_1684152_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	41.9	2.2e-30
WP_003155032.1|1684427_1685084_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_014417422.1|1685235_1686396_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_003155028.1|1686623_1688453_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1688490_1688658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003155024.1|1688944_1689847_-|protease	protease adaptor protein SpxH	protease	NA	NA	NA	NA
WP_014417424.1|1689843_1690242_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_014721000.1|1690470_1691157_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	2.3e-38
WP_014417426.1|1691161_1691734_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_012117290.1|1691858_1692224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155019.1|1692251_1692887_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|1692904_1693705_+	NAD kinase	NA	NA	NA	NA	NA
WP_014417427.1|1693719_1694613_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.4e-06
WP_007409101.1|1694645_1695395_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
WP_014417428.1|1695622_1697467_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_015417218.1|1697716_1698424_+	thiaminase II	NA	NA	NA	NA	NA
WP_014721002.1|1698401_1699019_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_014417430.1|1699002_1700112_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_007409096.1|1700108_1700312_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|1700308_1701079_+	thiazole synthase	NA	NA	NA	NA	NA
WP_040221605.1|1701075_1702086_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014417432.1|1702108_1702921_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003155001.1|1703051_1703828_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_014721003.1|1703919_1704534_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|1704592_1705036_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154995.1|1705181_1705664_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014417434.1|1705814_1706315_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014417435.1|1706407_1706722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417436.1|1706759_1707146_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	1718998	1773204	4069641	holin,capsid,portal,head,integrase,terminase,tail	uncultured_Caudovirales_phage(42.11%)	80	1718790:1718837	1780253:1780300
1718790:1718837	attL	CTACCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
WP_040221610.1|1718998_1720048_+|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.9	2.2e-08
WP_040221611.1|1720211_1720931_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	32.3	6.0e-21
WP_040221612.1|1721064_1721601_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	48.6	5.4e-35
WP_039063563.1|1721677_1721923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221615.1|1722985_1723735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085142.1|1723944_1724181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040221620.1|1724462_1724663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221622.1|1724900_1725443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221624.1|1725483_1725804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221626.1|1725804_1726005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221628.1|1726001_1726343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221630.1|1726335_1726521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221631.1|1727545_1727779_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040221632.1|1727759_1728692_+	hypothetical protein	NA	A0A0A8WF99	Clostridium_phage	28.3	1.6e-21
WP_040221634.1|1728764_1728983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024085155.1|1729114_1729315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221636.1|1729293_1729662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221638.1|1729658_1730141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221641.1|1730151_1730805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221643.1|1730841_1731549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221645.1|1731623_1731845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221647.1|1731841_1734661_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	40.5	8.1e-98
WP_052456251.1|1734915_1735662_+	zeta toxin family protein	NA	A0A2H4J4U1	uncultured_Caudovirales_phage	37.2	3.2e-33
WP_158319025.1|1735732_1735897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221648.1|1736067_1736370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221650.1|1736734_1737964_-|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	49.3	3.5e-106
WP_031378515.1|1737968_1738490_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	63.9	2.7e-55
WP_007408625.1|1738562_1739540_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_015239592.1|1739756_1740131_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	65.9	1.2e-33
WP_040221655.1|1740289_1740514_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	79.7	2.1e-25
WP_007408621.1|1740524_1740719_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031378518.1|1740715_1741444_+	Rha family transcriptional regulator	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	62.5	2.7e-85
WP_003155916.1|1741501_1742074_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	55.0	1.3e-58
WP_017417478.1|1742070_1742328_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.2	1.3e-07
WP_031378519.1|1742324_1742528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378520.1|1742630_1742819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378521.1|1742815_1743733_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.5	9.4e-88
WP_069013071.1|1743752_1744490_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2P1JU03	Anoxybacillus_phage	44.2	7.4e-43
WP_031378523.1|1744687_1745395_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_031378524.1|1745312_1746107_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.0	4.5e-62
