The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP010315	Escherichia coli strain 789 chromosome, complete genome	5017219	557162	624089	5017219	tail,protease,terminase,integrase,lysis,head,holin,transposase,capsid,portal,tRNA	Enterobacteria_phage(41.51%)	71	567313:567359	615563:615609
WP_000912345.1|557162_558548_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|558583_559105_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|559212_559425_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|559426_560293_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|560763_561306_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|561525_562218_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691050.1|564869_565877_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001323731.1|565887_566403_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805432.1|566405_567038_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
567313:567359	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|567372_568536_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000433949.1|568391_568763_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_021514910.1|568762_569068_-	hypothetical protein	NA	U5P0J0	Shigella_phage	94.1	1.8e-48
WP_001242707.1|569067_569430_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_021514911.1|569420_569957_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	1.1e-99
WP_000081287.1|570084_570909_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135680.1|570974_571337_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_021514790.1|572269_573355_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.7	3.4e-60
WP_001410974.1|573589_574294_-	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	58.7	1.3e-68
WP_000098316.1|574400_574664_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	51.7	1.1e-09
WP_042033432.1|574692_575277_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	1.9e-57
WP_001188051.1|575452_575632_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_044502128.1|575621_576599_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	91.0	3.3e-139
WP_000054974.1|576595_577084_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	4.7e-86
WP_000210176.1|577083_577410_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|577406_577796_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_021562535.1|577815_578658_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	90.7	1.2e-137
WP_021562536.1|578665_579655_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	6.8e-193
WP_001047122.1|579668_580421_+	antitermination protein	NA	Q8SBE4	Shigella_phage	97.6	8.4e-135
WP_000966854.1|580575_581106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317671.1|581287_581482_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	95.3	5.7e-27
WP_000799651.1|581631_582693_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.7	2.7e-203
WP_000502162.1|583572_583764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284486.1|583786_584002_+|holin	holin	holin	M1FN85	Enterobacteria_phage	95.8	1.0e-32
WP_021562537.1|584006_584351_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	89.3	5.9e-35
WP_000370549.1|584316_584589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992107.1|584694_585228_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	95.5	1.1e-99
WP_001228695.1|585444_585627_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738425.1|585717_586011_-	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
WP_000830178.1|586491_586818_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881608.1|587024_587207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033549128.1|587771_588317_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	8.1e-95
WP_044502129.1|588291_590217_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000198149.1|590213_590420_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_044502130.1|590416_592018_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	8.5e-310
WP_000123225.1|591998_593318_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	6.2e-234
WP_001338090.1|593327_593660_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_044502131.1|593714_594740_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.5	8.4e-186
WP_077790342.1|594781_595177_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	3.3e-58
WP_000752994.1|595188_595542_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_032298608.1|595553_596132_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	1.7e-79
WP_000683105.1|596128_596524_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_044502411.1|596531_597272_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	2.5e-131
WP_044502133.1|597287_597674_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	90.6	1.5e-58
WP_071925348.1|597691_598126_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	95.8	9.3e-62
WP_044502134.1|598118_600698_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.4	0.0e+00
WP_000847347.1|600694_601024_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152505.1|601023_601722_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	96.1	1.1e-128
WP_044502135.1|601726_602470_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	2.9e-148
WP_071781836.1|602406_603039_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
WP_044502136.1|603099_606582_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.3	0.0e+00
WP_032202908.1|606648_607248_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.2e-109
WP_071925364.1|607312_610663_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_042033242.1|610662_611247_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.5e-102
WP_000239881.1|611301_611970_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042033240.1|612026_612332_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226376.1|612515_614000_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201822.1|614186_615140_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|615652_616414_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
615563:615609	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|616596_617487_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|617487_620460_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000420922.1|622952_624089_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP010315	Escherichia coli strain 789 chromosome, complete genome	5017219	1486566	1604053	5017219	tail,protease,terminase,integrase,lysis,transposase,tRNA	Escherichia_phage(46.3%)	111	1480950:1480966	1521328:1521344
1480950:1480966	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_000628065.1|1486566_1487799_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|1488053_1489037_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1489514_1490888_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157405.1|1491016_1491952_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_071925352.1|1492003_1493239_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.5e-239
WP_000079604.1|1493240_1493456_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1493534_1493744_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1493736_1493931_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1493987_1494797_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_044502199.1|1494789_1497390_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000632297.1|1497491_1497767_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_077790356.1|1497841_1498012_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	69.6	1.8e-16
