assembly_id	genome_id	genome_def	crispr_array_locus_merge	crispr_array_location_merge	crispr_locus_id	crispr_pred_method	array_in_prot	prot_within_array_20000	prot_in_genome	crispr_type_by_cas_prot	consensus_repeat	repeat_length	self-targeting_spacer_number	self-targeting_target_number	spacer_location	protospacer_location	repeat_type	spacer_locus_num	spacer_num	correct_crispr_type	genome_cas_prots	unknown_protein_around_crispr	L10	L10_domain	L9	L9_domain	L8	L8_domain	L7	L7_domain	L6	L6_domain	L5	L5_domain	L4	L4_domain	L3	L3_domain	L2	L2_domain	L1	L1_domain	R1	R1_domain	R2	R2_domain	R3	R3_domain	R4	R4_domain	R5	R5_domain	R6	R6_domain	R7	R7_domain	R8	R8_domain	R9	R9_domain	R10	R10_domain
GCF_000815225.1_ASM81522v1	NZ_CP010427	Allofrancisella guangzhouensis strain 08HL01032 chromosome, complete genome	1	34385-34503	1	CRISPRCasFinder	no	csa3	csa3,DEDDh,RT,cas2,cas3	Type I-A	TCAGCCTCTGCTTTACGTTTAGCTTCTTCTTT	32	0	0	NA	NA	NA	1	1	Orphan	csa3,DEDDh,RT,cas2,cas3	NA|63aa|up_1|NZ_CP010427.1_32448_32637_-,NA|79aa|down_2|NZ_CP010427.1_36166_36403_+	NA|171aa|up_9|NZ_CP010427.1_26261_26774_+	pfam04345, Chor_lyase, Chorismate lyase	NA|285aa|up_8|NZ_CP010427.1_26767_27622_+	PRK12848, ubiA, 4-hydroxybenzoate octaprenyltransferase	NA|130aa|up_7|NZ_CP010427.1_27641_28031_+	COG2363, COG2363, Uncharacterized small membrane protein [Function unknown]	NA|253aa|up_6|NZ_CP010427.1_28183_28942_-	pfam01925, TauE, Sulfite exporter TauE/SafE	NA|207aa|up_5|NZ_CP010427.1_28952_29573_-	COG2964, COG2964, Uncharacterized protein conserved in bacteria [Function unknown]	NA|142aa|up_4|NZ_CP010427.1_29731_30157_+	pfam12092, DUF3568, Protein of unknown function (DUF3568)	NA|440aa|up_3|NZ_CP010427.1_30384_31704_-	PRK14862, rimO, 30S ribosomal protein S12 methylthiotransferase RimO	NA|215aa|up_2|NZ_CP010427.1_31779_32424_-	TIGR02802, Peptidoglycan-associated_lipoprotein, peptidoglycan-associated lipoprotein	NA|63aa|up_1|NZ_CP010427.1_32448_32637_-	NA	NA|436aa|up_0|NZ_CP010427.1_32646_33954_-	TIGR02800, Protein_TolB, tol-pal system beta propeller repeat protein TolB	NA|147aa|down_0|NZ_CP010427.1_34819_35260_-	TIGR02801, Protein_TolR, TolR protein	NA|240aa|down_1|NZ_CP010427.1_35272_35992_-	TIGR02796, Protein_TolQ, TolQ protein	NA|79aa|down_2|NZ_CP010427.1_36166_36403_+	NA	NA|267aa|down_3|NZ_CP010427.1_36416_37217_-	COG1183, PssA, Phosphatidylserine synthase [Lipid metabolism]	NA|121aa|down_4|NZ_CP010427.1_37229_37592_-	pfam07736, CM_1, Chorismate mutase type I	NA|318aa|down_5|NZ_CP010427.1_37595_38549_-	PRK01045, ispH, 4-hydroxy-3-methylbut-2-enyl diphosphate reductase; Reviewed	NA|155aa|down_6|NZ_CP010427.1_38529_38994_-	COG1047, SlpA, FKBP-type peptidyl-prolyl cis-trans isomerases 2 [Posttranslational modification, protein turnover, chaperones]	NA|611aa|down_7|NZ_CP010427.1_39097_40930_-	cd00200, WD40, WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide 11-24 residues from its N-terminus and the WD dipeptide at its C-terminus and is 40 residues long, hence the name WD40; between GH and WD lies a conserved core; serves as a stable propeller-like platform to which proteins can bind either stably or reversibly; forms a propeller-like structure with several blades where each blade is composed of a four-stranded anti-parallel b-sheet; instances with few detectable copies are hypothesized to form larger structures by dimerization; each WD40 sequence repeat forms the first three strands of one blade and the last strand in the next blade; the last C-terminal WD40 repeat completes the blade structure of the first WD40 repeat to create the closed ring propeller-structure; residues on the top and bottom surface of the propeller are proposed to coordinate interactions with other proteins and/or small ligands; 7 copies of the repeat are present in this alignment	NA|154aa|down_8|NZ_CP010427.1_41211_41673_+	pfam03703, bPH_2, Bacterial PH domain	NA|415aa|down_9|NZ_CP010427.1_41778_43023_+	cd07185, OmpA_C-like, Peptidoglycan binding domains similar to the C-terminal domain of outer-membrane protein OmpA
