The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007511	Pseudomonas balearica DSM 6083 strain DSM6083 (=SP1402) chromosome, complete genome	4383480	206076	217234	4383480		Bacillus_phage(85.71%)	7	NA	NA
WP_041108847.1|206076_206466_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.3	2.0e-15
WP_043217885.1|206462_209309_-	response regulator	NA	W8CYF6	Bacillus_phage	33.5	7.6e-27
WP_043222839.1|209373_211035_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.3	3.8e-18
WP_041108843.1|211027_211414_-	response regulator	NA	W8CYM9	Bacillus_phage	29.6	1.3e-06
WP_043217887.1|211410_213822_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	31.5	1.0e-24
WP_043217889.1|213870_214257_-	response regulator	NA	W8CYM9	Bacillus_phage	36.8	1.4e-13
WP_082041959.1|214219_217234_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	28.9	2.0e-25
>prophage 2
NZ_CP007511	Pseudomonas balearica DSM 6083 strain DSM6083 (=SP1402) chromosome, complete genome	4383480	245611	253567	4383480	integrase	Pseudomonas_phage(85.71%)	10	235784:235799	255361:255376
235784:235799	attL	CGCGCGGCGATCTTGC	NA	NA	NA	NA
WP_041108801.1|245611_246214_-	hypothetical protein	NA	A0A1B0VMK2	Pseudomonas_phage	55.0	9.0e-55
WP_041108799.1|246753_248505_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	40.4	1.5e-110
WP_052264501.1|248501_249431_-	topoisomerase	NA	A0A1B0VML8	Pseudomonas_phage	57.3	1.3e-89
WP_041108797.1|249435_249753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041108795.1|249749_250022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052264502.1|250458_250788_-	hypothetical protein	NA	A0A1B0VRK7	Pseudomonas_phage	41.3	1.7e-10
WP_041108793.1|250789_251008_-	AlpA family transcriptional regulator	NA	A0A1B0VNF0	Pseudomonas_phage	55.6	1.6e-09
WP_041108791.1|251112_251823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041108789.1|251922_253131_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	79.9	1.2e-186
WP_041108787.1|253117_253567_-	DUF4102 domain-containing protein	NA	A0A2L0V119	Agrobacterium_phage	43.5	1.2e-08
255361:255376	attR	CGCGCGGCGATCTTGC	NA	NA	NA	NA
>prophage 3
NZ_CP007511	Pseudomonas balearica DSM 6083 strain DSM6083 (=SP1402) chromosome, complete genome	4383480	1851509	1857422	4383480	tRNA,integrase,transposase	Shigella_phage(33.33%)	6	1846469:1846484	1870465:1870480
1846469:1846484	attL	GCCTGCTCGACGGTCA	NA	NA	NA	NA
WP_041105431.1|1851509_1852004_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	33.5	1.2e-15
WP_043223027.1|1852163_1853834_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	62.1	1.0e-204
WP_043219837.1|1853837_1855223_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	2.3e-45
WP_043219839.1|1855280_1856135_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.2	3.5e-28
WP_080773344.1|1856909_1857086_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	55.0	5.5e-05
WP_082041978.1|1857128_1857422_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	41.5	1.2e-07
1870465:1870480	attR	TGACCGTCGAGCAGGC	NA	NA	NA	NA
>prophage 4
NZ_CP007511	Pseudomonas balearica DSM 6083 strain DSM6083 (=SP1402) chromosome, complete genome	4383480	2203589	2214658	4383480	tRNA	uncultured_Caudovirales_phage(60.0%)	12	NA	NA
WP_043220291.1|2203589_2204570_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	72.5	1.3e-138
WP_043220293.1|2204560_2204896_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	68.5	1.6e-37
WP_043220296.1|2204892_2205195_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	55.0	1.1e-21
WP_041105552.1|2205194_2205554_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	62.5	7.3e-36
WP_043220298.1|2205553_2205946_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	75.2	1.6e-49
WP_041105554.1|2206038_2206704_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	77.5	1.7e-86
WP_043220303.1|2206964_2208359_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_041105556.1|2208517_2209798_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.8	2.3e-100
WP_041105557.1|2209864_2210239_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	36.0	2.7e-09
WP_043220306.1|2210235_2211561_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	4.0e-79
WP_041105559.1|2211604_2212231_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_074519851.1|2212249_2214658_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	6.5e-88
>prophage 5
NZ_CP007511	Pseudomonas balearica DSM 6083 strain DSM6083 (=SP1402) chromosome, complete genome	4383480	3461377	3534994	4383480	protease,integrase,head,tail,portal,transposase,plate,terminase,tRNA	uncultured_Caudovirales_phage(32.43%)	83	3482234:3482257	3540491:3540514
WP_043221753.1|3461377_3461665_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_041103923.1|3461679_3463131_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_102847943.1|3463139_3464591_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_043221755.1|3464698_3465103_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.7	2.6e-21
WP_043221756.1|3465158_3466226_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_043221758.1|3466249_3467335_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_041103915.1|3467376_3468315_-	AEC family transporter	NA	NA	NA	NA	NA
WP_041103914.1|3468403_3468964_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_041103912.1|3468992_3470246_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_043221760.1|3470394_3471099_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_041103909.1|3471161_3471491_-	RnfH family protein	NA	NA	NA	NA	NA
WP_041103907.1|3471483_3471918_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_041103905.1|3472097_3472580_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.0e-29
WP_041103903.1|3472604_3473399_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043221762.1|3473676_3475371_+	L-lactate permease	NA	NA	NA	NA	NA
WP_041103899.1|3475465_3476287_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_043221763.1|3476283_3477744_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_043221765.1|3477740_3478412_+	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_043221767.1|3478408_3481258_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_041103890.1|3481434_3481740_+	hypothetical protein	NA	NA	NA	NA	NA
