The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007773	Campylobacter subantarcticus LMG 24377 chromosome, complete genome	1852995	282118	291189	1852995		Synechococcus_phage(77.78%)	11	NA	NA
WP_043019409.1|282118_282514_+	HAD hydrolase family protein	NA	M4QRS4	Synechococcus_phage	46.0	1.6e-12
WP_043019410.1|282510_284049_+	capsular polysaccharide biosynthesis protein	NA	B2ZYD9	Ralstonia_phage	26.7	1.8e-38
WP_039662814.1|284045_284777_+	glycosyl transferase family 2	NA	A0A222YY90	Synechococcus_phage	28.5	4.8e-18
WP_043019411.1|284757_285390_+	hypothetical protein	NA	A0A2H4UUJ1	Bodo_saltans_virus	32.6	4.3e-15
WP_043020334.1|285413_286016_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	40.2	1.5e-33
WP_039662821.1|286016_286757_+	NTP transferase domain-containing protein	NA	A0A1D8KNV9	Synechococcus_phage	33.0	9.4e-30
WP_043019412.1|286737_287073_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_039662825.1|287075_287408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039664756.1|287403_288138_+	glycosyl transferase family 2	NA	A0A1D8KNV9	Synechococcus_phage	48.5	2.7e-53
WP_039662827.1|288124_289252_+	class I SAM-dependent methyltransferase	NA	M4QRS6	Synechococcus_phage	39.3	2.1e-60
WP_039662829.1|289245_291189_+	hypothetical protein	NA	E3SJ94	Synechococcus_phage	26.4	9.2e-08
>prophage 2
NZ_CP007773	Campylobacter subantarcticus LMG 24377 chromosome, complete genome	1852995	529768	540043	1852995		environmental_Halophage(16.67%)	10	NA	NA
WP_043019538.1|529768_531130_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	65.9	1.6e-38
WP_043019539.1|531148_531952_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.4	1.3e-45
WP_043019540.1|531963_532434_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.4	9.2e-31
WP_043019541.1|532435_532834_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_043019542.1|532830_533514_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_043019543.1|533526_533937_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_043019544.1|533954_535547_-	MCP-domain signal transduction protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.0	4.1e-06
WP_039663219.1|535562_537095_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	46.0	2.1e-39
WP_043019545.1|537095_537863_-	Dna-J like membrane chaperone protein	NA	NA	NA	NA	NA
WP_043019546.1|537865_540043_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.6	3.2e-142
>prophage 3
NZ_CP007773	Campylobacter subantarcticus LMG 24377 chromosome, complete genome	1852995	934386	981959	1852995	terminase,integrase,plate,tail,transposase	Campylobacter_phage(57.14%)	63	923294:923349	982191:982246
923294:923349	attL	CTCAAAATCTGGTAAGGGCAACCTTGTGTCGGTTCGAGTCCGACCTCGGGCACCAT	NA	NA	NA	NA
WP_039663861.1|934386_935016_+	hypothetical protein	NA	A7YG70	Campylobacter_phage	78.8	3.5e-49
WP_043019801.1|935073_935394_+	hypothetical protein	NA	A7YG71	Campylobacter_phage	85.8	2.2e-44
WP_039664819.1|935410_935605_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	71.4	1.8e-17
WP_043019802.1|935670_935958_+	ankyrin repeat domain-containing protein	NA	A7YGI8	Campylobacter_phage	77.9	6.9e-37
WP_039663867.1|935989_936802_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	88.5	5.9e-134
WP_043019803.1|936904_937387_-	virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	77.6	4.1e-66
WP_043019804.1|937390_939592_-|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	70.2	1.0e-249
WP_043019805.1|939633_939939_+	hypothetical protein	NA	A7YG88	Campylobacter_phage	88.7	8.4e-17
WP_039663876.1|940050_940290_-	Mu-like prophage protein gp41	NA	A7YGZ3	Campylobacter_phage	84.4	2.0e-21
WP_039663878.1|940331_940841_-|tail	phage contractile tail tube protein, P2 family	tail	A7YG76	Campylobacter_phage	86.4	2.0e-79
WP_043019806.1|940843_942034_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	72.7	2.9e-166
WP_043019807.1|942033_943296_-	hypothetical protein	NA	X2KLT6	Campylobacter_phage	37.0	7.0e-41
WP_043019808.1|943306_943663_-	DUF1353 domain-containing protein	NA	A7YGF6	Campylobacter_phage	64.1	8.8e-42
WP_043019809.1|943662_944175_-	DUF4376 domain-containing protein	NA	A7YGY7	Campylobacter_phage	54.4	2.8e-41
WP_039663893.1|945227_945848_-|tail	phage tail protein	tail	A7YH02	Campylobacter_phage	86.4	2.1e-51
WP_043019810.1|945844_947002_-|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	23.5	3.3e-13
WP_043019811.1|946998_947289_-|plate	baseplate assembly protein W	plate	Q8H9N4	Vibrio_phage	46.9	3.6e-09
WP_039663900.1|947285_947498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663902.1|947497_947995_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.8	1.6e-09