WP_193352598.1|1746099_1746243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017417484.1|1746337_1746766_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	63.5	1.3e-42
WP_017417485.1|1746816_1746969_+	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	63.4	6.0e-08
WP_003155894.1|1747050_1747254_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	75.4	3.4e-22
WP_031378525.1|1747285_1747570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378526.1|1747566_1747824_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	6.6e-07
WP_175365347.1|1747965_1748136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378527.1|1748283_1748862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014471511.1|1749233_1749362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221658.1|1749377_1749893_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	5.2e-27
WP_175365348.1|1749998_1750136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155868.1|1750434_1750647_+	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	9.6e-12
WP_031378531.1|1750828_1751041_+	transcriptional regulator	NA	A0A1Z1LZP5	Bacillus_phage	48.3	1.1e-07
WP_040221661.1|1751174_1751459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378533.1|1751596_1752097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378534.1|1752323_1752722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378535.1|1752805_1753567_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	57.7	8.1e-69
WP_032862507.1|1753553_1754762_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	86.0	2.7e-207
WP_031378537.1|1754761_1756165_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.4	1.8e-151
WP_031378538.1|1756151_1757078_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	51.5	8.6e-81
WP_031378539.1|1757180_1757768_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	53.1	5.9e-51
WP_040221664.1|1757783_1758701_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	68.2	7.7e-114
WP_003155858.1|1758705_1759041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155856.1|1759042_1759315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155853.1|1759323_1759632_+|head,tail	phage head-tail connector protein	head,tail	R4IFL8	Staphylococcus_phage	40.6	1.7e-12
WP_031378542.1|1759628_1759967_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_031378543.1|1759959_1760376_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	53.4	2.8e-31
WP_015239630.1|1760394_1760793_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	44.6	4.9e-25
WP_017417511.1|1760806_1761331_+|tail	phage major tail protein, TP901-1 family	tail	Q0PDK9	Bacillus_phage	42.9	3.7e-28
WP_031378544.1|1761305_1761587_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	74.1	1.0e-24
WP_076983593.1|1761600_1761843_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_031378545.1|1761899_1762406_+	hypothetical protein	NA	I6T7F0	Staphylococcus_virus	32.7	1.5e-10
WP_031378546.1|1762453_1762762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040221670.1|1762766_1767647_+	membrane protein	NA	M9NRJ5	Staphylococcus_phage	25.3	2.7e-40
WP_031378548.1|1767643_1768408_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_031378549.1|1768420_1771804_+|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	45.3	2.2e-129
WP_031378550.1|1771817_1772207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134816602.1|1772345_1772513_+	XkdX family protein	NA	NA	NA	NA	NA
WP_031378551.1|1772525_1772747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015239640.1|1772781_1773204_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	89.5	3.8e-60
1780253:1780300	attR	CTACCTTGACAGGGTAGAGGTCGCTGGTTCGAGCCCAGTCGGAATCAT	NA	NA	NA	NA
>prophage 5
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	1827644	1839660	4069641	holin,portal,terminase	uncultured_Caudovirales_phage(40.0%)	22	NA	NA
WP_087920760.1|1827644_1828781_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1828770_1828905_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_014417515.1|1829047_1830001_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|1830038_1830416_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_014417516.1|1830525_1831131_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_014721040.1|1831120_1831267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417517.1|1831253_1831844_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1831991_1832330_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_014417518.1|1832520_1832700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417519.1|1832689_1833517_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	50.0	5.8e-20
WP_014417520.1|1833416_1834217_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_014417521.1|1834216_1834393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417522.1|1834481_1834823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1834812_1835016_+	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_012117362.1|1835122_1835635_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.9e-22
WP_014417523.1|1835747_1836407_+|terminase	terminase	terminase	A0A1B1P867	Bacillus_phage	33.3	3.4e-07
WP_014417525.1|1836784_1837156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610833.1|1837160_1837358_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_014417526.1|1837414_1838176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1838227_1838491_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1838504_1838768_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_007407257.1|1838781_1839660_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 6
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	2394147	2400361	4069641		Bacillus_phage(50.0%)	6	NA	NA
WP_014417834.1|2394147_2394540_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	5.0e-30
WP_007611605.1|2394499_2396602_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|2396619_2397609_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_014417835.1|2397657_2398278_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	5.4e-47
