The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010436	Helicobacter pylori strain 26695-1MET chromosome, complete genome	1667303	1018085	1070009	1667303	integrase,tRNA,transposase	Helicobacter_phage(50.0%)	42	1028592:1028611	1079932:1079951
WP_001150920.1|1018085_1018997_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_000401714.1|1019010_1019949_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_029671444.1|1020080_1020293_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	55.2	7.9e-06
WP_001862974.1|1020534_1021878_-	dynamin-like GTPase family protein	NA	NA	NA	NA	NA
WP_000244300.1|1024203_1025850_-	GTPase	NA	NA	NA	NA	NA
WP_000271456.1|1026073_1026361_-	endoribonuclease VapD	NA	NA	NA	NA	NA
WP_000880322.1|1026430_1026712_-	DUF3240 family protein	NA	NA	NA	NA	NA
WP_015056073.1|1026727_1029787_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	25.7	2.8e-83
1028592:1028611	attL	ATGAGCATGCCTATAGCGAT	NA	NA	NA	NA
WP_000816822.1|1029786_1030866_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_001212364.1|1030862_1032164_-	TolC family protein	NA	NA	NA	NA	NA
WP_000555186.1|1032153_1034259_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000682021.1|1034370_1035432_+	hypothetical protein	NA	A0A2D1GN01	Pseudoalteromonas_phage	30.1	2.0e-09
WP_000057737.1|1035444_1036920_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001165207.1|1036934_1037216_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_001010809.1|1037335_1038646_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	NA	NA	NA	NA
WP_000574070.1|1038774_1040238_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_161595581.1|1040238_1041732_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_000233600.1|1041862_1043020_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001863015.1|1044177_1044480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049794234.1|1044490_1044763_+	exonuclease VII large subunit	NA	NA	NA	NA	NA
WP_001101624.1|1045221_1045830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169565.1|1045830_1046121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343415.1|1046679_1047504_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000517562.1|1047790_1048006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875575.1|1048339_1049053_-	DUF1887 family protein	NA	NA	NA	NA	NA
WP_000886948.1|1050436_1050670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162481329.1|1050676_1051123_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	1.2e-75
WP_000930564.1|1051174_1052458_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.2	1.2e-200
WP_080012132.1|1052506_1053220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010875576.1|1053224_1053854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006537.1|1054439_1054691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009099.1|1054662_1055466_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_001120382.1|1055782_1056850_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	26.7	1.7e-08
WP_000905829.1|1057999_1059826_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_000930565.1|1059950_1061234_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5REX3	Helicobacter_phage	85.0	2.6e-200
WP_162481329.1|1061285_1061732_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	97.9	1.2e-75
WP_000587397.1|1062313_1062970_+	ParA family protein	NA	A2I303	Vibrio_virus	23.4	7.1e-05
WP_000394638.1|1063054_1063339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000665511.1|1063382_1064567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065304.1|1066782_1067097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025444691.1|1067647_1068172_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_001862466.1|1069592_1070009_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	96.4	4.6e-74
1079932:1079951	attR	ATCGCTATAGGCATGCTCAT	NA	NA	NA	NA
