The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009049	Salmonella enterica subsp. enterica serovar Paratyphi A strain 50973 chromosome, complete genome	4599018	482623	493387	4599018	integrase	Enterobacteria_phage(60.0%)	13	479005:479021	487802:487818
479005:479021	attL	GCCCGCGATGATAAAAA	NA	NA	NA	NA
WP_039773487.1|482623_483733_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	25.9	2.3e-32
WP_020839656.1|484203_485463_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.2	3.7e-74
WP_000970946.1|485516_486512_-	site-specific DNA-methyltransferase	NA	S0A236	Cellulophaga_phage	24.2	3.5e-19
WP_010376679.1|486567_486804_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000667328.1|486800_487364_+	type II restriction endonuclease PvuII	NA	A0A1B0UXL9	Roseobacter_phage	42.9	7.2e-30
WP_000210078.1|487583_488150_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
487802:487818	attR	TTTTTATCATCGCGGGC	NA	NA	NA	NA
WP_000984211.1|488166_488412_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000198637.1|488408_489146_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.9	3.4e-80
WP_000556591.1|489683_489950_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_000980371.1|489946_490498_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.9	2.0e-24
WP_001216601.1|490494_490722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743148.1|490718_491039_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783718.1|491053_493387_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.1	0.0e+00
>prophage 2
NZ_CP009049	Salmonella enterica subsp. enterica serovar Paratyphi A strain 50973 chromosome, complete genome	4599018	1380165	1389336	4599018	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569167.1|1380165_1381113_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824856.1|1381096_1381828_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1381808_1381916_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1381975_1382707_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272855.1|1382929_1384615_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	88.9	3.7e-279
WP_000598637.1|1384611_1385331_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1385377_1385845_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001265354.1|1385901_1386432_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703141.1|1386603_1387062_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_000195335.1|1387302_1389336_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP009049	Salmonella enterica subsp. enterica serovar Paratyphi A strain 50973 chromosome, complete genome	4599018	1472758	1480414	4599018		Enterobacteria_phage(50.0%)	8	NA	NA
WP_000697846.1|1472758_1473844_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023655.1|1473843_1474743_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	4.7e-31
WP_000857533.1|1474790_1475669_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	6.0e-108
WP_000973711.1|1475669_1476221_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000018223.1|1476226_1477201_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648782.1|1477216_1477990_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565907.1|1477994_1479074_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.7e-16
WP_000126347.1|1479100_1480414_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP009049	Salmonella enterica subsp. enterica serovar Paratyphi A strain 50973 chromosome, complete genome	4599018	1565289	1572516	4599018		Morganella_phage(33.33%)	7	NA	NA
WP_000394197.1|1565289_1565709_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457650.1|1565711_1566980_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	1.3e-225
WP_000208509.1|1567425_1567638_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1567648_1567837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080667.1|1568097_1569276_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.7	2.3e-107
WP_000377044.1|1570316_1571012_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.8e-07
WP_001157323.1|1571085_1572516_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP009049	Salmonella enterica subsp. enterica serovar Paratyphi A strain 50973 chromosome, complete genome	4599018	2280978	2289171	4599018		Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2280978_2281218_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_011233072.1|2282091_2282901_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.4	4.2e-63
WP_001277616.1|2282973_2283351_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2283498_2284041_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_011233073.1|2284232_2284961_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.9	4.1e-62
WP_011233074.1|2284977_2285391_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_000915986.1|2286337_2287462_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444503.1|2287920_2289171_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 6
NZ_CP009049	Salmonella enterica subsp. enterica serovar Paratyphi A strain 50973 chromosome, complete genome	4599018	2539614	2549312	4599018	integrase,protease	Ralstonia_phage(16.67%)	8	2534143:2534157	2548048:2548062
2534143:2534157	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_011233091.1|2539614_2539992_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	2.6e-20
WP_001117984.1|2540153_2540351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274276.1|2541919_2542450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2542948_2545225_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2545255_2545576_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2545899_2546121_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125879.1|2546250_2548197_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2548048:2548062	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201759.1|2548193_2549312_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 7