WP_007410370.1|2398327_2399086_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
WP_014721211.1|2399392_2400361_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 7
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	2733097	2783958	4069641	plate,protease,terminase,capsid,portal,head,coat,integrase,holin,tail	Bacillus_phage(42.11%)	62	2749801:2749819	2789543:2789561
WP_158319026.1|2733097_2734531_-	glycosyltransferase	NA	A0A1V0SGA9	Hokovirus	30.0	9.1e-05
WP_014418180.1|2734972_2735569_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_040221738.1|2735777_2736305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014418181.1|2736499_2737663_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	49.1	1.2e-68
WP_040221739.1|2737708_2738131_-|holin	phage holin family protein	holin	D6R405	Bacillus_phage	87.2	3.6e-58
WP_014418183.1|2738180_2738366_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	72.1	5.8e-21
WP_040221740.1|2738365_2738728_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	56.3	4.6e-30
WP_014418184.1|2738724_2740548_-|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	35.7	1.1e-79
WP_014418185.1|2740562_2743127_-	peptidase G2	NA	D6R401	Bacillus_phage	79.8	0.0e+00
WP_014418186.1|2743180_2744884_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	57.6	2.3e-180
WP_014418187.1|2744898_2745738_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.3	1.2e-92
WP_014418188.1|2745731_2750219_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	32.4	7.9e-63
2749801:2749819	attL	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
WP_014418189.1|2750416_2750794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418190.1|2750859_2751468_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	35.5	3.7e-24
WP_014418191.1|2751482_2751866_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014418192.1|2751862_2752261_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_014418193.1|2752257_2752575_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.2	3.4e-13
WP_014418194.1|2752564_2752867_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.2	3.6e-12
WP_014418195.1|2752884_2753364_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	60.8	1.6e-09
WP_014418196.1|2753386_2754679_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.7	1.8e-92
WP_014418197.1|2754717_2755344_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	77.7	2.5e-84
WP_014418198.1|2755306_2756587_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	62.8	2.1e-154
WP_014418199.1|2756591_2756762_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	61.8	7.9e-09
WP_014418200.1|2756775_2758485_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	63.0	6.4e-207
WP_014418201.1|2758481_2758997_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.3	7.0e-32
WP_032863623.1|2759222_2759588_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	54.2	2.3e-29
WP_032863621.1|2759894_2760614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863619.1|2760636_2761449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863616.1|2761638_2761851_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	43.9	3.8e-08
WP_169800257.1|2762103_2762253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863614.1|2762391_2762604_-	helix-turn-helix domain-containing protein	NA	A0A1Z1LZP5	Bacillus_phage	52.9	1.6e-11
WP_014304494.1|2762902_2763040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032863612.1|2763144_2763660_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	43.2	1.6e-28
WP_025852602.1|2763679_2763865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025852606.1|2764112_2764778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025852608.1|2764940_2765198_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	40.5	2.5e-06
WP_025852610.1|2765233_2765437_-	XtrA/YqaO family protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	70.3	2.8e-21
WP_162918043.1|2765534_2765699_-	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	66.0	6.7e-13
WP_040221743.1|2765749_2766178_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	1.7e-44
WP_141233183.1|2766413_2767361_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.2	1.9e-54
WP_032859408.1|2767245_2767947_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_082029678.1|2768144_2768882_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2P1JU03	Anoxybacillus_phage	42.4	4.8e-42
WP_025852621.1|2768901_2769822_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	64.0	4.5e-90
WP_032859263.1|2769818_2770007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014721404.1|2770108_2770306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418217.1|2770302_2770560_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	39.8	1.1e-09
WP_014418218.1|2770556_2771129_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	56.9	4.7e-61
WP_014418219.1|2771186_2771915_-	Rha family transcriptional regulator	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	68.7	6.1e-90
WP_032863594.1|2771911_2772226_-	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	49.3	1.9e-11
WP_025852635.1|2772238_2772457_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014418220.1|2772610_2772988_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	45.3	1.1e-10
WP_014418221.1|2773359_2774556_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	43.9	2.5e-80
WP_014418222.1|2774599_2775904_-	purine permease	NA	NA	NA	NA	NA
WP_014418223.1|2775900_2776485_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014418224.1|2776817_2778320_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_014721409.1|2778431_2780351_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
WP_014418226.1|2780454_2780646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003153548.1|2780812_2780965_+	YpzG family protein	NA	NA	NA	NA	NA
WP_014418227.1|2781005_2782172_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003153541.1|2782705_2783005_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_014418228.1|2783084_2783633_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003153539.1|2783721_2783958_-|coat	spore coat protein	coat	NA	NA	NA	NA
