The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010376	Enterobacter hormaechei subsp. steigerwaltii strain 34977 chromosome, complete genome	4897485	1183963	1231596	4897485	tail,terminase,head,integrase,holin	Enterobacteria_phage(21.82%)	72	1183904:1183950	1231938:1231984
1183904:1183950	attL	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
WP_040117279.1|1183963_1185127_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.0	2.0e-228
WP_071887069.1|1185003_1185339_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040117280.1|1185347_1185548_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	84.8	2.0e-27
WP_040117281.1|1185739_1185970_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	94.7	7.4e-34
WP_040117282.1|1185978_1186218_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	6.3e-28
WP_052686657.1|1186195_1186894_-	hypothetical protein	NA	R9VWB9	Serratia_phage	43.2	3.6e-39
WP_040117284.1|1186908_1187127_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	2.7e-17
WP_040117285.1|1187221_1187530_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	65.6	4.0e-35
WP_023300422.1|1187526_1187745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040117286.1|1187741_1188293_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.7	1.8e-54
WP_040117287.1|1188453_1188882_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	93.0	3.2e-70
WP_040117288.1|1188878_1189502_-	YqaJ-like viral recombinase	NA	S0A2A9	Cellulophaga_phage	49.5	9.3e-47
WP_162184608.1|1189498_1189807_-	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	33.3	3.8e-09
WP_040117289.1|1190013_1190298_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	97.9	3.5e-49
WP_040117290.1|1190369_1190567_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040117291.1|1190844_1191063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040118278.1|1191470_1191680_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	78.1	1.2e-19
WP_040117292.1|1191719_1192100_-	lipoprotein	NA	NA	NA	NA	NA
WP_040118279.1|1192147_1192852_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	79.1	1.6e-103
WP_040117293.1|1192963_1193191_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	70.4	1.5e-23
WP_040117294.1|1193220_1193766_+	hypothetical protein	NA	G8C7U3	Escherichia_phage	98.9	4.3e-96
WP_017383042.1|1193950_1194886_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	90.7	4.9e-76
WP_040117295.1|1194882_1195572_+	phage replication protein P	NA	G8C7U6	Escherichia_phage	95.2	5.5e-125
WP_040117296.1|1195573_1195918_+	winged helix-turn-helix transcriptional regulator	NA	K7PHG5	Enterobacteria_phage	96.5	3.6e-56
WP_040117297.1|1195914_1196163_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040117298.1|1196159_1196456_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	62.0	3.5e-28
WP_022651090.1|1196452_1196656_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_040117299.1|1196652_1196949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024242389.1|1197620_1197947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514173.1|1197946_1198201_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.0	2.3e-28
WP_001514174.1|1198217_1198478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032634774.1|1198997_1199453_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_040117301.1|1199452_1199623_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	90.6	3.8e-19
WP_015964709.1|1199615_1199906_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	6.3e-46
WP_040117302.1|1200374_1201064_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	4.2e-56
WP_040117303.1|1201253_1201496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514183.1|1201930_1202332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|1202328_1202604_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_040117304.1|1202607_1203084_+	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	79.4	3.0e-69
WP_040117305.1|1203080_1203467_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	36.4	1.2e-12
WP_040117307.1|1203890_1204409_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	96.5	5.1e-91
WP_131631759.1|1204457_1204739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117308.1|1204854_1205073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117310.1|1205238_1205658_+|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	86.9	7.9e-58
WP_040117311.1|1205654_1206902_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.0	2.0e-213
WP_040117312.1|1206975_1207164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158003163.1|1207234_1207411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117313.1|1207421_1208771_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	85.7	4.0e-228
WP_040117314.1|1208730_1209657_+|head	SPP1 gp7 family phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.5	1.5e-162
WP_040117315.1|1209659_1210925_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	91.9	3.1e-222
WP_040117316.1|1210937_1211387_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	8.4e-66