NZ_CP009049	Salmonella enterica subsp. enterica serovar Paratyphi A strain 50973 chromosome, complete genome	4599018	3103872	3147979	4599018	coat,holin,portal,lysis,protease,integrase,terminase	Salmonella_phage(50.77%)	66	3134060:3134073	3145355:3145368
WP_000915523.1|3103872_3104235_+	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_000703606.1|3104231_3105164_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	99.7	1.2e-175
WP_000129927.1|3106067_3108071_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	99.9	0.0e+00
WP_000532177.1|3108206_3108455_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3108475_3108769_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000868979.1|3108907_3110839_-	hypothetical protein	NA	I1TEJ6	Salmonella_phage	99.1	0.0e+00
WP_011233121.1|3110838_3112176_-	phage DNA ejection protein	NA	A0A1R3Y5Q4	Salmonella_virus	99.3	2.8e-242
WP_000964851.1|3112218_3112908_-	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	2.9e-81
WP_000627703.1|3112910_3113366_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_000774919.1|3113365_3114004_-	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_001122416.1|3114007_3115426_-	Packaged DNA stabilization protein gp10	NA	A0A220NQZ5	Salmonella_phage	99.8	2.4e-276
WP_001166094.1|3115385_3115886_-	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	98.8	1.2e-89
WP_000538674.1|3115869_3116430_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001196936.1|3116470_3117763_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	99.8	2.5e-243
WP_000433852.1|3117762_3118674_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_000774658.1|3118687_3120865_-|portal	portal protein p19	portal	I6R968	Salmonella_phage	98.6	0.0e+00
WP_000417866.1|3120864_3122364_-|terminase	terminase	terminase	A0A2H4FUR5	Salmonella_phage	100.0	4.8e-307
WP_000729925.1|3122341_3122830_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_012532521.1|3122833_3123238_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	99.3	1.5e-66
WP_000808100.1|3123240_3123483_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_001028469.1|3123806_3124328_-	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	100.0	1.9e-101
WP_011233123.1|3124540_3124990_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	87.8	3.0e-63
WP_001167374.1|3125007_3125445_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	6.3e-74
WP_000738703.1|3125428_3125755_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_001235452.1|3126189_3126813_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	87.0	8.3e-96
WP_000994515.1|3126809_3126998_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001046347.1|3126994_3127357_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	7.8e-62
WP_000002244.1|3127353_3127644_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_001286918.1|3127636_3127849_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	4.7e-35
WP_000950962.1|3127841_3128018_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_011233124.1|3128010_3128352_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	99.1	5.1e-63
WP_000113770.1|3128354_3128531_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679702.1|3128497_3128671_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000811302.1|3128667_3129114_-	recombination protein NinB	NA	I6R0N7	Salmonella_phage	98.6	7.8e-80
WP_000049340.1|3129070_3129367_-	hypothetical protein	NA	E7C9R7	Salmonella_phage	99.0	6.8e-48
WP_000344579.1|3129369_3129690_-	hypothetical protein	NA	I6R992	Salmonella_phage	59.4	1.1e-22
WP_000975822.1|3129701_3129857_-	hypothetical protein	NA	A0A2H4FWM4	Salmonella_phage	100.0	2.4e-20
WP_000248682.1|3129868_3130075_-	hypothetical protein	NA	I6RSI5	Salmonella_phage	100.0	1.1e-31
WP_000131495.1|3130150_3131587_-	AAA family ATPase	NA	A0A220NQX0	Salmonella_phage	99.2	3.0e-274
WP_000065656.1|3131576_3132476_-	hypothetical protein	NA	E7C9R4	Salmonella_phage	98.7	2.5e-154
WP_001125982.1|3132468_3132615_-	DUF2740 family protein	NA	A0A0M4S617	Salmonella_phage	100.0	1.9e-19
WP_001103491.1|3132649_3132931_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	98.9	1.6e-43
WP_000182204.1|3133041_3133257_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3133367_3134057_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
3134060:3134073	attL	AGCCAATGGCCTGA	NA	NA	NA	NA
WP_000680395.1|3134414_3134660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786965.1|3134698_3134908_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	92.8	1.9e-28
WP_000216028.1|3135271_3135574_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	97.0	8.2e-49
WP_001066166.1|3135586_3136174_-	superinfection exclusion protein B	NA	A0A0M4R594	Salmonella_phage	98.5	1.4e-84
WP_000213983.1|3136387_3136582_+	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_000542409.1|3136618_3136912_+	hypothetical protein	NA	B8K1E3	Salmonella_phage	95.7	4.1e-45
WP_001200114.1|3137226_3137379_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	98.0	9.2e-25
WP_000156730.1|3137359_3137548_+	DUF5444 family protein	NA	A0A1R3Y5S5	Salmonella_virus	100.0	1.6e-31
WP_000902088.1|3137537_3137681_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	97.9	2.7e-18
WP_001046981.1|3137677_3138385_+	recombinase	NA	A0A1R3Y600	Salmonella_virus	100.0	4.1e-139
WP_001111312.1|3138715_3139009_+	DUF2856 family protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001214769.1|3139019_3139190_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	94.6	5.7e-23
WP_000665851.1|3139186_3139846_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	61.6	2.2e-62
WP_001017879.1|3139842_3140343_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	62.6	1.0e-64
WP_000582227.1|3140342_3141098_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	99.2	5.5e-150
