The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010431	Pandoraea sputorum strain DSM 21091 chromosome, complete genome	5742997	2151970	2171958	5742997	plate,holin	Burkholderia_phage(41.18%)	22	NA	NA
WP_039402928.1|2151970_2152648_-	LexA family transcriptional regulator	NA	B5WZX5	Pseudomonas_phage	36.7	4.6e-15
WP_157127366.1|2152824_2153784_+	hypothetical protein	NA	A0A1J0MCP9	Streptomyces_phage	40.9	1.2e-16
WP_052252752.1|2153824_2154430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052252754.1|2154426_2155050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039397763.1|2155191_2155746_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	48.1	3.3e-43
WP_039397765.1|2155921_2157397_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	42.6	6.8e-96
WP_039397767.1|2157409_2157850_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	51.4	1.7e-34
WP_039397769.1|2157849_2158341_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	35.1	8.2e-14
WP_052252756.1|2158521_2160255_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	35.7	4.9e-37
WP_039397771.1|2160251_2160836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039397773.1|2160837_2161152_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	42.4	1.2e-15
WP_039397775.1|2161151_2162144_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	59.6	1.5e-86
WP_039397776.1|2162220_2162967_+	phage protein	NA	A9YX06	Burkholderia_phage	73.8	9.6e-99
WP_039397778.1|2162969_2163317_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	70.1	3.4e-38
WP_039397780.1|2163313_2164495_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	66.2	3.7e-137
WP_039397782.1|2164496_2165159_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	68.2	1.2e-87
WP_039397783.1|2166220_2166412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039397785.1|2166493_2166787_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	52.8	1.3e-19
WP_039397787.1|2166854_2167331_+	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	60.4	1.3e-48
WP_039397789.1|2167330_2167816_+	DUF2514 family protein	NA	U6C7Z8	Ralstonia_phage	40.4	3.5e-09
WP_039397791.1|2168001_2168259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039397793.1|2170269_2171958_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	33.9	5.6e-62
>prophage 2
NZ_CP010431	Pandoraea sputorum strain DSM 21091 chromosome, complete genome	5742997	5254217	5290302	5742997	plate,integrase,holin,capsid,terminase,portal,tail,head,protease	Burkholderia_phage(40.0%)	45	5251286:5251331	5289648:5289693
5251286:5251331	attL	TTGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAA	NA	NA	NA	NA
WP_084104315.1|5254217_5255204_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	36.0	1.5e-43
WP_052253127.1|5255926_5256946_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	73.5	3.8e-138
WP_052253128.1|5256990_5258760_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	67.5	3.9e-231
WP_039393526.1|5258902_5259790_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S5NPS0	Burkholderia_phage	46.8	1.5e-53
WP_039393528.1|5259838_5260849_+|capsid	phage major capsid protein, P2 family	capsid	E5FFI6	Burkholderia_phage	66.4	5.3e-132
WP_039393530.1|5260851_5261538_+	hypothetical protein	NA	A0A077K804	Ralstonia_phage	48.8	9.9e-50
WP_039393532.1|5261637_5262120_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	48.6	5.2e-29
WP_039393533.1|5262119_5262323_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	64.2	1.3e-18
WP_039393536.1|5262325_5262700_+	membrane protein	NA	E5E3R9	Burkholderia_phage	60.5	1.2e-28
WP_039393537.1|5262696_5263020_+|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	50.5	8.9e-17
WP_039393539.1|5263003_5263819_+	N-acetylmuramidase family protein	NA	E5E3R7	Burkholderia_phage	62.6	3.3e-84
WP_039393540.1|5263815_5264325_+	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	49.0	2.7e-28
WP_039393541.1|5264321_5264774_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	40.4	1.7e-26
WP_039393542.1|5264773_5265223_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	60.8	1.3e-42
WP_157127448.1|5265228_5266080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039393547.1|5266224_5266860_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	45.4	7.8e-41
WP_039393548.1|5266856_5267228_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	50.0	3.3e-23
WP_052252346.1|5267224_5268181_+|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	53.2	3.1e-73
WP_039393550.1|5268177_5268792_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	64.5	1.6e-62
WP_039393552.1|5270885_5271242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039393554.1|5271244_5272240_-|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	35.9	1.6e-32
WP_084104088.1|5272615_5272807_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	74.1	6.8e-17
WP_095178489.1|5272847_5273513_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	65.8	1.2e-84
WP_039393558.1|5273629_5274808_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	71.9	6.5e-166
WP_039393560.1|5274832_5275345_+|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	57.6	2.3e-51
WP_095178490.1|5275405_5275723_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	55.6	5.3e-22
WP_125347820.1|5275680_5275824_+|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	60.5	4.3e-08
WP_039393562.1|5275820_5278481_+	hypothetical protein	NA	A4PE52	Ralstonia_virus	52.9	4.3e-234
WP_072633367.1|5278491_5279130_+|tail	phage tail protein	tail	E5E3P8	Burkholderia_phage	57.0	5.6e-39
WP_095178491.1|5279177_5280335_+	phage late control D family protein	NA	E5E3P7	Burkholderia_phage	54.6	8.8e-99
WP_052253129.1|5280382_5281513_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_052252350.1|5281569_5282295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039393564.1|5282353_5282773_-	helix-turn-helix domain-containing protein	NA	A4JWR8	Burkholderia_virus	51.8	2.0e-29
WP_039393565.1|5282821_5283109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039401584.1|5283131_5283323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039393568.1|5283351_5283546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039393570.1|5283542_5283803_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	54.9	2.2e-18
WP_157127450.1|5283901_5284117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157127453.1|5284270_5284531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157127454.1|5284543_5285209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039393576.1|5285348_5285597_+	hypothetical protein	NA	I6NMK4	Burkholderia_virus	46.4	4.3e-11
WP_039393578.1|5285608_5288320_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	55.5	7.7e-287
WP_072633368.1|5288289_5288544_+	DUF4224 domain-containing protein	NA	E5E3T1	Burkholderia_phage	65.4	5.0e-15
WP_039393580.1|5288544_5289573_+|integrase	tyrosine-type recombinase/integrase	integrase	E5E3T0	Burkholderia_phage	63.5	5.0e-122
WP_039393581.1|5289843_5290302_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	43.3	2.2e-21
5289648:5289693	attR	TTGGTGCCGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAA	NA	NA	NA	NA