WP_040117317.1|1211404_1212481_+	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	87.2	6.3e-184
WP_040117318.1|1212490_1212784_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	90.7	4.5e-44
WP_023300381.1|1212845_1213247_+	glycoprotein	NA	A0A1V0E5R0	Salmonella_phage	81.5	7.1e-56
WP_023300380.1|1213246_1213420_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	5.1e-11
WP_040117319.1|1213419_1213770_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	63.5	9.9e-38
WP_040117320.1|1213772_1214237_+	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	44.8	2.0e-30
WP_040117321.1|1214233_1214617_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.8	5.2e-40
WP_040117322.1|1214680_1215424_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	86.0	6.5e-71
WP_040117323.1|1215481_1216153_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	50.0	1.2e-55
WP_045336471.1|1216331_1216964_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	36.9	1.4e-18
WP_040117324.1|1217021_1219952_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	42.7	9.2e-137
WP_040117325.1|1219962_1220190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117326.1|1220728_1221199_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	93.6	2.4e-79
WP_040117327.1|1221212_1221578_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.8	7.1e-63
WP_040117328.1|1221564_1224042_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.6	0.0e+00
WP_071887071.1|1226552_1227965_-	hypothetical protein	NA	A8CG94	Salmonella_phage	25.6	2.9e-11
WP_040117331.1|1227961_1228885_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.1	5.6e-157
WP_040117332.1|1228881_1229244_-	GtrA family protein	NA	U5P0S6	Shigella_phage	82.5	9.9e-49
WP_040117333.1|1229356_1229662_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	43.6	6.0e-15
WP_040117334.1|1229663_1230932_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.5	9.0e-230
WP_040117335.1|1230924_1231596_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	3.7e-81
1231938:1231984	attR	CTTCTAAGCCGTAGGTCGTAGGTTCGAATCCTACAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 2
NZ_CP010376	Enterobacter hormaechei subsp. steigerwaltii strain 34977 chromosome, complete genome	4897485	1871425	1931813	4897485	tail,terminase,integrase,holin,portal,head,capsid,tRNA	Enterobacterial_phage(32.0%)	79	1883066:1883081	1906337:1906352
WP_032103856.1|1871425_1872538_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_032619915.1|1872578_1873052_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017693618.1|1873051_1873714_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|1873831_1875082_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_040117504.1|1875157_1875403_+	YmjA family protein	NA	NA	NA	NA	NA
WP_023296321.1|1875407_1876907_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_071524166.1|1877031_1877124_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|1877493_1877742_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|1877795_1877870_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|1877870_1877969_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_040117505.1|1878014_1879043_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.6	3.2e-12
WP_015570791.1|1879354_1879609_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_015570790.1|1879689_1879995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570789.1|1879995_1880340_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_040117506.1|1880491_1881199_+	CTP synthase	NA	NA	NA	NA	NA
WP_040117507.1|1881230_1882418_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_017384695.1|1882517_1883309_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1883066:1883081	attL	TGCCATGAGCGAACGC	NA	NA	NA	NA
WP_003857881.1|1883292_1883739_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_040117508.1|1883845_1885882_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_045336308.1|1885897_1887229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040117509.1|1887637_1888138_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032103854.1|1888357_1889500_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.3	6.4e-94
WP_071887073.1|1889474_1889738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040117510.1|1890119_1890902_-	DUF551 domain-containing protein	NA	M9NZE4	Enterobacteria_phage	45.8	5.1e-26
WP_040117511.1|1890905_1891115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052686656.1|1891117_1891708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040117512.1|1891704_1891938_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	47.7	1.8e-11
WP_131631755.1|1891934_1892531_-	hypothetical protein	NA	K7P6H6	Enterobacteria_phage	96.5	9.0e-39
WP_065186935.1|1892517_1893543_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	90.7	7.1e-169
WP_040118292.1|1893539_1893953_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	85.3	8.1e-55
WP_040117514.1|1894649_1895369_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	62.1	2.6e-77