WP_000208071.1|3141108_3142194_+	DUF550 domain-containing protein	NA	A0A1R3Y5Q8	Salmonella_virus	76.7	2.0e-153
WP_000002128.1|3142186_3142471_+	ASCH domain-containing protein	NA	A0A1R3Y5R3	Salmonella_virus	100.0	4.1e-50
WP_157804913.1|3142539_3142680_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	95.7	7.2e-16
WP_000051901.1|3142909_3144073_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	99.7	4.1e-229
WP_000893229.1|3144278_3145529_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.0e-97
3145355:3145368	attR	TCAGGCCATTGGCT	NA	NA	NA	NA
WP_001285277.1|3145540_3146644_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	9.0e-61
WP_001043666.1|3146926_3147979_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.3e-112
>prophage 8
NZ_CP009049	Salmonella enterica subsp. enterica serovar Paratyphi A strain 50973 chromosome, complete genome	4599018	3216412	3343263	4599018	tail,tRNA,holin,portal,lysis,plate,capsid,head,integrase,terminase	Salmonella_phage(51.85%)	127	3278554:3278602	3344363:3344411
WP_000108009.1|3216412_3216907_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371505.1|3216922_3218806_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145239.1|3218802_3219798_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367632.1|3219808_3220852_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|3221382_3222114_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|3222177_3222645_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801242.1|3222641_3223364_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052769.1|3223398_3224154_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_039755476.1|3224225_3225593_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	32.5	9.0e-10
WP_000207237.1|3225648_3226419_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230970.1|3226496_3227297_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127560.1|3227428_3228604_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648518.1|3228708_3229623_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154860.1|3229644_3230448_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	34.6	5.1e-37
WP_001235092.1|3236450_3239024_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000992634.1|3239153_3239885_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|3239881_3240862_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|3240993_3241731_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|3242002_3242341_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|3242444_3242492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200087.1|3242591_3243752_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210975.1|3243712_3244621_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225183.1|3244678_3245800_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|3245809_3246880_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212373.1|3247319_3247838_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030993.1|3247830_3249051_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|3249207_3249555_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469802.1|3249595_3250363_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|3250407_3250956_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|3250974_3251223_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460060.1|3251474_3252836_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|3253001_3253793_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127908301.1|3253812_3255099_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000271804.1|3255228_3255834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|3255874_3256465_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|3256587_3257466_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|3257551_3259213_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203433.1|3259361_3259700_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|3259865_3260156_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242604.1|3260145_3260622_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|3260770_3261253_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_039773610.1|3261871_3273346_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533854.1|3273410_3274820_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196157.1|3274816_3276997_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000342601.1|3277004_3278168_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
3278554:3278602	attL	GAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_001039750.1|3278697_3279075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001775272.1|3279161_3279380_-	positive regulator of late gene transcription	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
WP_001011749.1|3279447_3280548_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	91.8	3.0e-189
WP_000980405.1|3280544_3281030_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
WP_161976233.1|3281029_3283576_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	42.7	1.2e-113
WP_000763315.1|3283802_3283922_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001280965.1|3283936_3284239_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
WP_001207653.1|3284293_3284809_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_000046101.1|3284818_3285991_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
WP_000388790.1|3286093_3286312_-	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_000161709.1|3286525_3287248_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000006337.1|3287445_3287853_-|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_001274654.1|3287859_3289479_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	91.2	3.2e-155
WP_001086800.1|3289475_3290081_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	99.0	1.3e-117
WP_000268328.1|3290073_3290982_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.7	3.5e-159