WP_000560223.1|1498011_1498233_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001324055.1|1498674_1499163_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1499159_1499315_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1499768_1500245_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1500368_1500665_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1500687_1501110_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899746.1|1501122_1501980_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1501986_1502733_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_044502201.1|1502755_1503517_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	1.6e-117
WP_040091718.1|1503532_1503937_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	2.1e-63
WP_040091717.1|1504036_1506487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940342.1|1507165_1507765_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	5.5e-105
WP_000247764.1|1507764_1508055_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	1.1e-45
WP_000640161.1|1508051_1508594_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|1509638_1510067_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|1510238_1510613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502202.1|1510864_1511080_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.2e-32
WP_000193293.1|1511084_1511429_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000370551.1|1511394_1511667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|1511772_1512306_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001228696.1|1512522_1512708_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_024165216.1|1512904_1514362_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291093.1|1514499_1515291_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204035.1|1515283_1516216_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000126788.1|1516193_1516403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089450.1|1516406_1517501_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	1.0e-112
WP_044502203.1|1517481_1518783_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.3	1.4e-148
WP_000763702.1|1518785_1520192_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_001363932.1|1520175_1521288_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000770042.1|1521392_1522157_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
1521328:1521344	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918487.1|1522255_1523395_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|1523617_1524013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|1524012_1524396_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_097410841.1|1524396_1524846_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_000094292.1|1524872_1525835_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|1525985_1526345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|1526452_1526653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502204.1|1526816_1529303_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.2	3.3e-87
WP_044502205.1|1529309_1530050_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	48.2	7.2e-54
WP_001152425.1|1530379_1531078_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.9e-128
WP_001312811.1|1531083_1531827_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.1e-150
WP_000741572.1|1531724_1532372_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	2.0e-108
WP_044502206.1|1532432_1535912_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_001233121.1|1535979_1536579_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_044502207.1|1536643_1540057_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_040091700.1|1540056_1540641_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	5.6e-102
WP_134236106.1|1540695_1541364_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_040091698.1|1541420_1541726_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	82.6	4.8e-12
WP_044502208.1|1541908_1543393_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_040091696.1|1543577_1544531_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001295593.1|1545544_1545979_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|1546119_1547253_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_000628148.1|1547619_1551144_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1551417_1551684_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1551680_1552103_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|1552213_1553203_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_000900996.1|1553410_1556050_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698141.1|1556046_1556232_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001325798.1|1556236_1556566_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067491.1|1556737_1557643_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1557878_1559378_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001186463.1|1561956_1564002_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191073.1|1564286_1565216_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1565227_1565515_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1565523_1566270_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189194.1|1566284_1566782_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206368.1|1566789_1567860_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_044502209.1|1567856_1568624_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969777.1|1568623_1569412_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973371.1|1569413_1570841_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1570830_1571253_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206190.1|1571252_1572458_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_044502210.1|1572484_1573798_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000041178.1|1573898_1574849_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123454.1|1574830_1575421_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000097794.1|1575651_1576512_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_000177525.1|1576810_1577416_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000890910.1|1577415_1578312_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_044502211.1|1578327_1580085_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000627379.1|1580074_1581391_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000048948.1|1581441_1582047_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_044502212.1|1582247_1586150_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_001027942.1|1586421_1587222_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115944.1|1587418_1588858_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048667.1|1588899_1589901_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001307188.1|1590089_1590620_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|1590864_1591038_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|1591109_1591259_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001098532.1|1591657_1593298_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_000414560.1|1593335_1594259_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044502213.1|1594475_1595819_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375956.1|1596043_1597699_+	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001296778.1|1597838_1598063_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140891.1|1598125_1598662_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001234034.1|1598656_1599637_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001190278.1|1599760_1600753_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586732.1|1600749_1601343_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261020.1|1601644_1602313_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000826466.1|1602844_1604053_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.6e-207