WP_023305900.1|1895467_1895686_+	hypothetical protein	NA	A0A2K8HL98	Pseudomonas_phage	60.3	4.9e-11
WP_032634711.1|1895727_1896198_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
WP_063945205.1|1896438_1896618_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	5.1e-14
WP_040117516.1|1896607_1897486_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	82.6	3.1e-40
WP_040117517.1|1897482_1897977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117518.1|1897976_1898636_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.9	7.2e-98
WP_040117519.1|1898632_1898860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117520.1|1898856_1899177_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.4	5.5e-43
WP_040117521.1|1899173_1899563_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	88.1	8.4e-62
WP_080338061.1|1899578_1900304_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.2	2.2e-55
WP_040117522.1|1900300_1901290_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	84.5	1.6e-165
WP_040118294.1|1901304_1901670_+	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	95.8	9.6e-60
WP_040117523.1|1901707_1902484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648767.1|1902671_1903067_+	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_022648766.1|1903053_1903335_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
WP_040117524.1|1903334_1903961_+	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	92.8	1.0e-109
WP_040117525.1|1903968_1904244_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.2	1.2e-25
WP_162230615.1|1904212_1904371_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.2	2.3e-18
WP_032622383.1|1904428_1905022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040117527.1|1905091_1906549_+	glycosyltransferase family 2 protein	NA	S4TSQ9	Salmonella_phage	89.1	2.9e-264
1906337:1906352	attR	GCGTTCGCTCATGGCA	NA	NA	NA	NA
WP_040117528.1|1906560_1906896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117529.1|1906849_1907107_-	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	97.5	1.1e-33
WP_040118295.1|1907272_1907866_+	hypothetical protein	NA	S4TR53	Salmonella_phage	79.2	8.8e-95
WP_040117530.1|1907858_1908227_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	89.3	4.5e-57
WP_040117531.1|1908332_1908827_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	99.4	8.4e-83
WP_100134848.1|1908823_1910485_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	98.2	0.0e+00
WP_040117533.1|1910543_1912478_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.2	0.0e+00
WP_040117534.1|1912681_1914043_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	93.2	2.1e-245
WP_040117535.1|1914039_1915083_+|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	84.1	2.4e-103
WP_040117536.1|1915079_1915406_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	88.9	2.9e-47
WP_040117537.1|1915414_1915765_+|head	phage head closure protein	head	S4TND9	Salmonella_phage	83.6	1.4e-47
WP_040117538.1|1915761_1916211_+	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	99.3	2.2e-74
WP_023337468.1|1916207_1916555_+	DUF3168 domain-containing protein	NA	K7PM93	Enterobacterial_phage	80.7	1.4e-47
WP_040117539.1|1916728_1917259_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	85.7	8.4e-81
WP_040117540.1|1917386_1917830_+	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	1.5e-70
WP_040117541.1|1917838_1918222_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	7.4e-63
WP_023305929.1|1918230_1918509_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	8.1e-43
WP_032648715.1|1918555_1918921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040117542.1|1918982_1922474_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	85.6	0.0e+00
WP_022650857.1|1922476_1922815_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	60.7	1.1e-38
WP_040117543.1|1922811_1923570_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	7.8e-96
WP_022648880.1|1923572_1924283_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_032648711.1|1924282_1924870_+|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.4	6.1e-48
WP_040117544.1|1924922_1928804_+|tail	phage tail protein	tail	Q9MCR7	Enterobacteria_phage	58.3	0.0e+00
WP_040117545.1|1928805_1929771_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.9	2.2e-58
WP_040117546.1|1929830_1931171_+	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	56.7	4.8e-125
WP_154232874.1|1931265_1931505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650865.1|1931492_1931813_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.8	1.0e-25
>prophage 3
NZ_CP010376	Enterobacter hormaechei subsp. steigerwaltii strain 34977 chromosome, complete genome	4897485	3383369	3419266	4897485	terminase,tail,integrase	Salmonella_phage(32.43%)	41	3385532:3385547	3428778:3428793
WP_040117941.1|3383369_3385844_-	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.5	0.0e+00
3385532:3385547	attL	TGCGGTTAAGCGCTTC	NA	NA	NA	NA