2789543:2789561	attR	TTTTTAAAAACAGAAAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	2875546	2881799	4069641		Staphylococcus_phage(66.67%)	9	NA	NA
WP_007409428.1|2875546_2876140_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_014418279.1|2876129_2876885_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	1.7e-10
WP_003153376.1|2877092_2877182_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_014418280.1|2877269_2877791_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2877856_2878231_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2878347_2878812_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_014418281.1|2878844_2880041_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.7	2.1e-116
WP_007409425.1|2880055_2880703_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_014418282.1|2880683_2881799_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	4.4e-55
>prophage 9
NZ_CP009938	Bacillus sp. BH072 isolate honey chromosome, complete genome	4069641	3241061	3300953	4069641	coat,protease,tRNA	uncultured_Mediterranean_phage(25.0%)	59	NA	NA
WP_007408194.1|3241061_3241505_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003152716.1|3241517_3243722_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|3243879_3244392_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_014418527.1|3244397_3246758_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	8.1e-91
WP_014418528.1|3246813_3247140_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_014418529.1|3247203_3247701_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_014418530.1|3247832_3250052_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.5	1.2e-27
WP_014418531.1|3250088_3250385_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_014418532.1|3250500_3252057_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_014418533.1|3252064_3252721_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003152697.1|3252888_3253275_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_007408187.1|3253326_3253587_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.9e-06
WP_014305500.1|3253617_3254763_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152692.1|3254790_3255819_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003152687.1|3255844_3256045_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152685.1|3256037_3257042_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152683.1|3257052_3257658_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_014418534.1|3257792_3258302_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014721606.1|3258684_3259278_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_014418537.1|3259425_3260616_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_014418538.1|3260742_3261846_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_014721607.1|3261847_3262696_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_014418540.1|3262677_3264243_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_007408177.1|3264349_3265501_+	IscS subfamily cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	29.9	4.6e-31
WP_014418541.1|3265497_3266040_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_014418542.1|3266065_3266923_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|3266936_3267380_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_007408172.1|3267433_3268720_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014418543.1|3268751_3269330_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|3269647_3269932_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|3269944_3270286_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|3270288_3270597_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_014418544.1|3270742_3271609_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_014418545.1|3271601_3272405_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|3272532_3273336_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003152653.1|3273338_3274019_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_007408167.1|3274072_3274591_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_007408166.1|3274587_3275451_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|3275481_3276495_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_007408165.1|3276586_3277282_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_012118105.1|3277313_3277883_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_014418547.1|3278023_3279025_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_014418548.1|3279151_3279904_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_014418549.1|3280043_3281336_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014418550.1|3281394_3284037_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003152639.1|3284489_3284681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014418551.1|3284695_3285718_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_032863550.1|3285751_3287677_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014418553.1|3287809_3289099_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_015240312.1|3289127_3290102_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014418554.1|3290107_3290887_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_012118114.1|3290876_3291818_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_007408154.1|3291852_3292683_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_003152628.1|3292690_3294058_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014418555.1|3294251_3294743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152626.1|3294775_3295363_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_014418556.1|3295359_3297684_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.0e-183
WP_014418557.1|3297882_3299541_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_007408149.1|3299690_3300953_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