3482234:3482257	attL	TTCAAATCCCCCCGGCTCCACCAA	NA	NA	NA	NA
WP_043221769.1|3482561_3482795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043221770.1|3482851_3483292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043221772.1|3483288_3484647_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	58.1	8.9e-143
WP_043221774.1|3484643_3485150_-	DUF2924 domain-containing protein	NA	NA	NA	NA	NA
WP_043221776.1|3485150_3485366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043221777.1|3485498_3486413_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_043221779.1|3486409_3486730_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043221781.1|3486934_3488164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043221783.1|3488126_3489131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043221785.1|3489313_3489526_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052264582.1|3489522_3489993_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	45.0	1.0e-29
WP_043221787.1|3489998_3490313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043221790.1|3490309_3491197_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.0	3.1e-104
WP_043221792.1|3491199_3491805_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	60.6	1.4e-63
WP_043221794.1|3491818_3493495_+	DEAD/DEAH box helicase	NA	A0A1B1IW48	uncultured_Mediterranean_phage	29.5	4.0e-36
WP_043221796.1|3493491_3493914_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	48.8	1.5e-24
WP_043221798.1|3493913_3494669_+|tRNA	isoleucyl-tRNA synthetase	tRNA	K4HZA0	Acidithiobacillus_phage	59.0	3.7e-82
WP_052264631.1|3494668_3496858_+	AAA family ATPase	NA	A0A1B2LRQ1	Wolbachia_phage	33.1	7.2e-102
WP_043221800.1|3497169_3497625_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	70.3	1.7e-53
WP_043221801.1|3497627_3497831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043221803.1|3497823_3498210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082041996.1|3498404_3499721_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	69.4	4.6e-160
WP_043221805.1|3499993_3500455_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	71.8	3.4e-22
WP_043221806.1|3500495_3500717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043221808.1|3500763_3500970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052264583.1|3501325_3501853_+	hypothetical protein	NA	A0A2K9V2Q9	Faecalibacterium_phage	29.4	3.6e-07
WP_143008656.1|3501770_3503678_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	46.0	3.6e-134
WP_043221810.1|3503696_3503903_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	52.2	1.2e-11
WP_082042020.1|3503905_3505423_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	66.9	6.0e-188
WP_052264585.1|3505419_3506571_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	46.0	4.4e-82
WP_043221812.1|3506592_3506937_+|head	head decoration protein	head	NA	NA	NA	NA
WP_043221814.1|3507984_3508284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043221816.1|3508280_3508814_+|tail	phage tail protein	tail	B0ZSF5	Halomonas_phage	37.2	1.9e-16
WP_043221818.1|3508827_3509343_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	43.6	1.2e-26
WP_043221820.1|3509339_3509999_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	43.9	3.1e-24
WP_052264632.1|3510107_3510308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043223276.1|3510317_3510644_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	54.7	7.3e-27
WP_043221823.1|3510640_3511525_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	62.3	9.4e-93
WP_043221825.1|3511517_3512141_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	58.3	1.1e-60
WP_052264586.1|3512137_3513217_+	hypothetical protein	NA	A0A077K818	Ralstonia_phage	35.4	9.4e-71
WP_043221827.1|3513225_3513975_+	hypothetical protein	NA	A0A077K9S5	Ralstonia_phage	53.0	2.8e-61
WP_043221829.1|3514045_3515206_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	74.2	5.6e-162
WP_043221831.1|3515218_3515722_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	55.2	1.2e-49
WP_043221834.1|3515763_3516087_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_043221835.1|3516136_3518566_+|tail	tail length determination protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	56.6	7.4e-07
WP_052264587.1|3518574_3519492_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	42.6	3.2e-27
WP_043223283.1|3519478_3519673_+|tail	phage tail protein	tail	A0A2H4IYW8	uncultured_Caudovirales_phage	59.7	8.5e-15
WP_043221838.1|3519676_3520729_+	hypothetical protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	49.6	3.5e-86
WP_043221841.1|3520794_3521085_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	47.1	1.3e-14
WP_043223285.1|3521204_3521549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043221842.1|3521548_3522004_+	lysozyme	NA	A0A142EZW8	Stenotrophomonas_phage	45.8	1.3e-26
WP_143008655.1|3521976_3523902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043221844.1|3523906_3524659_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_043221846.1|3524659_3525961_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_043221848.1|3525957_3526371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043221849.1|3526399_3527284_+	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_043221851.1|3527286_3527703_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_043221853.1|3527702_3528686_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_143008654.1|3528701_3529313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043221857.1|3529401_3529641_-	DNA-binding protein	NA	A0A291LAT3	Bordetella_phage	35.8	4.7e-07
WP_041104567.1|3530027_3532481_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	22.5	7.8e-12
WP_082041997.1|3532649_3533768_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_139048015.1|3533772_3534994_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	75.5	2.0e-117
3540491:3540514	attR	TTCAAATCCCCCCGGCTCCACCAA	NA	NA	NA	NA