WP_040117942.1|3385847_3387650_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	74.5	5.9e-243
WP_040117943.1|3387646_3390157_-	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	83.9	0.0e+00
WP_040117944.1|3390169_3390709_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	73.3	3.4e-61
WP_040117945.1|3390708_3391173_-	hypothetical protein	NA	T1SA73	Salmonella_phage	90.9	1.4e-79
WP_040117946.1|3391172_3393650_-	hypothetical protein	NA	Q858G3	Salmonella_phage	95.5	0.0e+00
WP_040117947.1|3393649_3394255_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	86.6	3.2e-100
WP_040117948.1|3394254_3394578_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	71.8	1.3e-36
WP_032634950.1|3394629_3394995_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	68.6	2.2e-35
WP_032634949.1|3394999_3395440_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	90.4	1.8e-65
WP_040117949.1|3395491_3396478_-	phage protein	NA	G9L6C5	Escherichia_phage	86.9	1.5e-163
WP_040117950.1|3396495_3397182_-	peptidase	NA	G9L6C4	Escherichia_phage	87.0	5.1e-78
WP_045336058.1|3397193_3397517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040117951.1|3397513_3397813_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	69.8	1.0e-30
WP_040117952.1|3397809_3399480_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	95.0	7.2e-304
WP_032636549.1|3399494_3399701_-	hypothetical protein	NA	T1SA67	Salmonella_phage	95.6	1.3e-08
WP_040117953.1|3400672_3400942_+	hypothetical protein	NA	A0A248SKZ7	Klebsiella_phage	47.0	1.0e-10
WP_040117954.1|3400985_3402461_-	hypothetical protein	NA	Q858H3	Salmonella_phage	99.0	3.2e-295
WP_131631750.1|3402457_3403054_-|terminase	terminase small subunit	terminase	A0A193GYG6	Enterobacter_phage	92.9	5.5e-97
WP_040117956.1|3403110_3403440_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.8	1.3e-28
WP_040117957.1|3403517_3403856_-	hypothetical protein	NA	Q858C6	Salmonella_phage	82.1	3.0e-47
WP_040117960.1|3404414_3404687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052686648.1|3405723_3406272_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_131631748.1|3406552_3407011_-	hypothetical protein	NA	T1SBJ7	Salmonella_phage	47.1	1.3e-21
WP_040117962.1|3407079_3407544_-	crossover junction endodeoxyribonuclease	NA	A0A193GYM2	Enterobacter_phage	96.1	9.0e-79
WP_040117963.1|3407661_3408447_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	2.2e-133
WP_040117964.1|3408443_3409220_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	66.4	2.3e-87
WP_023242720.1|3409219_3409429_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	73.9	6.3e-24
WP_032634928.1|3409578_3409809_-	hypothetical protein	NA	A0A193GYK6	Enterobacter_phage	84.0	1.5e-31
WP_040117965.1|3409963_3410554_+	transcriptional regulator	NA	G9L6A6	Escherichia_phage	75.5	6.1e-80
WP_040117966.1|3410851_3411151_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	53.5	8.8e-19
WP_040117967.1|3411147_3412047_+	endonuclease	NA	Q858E0	Salmonella_phage	95.0	1.5e-162
WP_040117968.1|3412056_3413079_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	97.4	6.0e-184
WP_032634922.1|3413127_3413376_+	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	79.3	1.2e-32
WP_040117969.1|3413484_3413784_+	PerC family transcriptional regulator	NA	A0A2R9YJK3	Escherichia_phage	73.7	1.1e-34
WP_032634920.1|3413776_3413935_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	2.8e-16
WP_040117970.1|3413931_3414123_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	76.3	8.9e-17
WP_040117971.1|3414119_3414713_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.9	6.7e-111
WP_040117972.1|3414709_3415963_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	88.9	8.0e-215
WP_006811514.1|3416154_3417732_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_040117973.1|3417799_3419266_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	6.1e-89
3428778:3428793	attR	GAAGCGCTTAACCGCA	NA	NA	NA	NA
>prophage 4
NZ_CP010376	Enterobacter hormaechei subsp. steigerwaltii strain 34977 chromosome, complete genome	4897485	3904090	3957898	4897485	integrase,transposase,tRNA,protease	Burkholderia_phage(25.0%)	60	3953854:3953869	3957950:3957965
WP_015571833.1|3904090_3904588_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_003860034.1|3904682_3905390_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_017692692.1|3905441_3906173_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_015571835.1|3906204_3907152_+	glutathione synthase	NA	NA	NA	NA	NA
WP_006811924.1|3907226_3907787_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_033487645.1|3907786_3908203_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017692691.1|3908212_3909193_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_040118082.1|3909210_3909912_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015571838.1|3909933_3910500_+	YggT family protein	NA	NA	NA	NA	NA
WP_023304404.1|3910496_3910793_+	YggU family protein	NA	NA	NA	NA	NA