WP_000177408.1|3290968_3291328_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_000993747.1|3291324_3291903_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.1e-107
WP_000343944.1|3291971_3292418_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
WP_001039961.1|3292410_3292842_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_024131238.1|3292937_3293366_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.9	3.3e-67
WP_000731034.1|3293362_3293740_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
WP_001069889.1|3293744_3294254_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	1.2e-92
WP_000171565.1|3294234_3294450_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|3294453_3294657_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673540.1|3294656_3295121_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
WP_000059175.1|3295214_3295865_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
WP_000730751.1|3295868_3296933_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
WP_000216272.1|3296949_3297783_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
WP_001098454.1|3297925_3299692_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.3	0.0e+00
WP_011233140.1|3299691_3300735_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.0	1.2e-174
WP_000080839.1|3300783_3301479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000789324.1|3301498_3302563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835188.1|3303632_3303851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|3303946_3304180_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_001154438.1|3304191_3304380_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	7.9e-26
WP_000301196.1|3304547_3306950_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.5	0.0e+00
WP_000104130.1|3306940_3307801_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
WP_001090717.1|3307797_3308382_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
WP_000785510.1|3308378_3308606_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
WP_001244240.1|3308605_3308839_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
WP_000963479.1|3308906_3309248_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_000956167.1|3309211_3309412_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
WP_000460852.1|3309419_3309929_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
WP_000102106.1|3309961_3310204_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_000052560.1|3310320_3310953_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
WP_000027757.1|3310956_3311982_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
WP_001177838.1|3312225_3312474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136561.1|3314098_3315217_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_011233142.1|3315896_3317597_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	9.2e-222
WP_000200793.1|3317599_3318145_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.9e-59
WP_000267952.1|3318116_3318842_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	2.3e-68
WP_000421117.1|3318831_3319359_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	3.1e-51
WP_000084304.1|3319376_3321404_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	47.9	1.2e-154
WP_001001826.1|3321413_3322001_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	2.4e-89
WP_000136924.1|3321993_3323178_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	77.6	2.8e-177
WP_001002797.1|3323174_3323504_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811085.1|3323500_3325471_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.1	5.6e-271
WP_000411339.1|3325658_3325916_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376372.1|3326062_3326395_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_039755423.1|3326394_3326736_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	90.1	3.8e-50
WP_001154425.1|3326732_3327026_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166742.1|3327035_3327491_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	71.5	2.1e-56
WP_000220202.1|3327487_3328615_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	5.6e-175
WP_000560074.1|3328611_3329319_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.2	6.3e-100
WP_000084220.1|3329315_3329822_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000447487.1|3329818_3330307_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218536.1|3330367_3331069_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.2	3.2e-88
WP_000550496.1|3331072_3332095_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_000018798.1|3332156_3332957_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_001151947.1|3333117_3334893_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.6	7.0e-289
WP_000038210.1|3334889_3335951_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3335947_3336271_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000960960.1|3336244_3336463_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	49.1	2.8e-06
WP_001137729.1|3336575_3338327_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	75.0	2.2e-255
WP_016504913.1|3338453_3338597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011233149.1|3338637_3339450_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	84.3	8.8e-122
WP_000057334.1|3339440_3339671_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3339738_3340140_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000643374.1|3340554_3340782_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_023211710.1|3340791_3341295_-	phage protein	NA	F1BUN6	Cronobacter_phage	72.5	4.5e-60
WP_000687097.1|3341677_3342250_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	53.8	1.7e-58
WP_012532529.1|3342249_3343263_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUN9	Cronobacter_phage	85.1	2.5e-174
3344363:3344411	attR	GAGGATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