>prophage 4
NZ_CP010315	Escherichia coli strain 789 chromosome, complete genome	5017219	1767855	1817474	5017219	tail,terminase,integrase,lysis	Enterobacteria_phage(35.0%)	63	1789740:1789755	1822169:1822184
WP_000527758.1|1767855_1769316_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_044502223.1|1769404_1770688_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1771290_1771404_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1771472_1771706_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1772022_1772613_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|1772710_1773286_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_071925355.1|1773285_1776648_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	1.4e-11
WP_032292241.1|1776712_1777312_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
WP_044502227.1|1777379_1780859_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.4	0.0e+00
WP_044502228.1|1781486_1782230_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_044502229.1|1782234_1782933_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	94.0	1.9e-125
WP_000847347.1|1782932_1783262_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_071925356.1|1783258_1784623_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.9	3.9e-207
WP_001549229.1|1784619_1786545_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453603.1|1786519_1787065_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_001368374.1|1787452_1787686_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1787743_1788154_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1788305_1788479_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1788650_1788806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1788884_1788950_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1788952_1789141_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1789151_1789364_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_044502230.1|1789726_1790224_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	28.8	1.1e-05
1789740:1789755	attL	TTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_044502231.1|1790220_1790754_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	1.9e-96
WP_000189916.1|1790750_1791062_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1791066_1791282_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1792035_1792251_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1792551_1792764_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1792818_1792908_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1793185_1793938_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1793951_1795001_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1795002_1795281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1795347_1795599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1795815_1795971_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1796042_1796330_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1796329_1796569_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1796593_1796899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1797101_1797434_+	protein FlxA	NA	NA	NA	NA	NA
WP_000955178.1|1799362_1799545_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_072096395.1|1799519_1799738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310834.1|1800851_1801208_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1801204_1801627_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1801667_1802633_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1802613_1803135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1803118_1803349_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1803432_1803840_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1804006_1804162_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1804321_1804540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|1804543_1804708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1805107_1805296_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1805292_1805484_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048342.1|1805576_1808048_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|1808135_1808372_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_044502232.1|1808406_1809687_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	2.1e-154
WP_001360138.1|1809706_1809817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|1809874_1810894_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1810905_1812120_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1812325_1812652_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1812786_1813128_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1813162_1813723_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1813725_1814436_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1814543_1814849_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041558.1|1815047_1817474_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
1822169:1822184	attR	TTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 5
NZ_CP010315	Escherichia coli strain 789 chromosome, complete genome	5017219	2172365	2263408	5017219	tail,integrase,terminase,head,holin,capsid,portal,protease	Escherichia_phage(41.3%)	103	2239067:2239082	2289281:2289296
WP_001774913.1|2172365_2173583_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000413227.1|2173663_2174404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001160187.1|2175099_2175648_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001283421.1|2175704_2177537_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000611335.1|2177533_2178190_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_000590344.1|2178485_2178662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106474.1|2178648_2178873_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001154273.1|2178940_2179663_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_001272994.1|2179892_2180645_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001158220.1|2180641_2181310_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001128215.1|2181324_2182311_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001295643.1|2182415_2183216_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001384571.1|2183303_2183855_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001087473.1|2183900_2184620_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_000079737.1|2184939_2186781_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146780.1|2187046_2188453_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000270663.1|2188477_2188888_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001015023.1|2188887_2189253_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245719.1|2189330_2190818_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001295642.1|2190851_2191265_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118901.1|2191451_2192657_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000789493.1|2192653_2192887_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_044502250.1|2192995_2193664_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	1.6e-81
