The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007772	Campylobacter subantarcticus LMG 24374 chromosome, complete genome	1782536	297558	315180	1782536		Synechococcus_phage(62.5%)	19	NA	NA
WP_052242960.1|297558_298665_+	NAD-dependent epimerase/dehydratase family protein	NA	M4R1H4	Synechococcus_phage	40.9	1.1e-66
WP_052242961.1|298661_299759_+	GDP-L-fucose synthase	NA	M1HVW2	Paramecium_bursaria_Chlorella_virus	47.1	2.7e-81
WP_039662795.1|299802_300864_+	GDP-L-fucose synthase	NA	M4R1H4	Synechococcus_phage	48.1	1.7e-85
WP_039662797.1|300903_301935_+	GDP-mannose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	73.9	1.7e-146
WP_148308633.1|301937_302957_+	dehydrogenase	NA	A0A222YW25	Synechococcus_phage	38.4	4.4e-54
WP_039662802.1|302944_303550_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.8	3.5e-14
WP_039662804.1|303537_304212_+	NTP transferase domain-containing protein	NA	H9NC64	Sphingomonas_phage	27.0	3.3e-05
WP_039662807.1|304227_306057_+	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_039662809.1|306107_306503_+	HAD hydrolase family protein	NA	M4QRS4	Synechococcus_phage	45.0	2.1e-12
WP_039662811.1|306499_308038_+	capsular polysaccharide biosynthesis protein	NA	B2ZYD9	Ralstonia_phage	26.8	1.8e-38
WP_039662814.1|308034_308766_+	glycosyl transferase family 2	NA	A0A222YY90	Synechococcus_phage	28.5	4.8e-18
WP_039662816.1|308746_309382_+	hypothetical protein	NA	A0A2H4UUJ1	Bodo_saltans_virus	32.6	4.3e-15
WP_039662818.1|309374_310007_+	HAD family phosphatase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	42.8	8.9e-37
WP_039662821.1|310007_310748_+	NTP transferase domain-containing protein	NA	A0A1D8KNV9	Synechococcus_phage	33.0	9.4e-30
WP_039662823.1|310728_311064_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_039662825.1|311066_311399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039664756.1|311394_312129_+	glycosyl transferase family 2	NA	A0A1D8KNV9	Synechococcus_phage	48.5	2.7e-53
WP_039662827.1|312115_313243_+	methyltransferase domain-containing protein	NA	M4QRS6	Synechococcus_phage	39.3	2.1e-60
WP_039662829.1|313236_315180_+	hypothetical protein	NA	E3SJ94	Synechococcus_phage	26.4	9.2e-08
>prophage 2
NZ_CP007772	Campylobacter subantarcticus LMG 24374 chromosome, complete genome	1782536	552512	562792	1782536		environmental_Halophage(16.67%)	10	NA	NA
WP_039663205.1|552512_553874_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	65.9	1.2e-38
WP_039663208.1|553892_554696_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.4	3.9e-45
WP_012661257.1|554709_555180_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.4	9.2e-31
WP_039663210.1|555181_555580_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_039663212.1|555576_556260_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_039663215.1|556272_556686_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_039663217.1|556703_558296_-	MCP-domain signal transduction protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	50.0	4.1e-06
WP_039663219.1|558311_559844_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	46.0	2.1e-39
WP_039663222.1|559844_560612_-	Dna-J like membrane chaperone protein	NA	NA	NA	NA	NA
WP_039663224.1|560614_562792_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.9e-142
>prophage 3
NZ_CP007772	Campylobacter subantarcticus LMG 24374 chromosome, complete genome	1782536	937477	972378	1782536	plate,integrase,tail,transposase,terminase	Campylobacter_phage(60.0%)	51	929307:929357	974912:974962
929307:929357	attL	AAAAAACTAAAGGAAAAACAATGAAAACATTAGAAGATATCAAAGCTATGA	NA	NA	NA	NA
WP_039663861.1|937477_938107_+	hypothetical protein	NA	A7YG70	Campylobacter_phage	78.8	3.5e-49
WP_039663863.1|938164_938485_+	hypothetical protein	NA	A7YG71	Campylobacter_phage	86.8	5.8e-45
WP_039664819.1|938501_938696_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	71.4	1.8e-17
WP_039663865.1|938763_939051_+	hypothetical protein	NA	A7YG83	Campylobacter_phage	78.9	8.1e-38
WP_039663867.1|939087_939900_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	88.5	5.9e-134
WP_039663869.1|940002_940491_-	virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	77.6	3.7e-67
WP_039663871.1|940494_942696_-|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	70.3	7.9e-250
WP_039663873.1|942737_943043_+	hypothetical protein	NA	A7YG88	Campylobacter_phage	66.3	5.8e-18
WP_039663876.1|943154_943394_-	Mu-like prophage protein gp41	NA	A7YGZ3	Campylobacter_phage	84.4	2.0e-21
WP_039663878.1|943435_943945_-|tail	phage contractile tail tube protein, P2 family	tail	A7YG76	Campylobacter_phage	86.4	2.0e-79