WP_040118083.1|3910796_3911390_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_017382926.1|3911382_3912531_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_023304405.1|3912587_3912926_+	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_023304406.1|3913009_3913726_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_023304407.1|3913783_3914110_-	YggL family protein	NA	NA	NA	NA	NA
WP_015571843.1|3914109_3914829_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_032649487.1|3914967_3916026_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003862425.1|3916052_3916325_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017382930.1|3916449_3917526_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_015571846.1|3917797_3919054_+	nucleoside permease	NA	NA	NA	NA	NA
WP_040118084.1|3919132_3919936_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_040118085.1|3919913_3920453_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_023304410.1|3920449_3921973_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_023306921.1|3921983_3922859_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_040118086.1|3922855_3923149_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_015571850.1|3923165_3924188_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_015571851.1|3924201_3925065_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_015571852.1|3925082_3926444_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_017382937.1|3926789_3928427_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015571854.1|3928416_3929109_+	response regulator	NA	NA	NA	NA	NA
WP_040118319.1|3929185_3931324_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_017692680.1|3931505_3932219_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_004115409.1|3932585_3933617_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_004115412.1|3933676_3935296_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004115414.1|3935362_3936838_-	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	31.5	2.6e-47
WP_004115417.1|3936998_3938384_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_025760278.1|3939240_3939492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742914.1|3939566_3941000_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.5	1.1e-103
WP_025760317.1|3941041_3942241_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	39.1	1.1e-32
WP_077254457.1|3942376_3942973_-	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	26.6	2.8e-08
WP_053287147.1|3942968_3943196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053287146.1|3943212_3943938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032742913.1|3944028_3944961_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_025760314.1|3944957_3945476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025760313.1|3945483_3946449_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001515173.1|3946631_3946955_+	helix-turn-helix transcriptional regulator	NA	F8TVE5	EBPR_siphovirus	41.7	7.5e-08
WP_025760312.1|3946957_3947824_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000427623.1|3948318_3949323_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|3949401_3949959_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|3949952_3950324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|3950320_3950821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|3950817_3951144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|3951398_3951755_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|3951744_3952146_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|3952142_3952433_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_032742911.1|3952741_3953722_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	2.0e-184
3953854:3953869	attL	CTTATTCGCACCTTCC	NA	NA	NA	NA
WP_040118087.1|3953894_3954254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049101629.1|3954509_3954734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032742891.1|3954910_3955810_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_004115425.1|3956917_3957898_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	79.1	1.6e-149
3957950:3957965	attR	CTTATTCGCACCTTCC	NA	NA	NA	NA
>prophage 1
NZ_CP012170	Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence	263138	2179	37701	263138	integrase,transposase,protease	Acinetobacter_phage(22.22%)	38	1048:1059	7099:7110
1048:1059	attL	CACGCTGATGCG	NA	NA	NA	NA
WP_000795949.1|2179_3355_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|3524_3737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|4097_5180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284318.1|5345_6845_-	kinase	NA	NA	NA	NA	NA
WP_000081059.1|6870_8508_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
7099:7110	attR	CACGCTGATGCG	NA	NA	NA	NA