WP_001274299.1|2194056_2194371_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994436.1|2194585_2196244_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2196236_2197232_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282692.1|2197224_2197911_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2197910_2199284_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000620089.1|2199741_2200869_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2200973_2201438_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2201442_2202447_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2202443_2202857_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2202859_2203225_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253447.1|2203224_2203962_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_044502251.1|2203971_2204241_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000104001.1|2205324_2205948_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2205991_2206234_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2206342_2206570_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000949112.1|2206867_2207683_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001351766.1|2207679_2209374_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2209611_2209794_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2209872_2210790_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212225.1|2210962_2211883_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228683.1|2211871_2212342_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001157256.1|2212322_2213741_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000826783.1|2215054_2216413_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001339045.1|2216412_2217084_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|2217216_2217630_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740111.1|2217738_2218743_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240090.1|2218743_2219379_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007754.1|2219635_2220286_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_044502252.1|2221876_2222458_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.7	7.5e-99
WP_071925357.1|2222457_2225871_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	1.4e-11
WP_032241503.1|2225935_2226535_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	1.3e-109
WP_044502255.1|2226602_2230082_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_000090949.1|2230142_2230745_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.6e-86
WP_032241748.1|2230681_2231425_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.7e-148
WP_001152459.1|2231429_2232128_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.1	1.7e-129
WP_001330090.1|2232127_2232484_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_024257906.1|2232461_2235689_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_071590020.1|2235735_2235996_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001312914.1|2236037_2236424_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_000097533.1|2236423_2237128_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001209399.1|2237187_2237532_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001312916.1|2237528_2237978_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001147820.1|2237974_2238313_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|2238321_2238627_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|2238638_2238827_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000257522.1|2238877_2240083_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
2239067:2239082	attL	GGCGATATCCGGCATC	NA	NA	NA	NA
WP_001193631.1|2240097_2240748_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|2240725_2241967_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000478564.1|2241966_2242149_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
WP_001140903.1|2242160_2243918_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	0.0e+00
WP_001312917.1|2243917_2244400_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001111090.1|2244547_2244898_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_000351660.1|2245036_2245576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|2245581_2245848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|2246065_2246251_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000992100.1|2246467_2247001_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193289.1|2247064_2247415_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000839572.1|2247419_2247635_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064896.1|2248447_2249137_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.8e-60
WP_044502258.1|2249133_2249493_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.1e-39
WP_044502259.1|2249505_2250555_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_001360223.1|2250556_2250835_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	6.3e-11
WP_000975572.1|2250901_2251165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040073344.1|2251382_2251595_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	9.9e-25
WP_122998651.1|2251639_2251771_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	69.4	3.0e-08
WP_039005580.1|2252442_2253033_-	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_039005582.1|2253060_2254374_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_157915105.1|2255091_2255634_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	3.7e-84
WP_044502261.1|2255545_2256583_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.8	3.3e-89
WP_000705377.1|2256554_2257106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2257089_2257317_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2257394_2257802_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_001092153.1|2258130_2258331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044502263.1|2258423_2258642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|2258645_2258810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2259209_2259398_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2259394_2259586_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_044502264.1|2259679_2262121_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.2	1.0e-112
WP_000096344.1|2262179_2262383_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|2262382_2263408_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
2289281:2289296	attR	GATGCCGGATATCGCC	NA	NA	NA	NA
>prophage 6
NZ_CP010315	Escherichia coli strain 789 chromosome, complete genome	5017219	2427099	2487943	5017219	tail,terminase,integrase,lysis,head,plate,holin,capsid,portal,tRNA	Escherichia_phage(39.53%)	71	2456662:2456676	2489639:2489653
WP_044502274.1|2427099_2428503_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137873.1|2428499_2429222_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|2429412_2429745_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2429953_2430250_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2430251_2430548_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2430650_2432012_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000468308.1|2432285_2432504_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882975.1|2432585_2433749_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_001471798.1|2433748_2434228_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.1e-84