WP_039663905.1|947991_948306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019812.1|948385_948634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019813.1|948630_948966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019814.1|948975_949365_-	peptidase, M15 family	NA	A0A2I7QT07	Vibrio_phage	39.8	4.8e-17
WP_043019815.1|949514_949949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043019816.1|949950_950772_+	Mu-like prophage protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	1.7e-24
WP_043019817.1|950774_951287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043019818.1|951289_952267_+	hypothetical protein	NA	R9TRN2	Rhizobium_phage	22.8	5.6e-06
WP_043019819.1|952382_952841_+	DUF1320 family protein	NA	NA	NA	NA	NA
WP_039663924.1|952833_953316_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_043019820.1|953315_954986_+|terminase	phage terminase large subunit	terminase	A0A0A1IW02	Pseudomonas_phage	41.4	5.2e-92
WP_043019821.1|954995_956354_+	Mu-like prophage protein gp29	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.2	7.6e-17
WP_043019822.1|956355_957594_+	phage Mu protein F-like protein	NA	A0A0M4UTA3	Ralstonia_phage	28.0	3.1e-17
WP_039663934.1|957729_958104_+	phage protein U	NA	NA	NA	NA	NA
WP_039663936.1|958096_958288_+|tail	phage tail protein X	tail	NA	NA	NA	NA
WP_043019823.1|958281_959259_+|tail	phage tail protein D	tail	A0A1B2LRT8	Wolbachia_phage	23.2	2.1e-08
WP_043019824.1|959241_960090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019825.1|960061_960265_-	CJH_07325 family protein	NA	J9SI91	Campylobacter_phage	44.3	1.2e-06
WP_043019826.1|960377_960662_-	Mor transcription activator domain protein	NA	NA	NA	NA	NA
WP_043019828.1|961562_962036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019829.1|962093_962339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663960.1|962353_962620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019830.1|962673_962874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663961.1|962870_963356_-	host-nuclease inhibitor protein Gam	NA	NA	NA	NA	NA
WP_039663964.1|963464_963803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019831.1|963858_964044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019832.1|964040_964232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019833.1|964234_965158_-	AAA domain protein	NA	NA	NA	NA	NA
WP_043019834.1|965239_967300_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_039663976.1|967301_967502_-	Mu phage-associated protein	NA	NA	NA	NA	NA
WP_039663978.1|967646_968279_+	LexA family transcriptional regulator	NA	M5A9D2	Nitratiruptor_phage	45.2	1.1e-23
WP_039663980.1|968301_968895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019836.1|973536_974679_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_167333046.1|974675_975272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167333026.1|975419_975563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069107230.1|976716_977175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158336971.1|977250_977418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019838.1|977625_977961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002789000.1|978053_978323_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_043019839.1|978312_978534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019840.1|978772_979465_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043019841.1|979581_980505_+	AAA domain protein	NA	NA	NA	NA	NA
WP_167333027.1|980504_980783_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043019842.1|980828_981959_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	24.3	3.4e-15
982191:982246	attR	CTCAAAATCTGGTAAGGGCAACCTTGTGTCGGTTCGAGTCCGACCTCGGGCACCAT	NA	NA	NA	NA
>prophage 4
NZ_CP007773	Campylobacter subantarcticus LMG 24377 chromosome, complete genome	1852995	1191585	1200858	1852995	tRNA	Salmonella_phage(33.33%)	8	NA	NA
WP_039664162.1|1191585_1193964_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	36.0	2.9e-128
WP_039664163.1|1193975_1195355_-	MCP-domain energy taxis signal transduction protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.5	3.8e-16
WP_039664164.1|1195366_1195858_-	PAS sensor protein	NA	A0A1B0V854	Salmonella_phage	38.8	1.6e-17
WP_039664165.1|1195945_1196437_-	PAS sensor protein	NA	A0A1B0V854	Salmonella_phage	41.5	3.4e-20
WP_039664166.1|1196480_1197692_-	threonine ammonia-lyase	NA	A0A1W6JHY1	Lactococcus_phage	24.9	4.4e-08
WP_052243718.1|1197694_1198054_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_158336973.1|1198258_1198423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043019940.1|1199805_1200858_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	A0A2P1ELP3	Moumouvirus	29.1	3.9e-13