WP_001253656.1|8507_9548_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|9632_10271_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|10270_10912_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|10934_11573_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|12035_12503_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|12520_13729_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|13739_14696_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|14695_15775_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|15776_16550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|16542_17685_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|17694_18753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254137.1|19073_19655_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|19654_20812_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|20834_21290_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|21312_22353_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|22401_22980_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|23048_23624_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|24052_25294_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_001067855.1|25403_26108_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000252081.1|26417_27311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|27482_27713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071366.1|27891_28212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165367.1|28728_29040_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001371932.1|29044_29536_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000781547.1|30088_30292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|30346_30571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|30610_30811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|31033_31345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|31720_32002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137794.1|32218_32824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949440.1|33156_34525_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000589001.1|34700_36041_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000219087.1|36462_37701_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
>prophage 2
NZ_CP012170	Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence	263138	80856	100188	263138	transposase	uncultured_Caudovirales_phage(54.55%)	22	NA	NA
WP_100185530.1|80856_81771_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.4	3.6e-172
WP_000900745.1|81936_82254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371904.1|82304_82712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000285959.1|83169_83841_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_001100610.1|83885_84191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785965.1|84213_84531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|84744_86148_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|86176_86809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072034961.1|86883_87285_+|transposase	IS5/IS1182 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	2.9e-65
WP_013815099.1|87286_88255_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_012695470.1|88415_89231_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	7.4e-161
WP_012695469.1|89367_90261_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021243026.1|90454_91612_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_012695467.1|91689_92274_+	MFS transporter	NA	NA	NA	NA	NA
WP_022652343.1|92295_93264_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_000125668.1|93483_94887_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|94919_95624_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|95710_96031_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|96076_97366_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|97378_97804_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|97863_98691_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|98709_100188_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
>prophage 3
NZ_CP012170	Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-263.138kb, complete sequence	263138	114169	168862	263138	transposase,integrase,protease	Escherichia_phage(33.33%)	55	137351:137410	159035:160392
WP_072196614.1|114169_115138_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_001572373.1|115326_116946_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|117022_117499_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|117664_118369_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000057569.1|118824_119166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248792.1|119180_119972_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_000480968.1|120152_120989_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|120988_121792_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000845039.1|121949_122963_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_048228299.1|122949_123555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019304.1|123565_124135_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_002008781.1|124134_124635_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000050481.1|124900_126442_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|126846_127686_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_012695489.1|128176_128821_+	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_003833285.1|128862_129315_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_000050481.1|130621_132163_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|132567_133407_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|133400_133748_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|133911_134703_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845048.1|134848_135862_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001173919.1|136204_136780_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.7	5.6e-46