WP_044502275.1|2434242_2436690_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.0	0.0e+00
WP_000785970.1|2436682_2436802_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2436834_2437110_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2437166_2437685_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001403133.1|2437697_2438888_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_044502276.1|2439486_2440479_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_044502277.1|2440872_2441400_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	94.9	1.5e-90
WP_000104724.1|2441403_2443626_-	hypothetical protein	NA	Q858V4	Yersinia_virus	40.8	8.8e-156
WP_001285314.1|2443636_2444167_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_001534994.1|2444159_2445068_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_000127160.1|2445072_2445420_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	1.1e-57
WP_001093722.1|2445416_2446052_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	3.4e-113
WP_021547832.1|2446135_2446921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297845.1|2446992_2447445_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_000917158.1|2447437_2447905_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.5e-81
WP_001300730.1|2447867_2448041_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_044502278.1|2448012_2448438_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	1.0e-65
WP_044502279.1|2448425_2448851_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	6.6e-60
WP_001144101.1|2448865_2449363_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|2449362_2449644_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_044502280.1|2449647_2449851_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	98.5	1.2e-30
WP_000988633.1|2449850_2450360_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203442.1|2450459_2451197_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	98.0	1.3e-127
WP_001248575.1|2451200_2452274_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.7	1.1e-201
WP_001085978.1|2452332_2453187_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.6	6.2e-134
WP_044502281.1|2453360_2455133_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_044502282.1|2455132_2456167_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	1.2e-200
WP_044502283.1|2456532_2458005_-	ATP-binding protein	NA	NA	NA	NA	NA
2456662:2456676	attL	ATTAAAAATAAGATG	NA	NA	NA	NA
WP_028985816.1|2458096_2460349_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	92.3	0.0e+00
WP_000027674.1|2460338_2460614_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113271.1|2460610_2460835_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	8.5e-35
WP_001512913.1|2460834_2461137_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	95.0	1.2e-44
WP_000557703.1|2461136_2461361_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217671.1|2461424_2461925_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000043869.1|2462102_2462378_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2462492_2462792_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_001512914.1|2462907_2463921_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	3.7e-194
WP_000716757.1|2464186_2464504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2464909_2465809_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2465890_2466670_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844208.1|2466769_2467810_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|2467857_2469213_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823272.1|2469216_2469501_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182914.1|2469531_2469984_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853886.1|2469993_2471256_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289788.1|2471284_2472139_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_044502284.1|2472448_2473501_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2473757_2475035_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|2475031_2476036_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_021535094.1|2476032_2476998_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|2476971_2477718_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000822274.1|2478656_2479457_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2479453_2480242_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141032.1|2480588_2480828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000617145.1|2480993_2481239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594465.1|2481250_2481970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000870791.1|2482116_2482299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273871.1|2484063_2484615_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	2.0e-29
WP_001316486.1|2484781_2485246_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000737406.1|2485356_2485704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240373.1|2485781_2486507_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001257775.1|2486635_2487943_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2489639:2489653	attR	ATTAAAAATAAGATG	NA	NA	NA	NA
>prophage 7
NZ_CP010315	Escherichia coli strain 789 chromosome, complete genome	5017219	2510637	2520078	5017219		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2510637_2511774_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|2511770_2513771_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2513895_2514357_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2514396_2514867_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2514913_2515633_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2515629_2517315_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2517536_2518268_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2518327_2518435_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2518415_2519147_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|2519151_2520078_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 8
NZ_CP010315	Escherichia coli strain 789 chromosome, complete genome	5017219	3127488	3140671	5017219		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|3127488_3130050_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|3130155_3130812_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272549.1|3130862_3131660_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3131825_3132734_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3132730_3133993_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3133989_3134628_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|3134632_3135409_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|3135497_3136862_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081524.1|3136955_3137948_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.0e-31
WP_001272592.1|3138010_3139150_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3139289_3139916_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3139909_3140671_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 9
NZ_CP010315	Escherichia coli strain 789 chromosome, complete genome	5017219	4790887	4858710	5017219	tRNA,transposase,protease	Vibrio_phage(20.0%)	55	NA	NA
