The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009788	Geobacter pickeringii strain G13 chromosome, complete genome	3618700	802266	811013	3618700	tRNA	uncultured_Mediterranean_phage(66.67%)	8	NA	NA
WP_084201332.1|802266_803391_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	30.7	2.7e-20
WP_039740606.1|803380_804412_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_039740607.1|804474_805587_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.1e-89
WP_039740608.1|805622_805949_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	47.0	1.3e-12
WP_039740610.1|806054_807656_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	25.5	2.1e-05
WP_039740612.1|807666_808575_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.8	6.5e-41
WP_039740614.1|808587_809184_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_039740616.1|809291_811013_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.2	5.5e-73
>prophage 2
NZ_CP009788	Geobacter pickeringii strain G13 chromosome, complete genome	3618700	1789113	1796219	3618700		Staphylococcus_phage(66.67%)	9	NA	NA
WP_039741978.1|1789113_1790571_-	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	45.2	2.5e-114
WP_039741980.1|1790681_1791227_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_179944517.1|1791239_1791677_+	peptide chain release factor-like protein	NA	NA	NA	NA	NA
WP_039745512.1|1791763_1792228_+	cytidine/deoxycytidylate deaminase family protein	NA	A0A1D8ESY8	Mycobacterium_phage	46.5	1.8e-23
WP_039741982.1|1792224_1792677_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_039745515.1|1792706_1793795_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.0	1.9e-47
WP_039741984.1|1793779_1794430_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	34.4	3.7e-30
WP_039741986.1|1794470_1795673_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.4	2.6e-101
WP_039741989.1|1795754_1796219_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.0	6.1e-35
>prophage 3
NZ_CP009788	Geobacter pickeringii strain G13 chromosome, complete genome	3618700	1880157	1887497	3618700	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_039742185.1|1880157_1880658_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.4	5.2e-32
WP_039742188.1|1880677_1881649_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	37.5	1.8e-36
WP_039742190.1|1881674_1882325_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	48.8	5.5e-34
WP_084201386.1|1882383_1883130_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	42.9	1.4e-52
WP_039742192.1|1883273_1883603_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039742194.1|1883646_1883922_-	integration host factor subunit alpha	NA	A0A1P8CWT5	Bacillus_phage	50.5	2.9e-16
WP_039742196.1|1884018_1886424_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_039742199.1|1886480_1887497_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	33.2	6.4e-29
>prophage 4
NZ_CP009788	Geobacter pickeringii strain G13 chromosome, complete genome	3618700	2110405	2176750	3618700	transposase,tRNA,integrase	Clostridium_phage(20.0%)	58	2137229:2137251	2178487:2178509
WP_039739717.1|2110405_2111491_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_039742578.1|2111928_2112375_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039742580.1|2112456_2112867_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_039742582.1|2112971_2114333_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_039742584.1|2114656_2116006_-	sigma-54-dependent Fis family transcriptional regulator	NA	W8CYM9	Bacillus_phage	32.4	8.3e-08
WP_039742586.1|2116002_2117832_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_039742588.1|2117854_2118706_-	amidohydrolase	NA	NA	NA	NA	NA
WP_039742590.1|2118857_2120201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039742592.1|2120896_2121667_-	cyclohexa-1,5-dienecarbonyl-CoA hydratase	NA	NA	NA	NA	NA
WP_039742593.1|2121698_2122772_-	6-hydroxycyclohex-1-ene-1-carbonyl-CoA dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.1	1.2e-14
WP_039742595.1|2122891_2123806_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_039742596.1|2123816_2124593_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_039742599.1|2124875_2126141_-	amidohydrolase	NA	NA	NA	NA	NA
WP_039742601.1|2126330_2128313_-	APC family permease	NA	NA	NA	NA	NA
WP_039742602.1|2128676_2129384_-	response regulator	NA	NA	NA	NA	NA
WP_039742605.1|2129438_2132102_-	sensor histidine kinase KdpD	NA	A0A1V0SGX0	Hokovirus	28.1	1.5e-13
WP_039742607.1|2132098_2132668_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_039742609.1|2132683_2134753_-	potassium-transporting ATPase subunit KdpB	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	23.9	4.4e-24
WP_039742612.1|2134754_2136539_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_039742614.1|2136641_2136854_-	hypothetical protein	NA	F5B3N7	Synechococcus_phage	36.5	3.0e-05
WP_039742616.1|2136979_2137180_+	hypothetical protein	NA	NA	NA	NA	NA
2137229:2137251	attL	TGGAGCGGGAAACGGGATTCGAA	NA	NA	NA	NA
WP_039745598.1|2137428_2137977_-	RNA 2'-phosphotransferase	NA	A0A0A8WJJ2	Clostridium_phage	48.5	3.0e-41
WP_158414172.1|2138059_2139067_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_039742620.1|2139375_2140062_+	serine/threonine protein phosphatase	NA	S5MD19	Sinorhizobium_phage	32.0	4.6e-23
WP_039742622.1|2140120_2140762_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_039745600.1|2140850_2141693_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_052263387.1|2141707_2142847_-	RNA ligase RtcB family protein	NA	A0A222ZNC0	Mycobacterium_phage	27.5	1.6e-20
WP_039742624.1|2143152_2143581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144400011.1|2144065_2145224_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_039742626.1|2145357_2145972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039742628.1|2145999_2146344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039742630.1|2146538_2147102_+	TrmH family RNA methyltransferase	NA	NA	NA	NA	NA
WP_039742632.1|2147595_2148567_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_039745606.1|2148563_2149298_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_039742635.1|2149554_2150829_-	Hsp70 family protein	NA	A0A2H4UVL6	Bodo_saltans_virus	26.3	1.9e-22
WP_144400080.1|2151502_2152000_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_039742638.1|2156324_2156630_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_084201405.1|2156610_2157531_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_039742639.1|2157632_2157875_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_039742642.1|2157859_2158195_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_084201406.1|2158310_2158988_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_039742645.1|2158977_2160015_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_039742648.1|2160048_2160735_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_039742650.1|2160731_2161220_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_039742652.1|2161216_2162791_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_084201408.1|2162787_2165349_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_039742654.1|2165452_2165971_-	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	39.6	9.2e-24
WP_039742656.1|2166018_2166981_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_039742658.1|2167539_2167830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144400011.1|2168226_2169385_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_039742662.1|2169519_2169813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039742664.1|2170038_2171676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144400081.1|2171679_2171976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144400082.1|2171989_2172211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039742666.1|2172821_2173445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158414173.1|2173437_2173587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039742669.1|2175025_2175874_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_039742671.1|2176006_2176750_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2178487:2178509	attR	TGGAGCGGGAAACGGGATTCGAA	NA	NA	NA	NA