WP_039663880.1|943947_945138_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	74.2	7.5e-170
WP_039663882.1|945137_946391_-	hypothetical protein	NA	X2KLT6	Campylobacter_phage	37.0	6.9e-41
WP_039663885.1|946401_946761_-	DUF1353 domain-containing protein	NA	A7YGF6	Campylobacter_phage	64.1	8.9e-42
WP_039663887.1|946757_948503_-	radical SAM domain protein	NA	NA	NA	NA	NA
WP_039663889.1|948502_949138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663891.1|949148_950039_-|tail	phage tail-collar fiber protein	tail	A7YGA7	Campylobacter_phage	84.7	3.6e-76
WP_039663893.1|950038_950659_-|tail	phage tail protein	tail	A7YH02	Campylobacter_phage	86.4	2.1e-51
WP_039663895.1|950655_951822_-|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	23.8	1.5e-13
WP_039663898.1|951818_952109_-|plate	baseplate assembly protein W	plate	Q8H9N4	Vibrio_phage	43.4	1.6e-09
WP_039663900.1|952105_952318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663902.1|952317_952815_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.8	1.6e-09
WP_039663905.1|952811_953126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663907.1|953205_953454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663908.1|953450_953786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663910.1|953795_954185_-	peptidase, M15 family	NA	I6R9L6	Nonlabens_phage	44.4	5.5e-21
WP_039663912.1|954334_954769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039663915.1|954770_955580_+	Mu-like prophage protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	31.2	9.0e-26
WP_039663917.1|955581_956121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039663919.1|956123_957101_+	hypothetical protein	NA	R9TRN2	Rhizobium_phage	23.4	5.6e-06
WP_039663921.1|957210_957630_+	DUF1320 family protein	NA	NA	NA	NA	NA
WP_039663924.1|957622_958105_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_039663926.1|958104_959769_+|terminase	phage terminase large subunit	terminase	A0A076FR23	Pseudomonas_phage	41.7	9.7e-91
WP_039663929.1|959778_961137_+	Mu-like prophage protein gp29	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.2	1.2e-14
WP_039663931.1|961138_962377_+	phage Mu protein F-like protein	NA	A0A0M4UTA3	Ralstonia_phage	29.6	1.8e-20
WP_039663934.1|962512_962887_+	phage protein U	NA	NA	NA	NA	NA
WP_039663936.1|962879_963071_+|tail	phage tail protein X	tail	NA	NA	NA	NA
WP_039663938.1|963064_964042_+|tail	phage tail protein D	tail	A0A1B2LRT8	Wolbachia_phage	23.6	7.1e-09
WP_039663941.1|964038_964557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663943.1|964549_964777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663946.1|964924_965209_-	Mor transcription activator domain protein	NA	NA	NA	NA	NA
WP_039663948.1|965304_965979_+	DNA-specific endonuclease I	NA	NA	NA	NA	NA
WP_039663951.1|965970_966246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663955.1|966713_967187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663958.1|967244_967490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663960.1|967504_967771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663961.1|967946_968432_-	host-nuclease inhibitor protein Gam	NA	NA	NA	NA	NA
WP_039663964.1|968541_968880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663967.1|968935_969121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663969.1|969117_969309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039663971.1|969311_970235_-	AAA domain protein	NA	NA	NA	NA	NA
WP_039663974.1|970317_972378_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
974912:974962	attR	AAAAAACTAAAGGAAAAACAATGAAAACATTAGAAGATATCAAAGCTATGA	NA	NA	NA	NA
>prophage 4
NZ_CP007772	Campylobacter subantarcticus LMG 24374 chromosome, complete genome	1782536	1109995	1119267	1782536	tRNA	Salmonella_phage(33.33%)	7	NA	NA
WP_039664162.1|1109995_1112374_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	36.0	2.9e-128
WP_039664163.1|1112385_1113765_-	MCP-domain energy taxis signal transduction protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.5	3.8e-16
WP_039664164.1|1113776_1114268_-	PAS sensor protein	NA	A0A1B0V854	Salmonella_phage	38.8	1.6e-17
WP_039664165.1|1114355_1114847_-	PAS sensor protein	NA	A0A1B0V854	Salmonella_phage	41.5	3.4e-20
WP_039664166.1|1114890_1116102_-	threonine ammonia-lyase	NA	A0A1W6JHY1	Lactococcus_phage	24.9	4.4e-08
WP_158336827.1|1116669_1116834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039664169.1|1118214_1119267_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	A0A0G2Y8K6	Acanthamoeba_polyphaga_mimivirus	28.6	3.0e-13