WP_001162171.1|4790887_4792240_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|4792422_4792809_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106222.1|4792853_4793318_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|4793475_4795614_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001339491.1|4796007_4797663_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|4797712_4799134_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|4799252_4800200_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4800384_4800438_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|4800578_4803275_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047538.1|4803480_4803867_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4803939_4804401_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4804413_4805349_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4805352_4805487_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230277.1|4805767_4806163_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500725.1|4806293_4807007_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256670.1|4807077_4807671_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|4807815_4808268_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_044502395.1|4808390_4809974_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000012908.1|4810134_4811148_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4811309_4811726_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|4811771_4812275_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079660.1|4812467_4813664_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416392.1|4813717_4816573_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786393.1|4816572_4817016_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4817369_4818881_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4819147_4820248_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4820247_4821330_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_044502396.1|4821490_4822993_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001309159.1|4823070_4824069_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128347.1|4824135_4825455_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|4825517_4826282_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|4826305_4827337_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|4827553_4828117_+	gluconokinase	NA	NA	NA	NA	NA
WP_001318460.1|4828120_4829140_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000483767.1|4833697_4835044_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|4835652_4836870_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|4836881_4838000_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|4838042_4838168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|4838220_4838478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|4838791_4839958_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|4839893_4840307_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|4840369_4842367_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000336726.1|4842520_4843339_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088391.1|4843374_4843677_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177057.1|4844610_4844868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4845424_4846192_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4846192_4847149_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|4847145_4848144_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_044502397.1|4848140_4849043_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|4849087_4851412_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068910.1|4851498_4852452_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4852448_4852970_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|4854719_4854977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823250.1|4855727_4857086_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4857324_4858710_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
>prophage 1
NZ_CP010317	Escherichia coli strain 789 plasmid pAPEC-O78-2	106397	76317	87607	106397	transposase	Salmonella_phage(50.0%)	9	NA	NA
WP_011117598.1|76317_76743_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.8e-50
WP_044502556.1|76755_78045_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	3.3e-171
WP_001138014.1|79000_81967_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|81970_82531_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|82519_82687_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001323889.1|82840_84418_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_106121298.1|85530_86758_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.0e-174
WP_011117596.1|86843_87206_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_011117595.1|87253_87607_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	48.7	9.7e-25
>prophage 1
NZ_CP010316	Escherichia coli strain 789 plasmid pAPEC-O78-ColV	144859	17222	71497	144859	integrase,protease,transposase	Macacine_betaherpesvirus(25.0%)	35	NA	NA
WP_085974881.1|17222_18495_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.1e-174
WP_000450494.1|19719_20913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000974762.1|23173_24115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001312828.1|24911_26282_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000733252.1|26285_28226_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	3.0e-35
WP_000928804.1|28222_29410_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_085949156.1|30863_32077_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_001312823.1|32259_32418_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000280980.1|33690_34644_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_000771475.1|35076_36186_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000175738.1|36248_37157_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001332052.1|37530_37719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|37839_38580_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361611.1|38864_39842_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_000949004.1|42823_43738_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|43737_44565_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000992806.1|44561_45419_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|45415_46273_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|47515_47896_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095526.1|48275_49469_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|49604_51329_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011907.1|51329_52277_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015721.1|52276_54019_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|54015_55293_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973517.1|55374_57576_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000163251.1|58808_59471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000190053.1|59910_60390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000238252.1|60507_60957_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
WP_000715081.1|61584_63087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925960.1|63312_63504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238646.1|66108_67275_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000817028.1|67274_68246_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_000343071.1|69464_70040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092896.1|70052_70265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000082155.1|70525_71497_-|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	8.3e-26