WP_011191340.1|136906_137155_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
137351:137410	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|137413_138118_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|138123_138264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|138910_139924_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_012695484.1|140086_140668_+	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_006473457.1|141155_142511_+|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_012695485.1|142752_143562_+	AAC(3)-II family aminoglycoside N-acetyltransferase	NA	O64018	Bacillus_phage	29.3	1.2e-17
WP_012695486.1|143689_144103_+	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_012695487.1|144465_144897_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000679427.1|146206_146554_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|146547_147387_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|147514_148015_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|148090_148795_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138070.1|148915_151882_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|151960_152965_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|153146_153323_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|153652_154468_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|154554_154857_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|154750_155002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|155032_156526_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|156736_156961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|156957_157695_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|158180_158321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|158326_159031_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002904004.1|159167_160028_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|160048_160810_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
159035:160392	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAACGCCGGGTTATTCTTATTTGTCGCTTCTTTACTCGCCTTTATCGGCCTTCACTCAAGGATGTATTGTGGTTATGCGTTATATTCGCCTGTGTATTATCTCCCTGTTAGCCACCCTGCCGCTGGCGGTACACGCCAGCCCGCAGCCGCTTGAGCAAATTAAACAAAGCGAAAGCCAGCTGTCGGGCCGCGTAGGCATGATAGAAATGGATCTGGCCAGCGGCCGCACGCTGACCGCCTGGCGCGCCGATGAACGCTTTCCCATGATGAGCACCTTTAAAGTAGTGCTCTGCGGCGCAGTGCTGGCGCGGGTGGATGCCGGTGACGAACAGCTGGAGCGAAAGATCCACTATCGCCAGCAGGATCTGGTGGACTACTCGCCGGTCAGCGAAAAACACCTTGCCGACGGCATGACGGTCGGCGAACTCTGCGCCGCCGCCATTACCATGAGCGATAACAGCGCCGCCAATCTGCTGCTGGCCACCGTCGGCGGCCCCGCAGGATTGACTGCCTTTTTGCGCCAGATCGGCGACAACGTCACCCGCCTTGACCGCTGGGAAACGGAACTGAATGAGGCGCTTCCCGGCGACGCCCGCGACACCACTACCCCGGCCAGCATGGCCGCGACCCTGCGCAAGCTGCTGACCAGCCAGCGTCTGAGCGCCCGTTCGCAACGGCAGCTGCTGCAGTGGATGGTGGACGATCGGGTCGCCGGACCGTTGATCCGCTCCGTGCTGCCGGCGGGCTGGTTTATCGCCGATAAGACCGGAGCTAGCAAGCGGGGTGCGCGCGGGATTGTCGCCCTGCTTGGCCCGAATAACAAAGCAGAGCGCATTGTGGTGATTTATCTGCGGGATACGCCGGCGAGCATGGCCGAGCGAAATCAGCAAATCGCCGGGATCGGCGCGGCGCTGATCGAGCACTGGCAACGCTAAGCCGGCGGTGGCCGCGCGCGTTATCCGGCCCGCAGCACCTCGCAGGCGTGCCGGGCGATATGACTGGCGGCGGCATCGGAAAGATGCCGGTCGGTAATGATGGTGGTGAACCGGGTCAAAGGTAACGCCATAAACGTGGCCACCTGATTGTATTTCGAACTGTCGCACAGCAGGATGCTTCTCGCGCTGACCTGGCTGACGGTCTCCTTGACGGTAACCTTGTTCTCATCAGGGGTGAATATCCCGCGACTGTCCCAGCCGCTGGCGGAGATAAAGGCCGTATCGATAGCCAGGTGGCGTAACGTACGCGCCGCCGATTCGCCCACGCAGGAGCGGTTCTCCCGGCACAGAGTGCCGCCGGTGT	NA	NA	NA	NA
WP_002903955.1|161071_161974_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_001067855.1|163607_164312_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000159617.1|164827_165022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|165018_165330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|165392_165632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|167447_167777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072223036.1|167893_168862_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.8e-185
>prophage 1
NZ_CP010374	Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-43.621kb, complete sequence	43621	0	4710	43621		Bacillus_phage(100.0%)	2	NA	NA
WP_043053774.1|3672_4023_-	trbM family protein	NA	NA	NA	NA	NA
WP_032420226.1|4023_4710_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	53.1	4.6e-23
>prophage 2
NZ_CP010374	Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-43.621kb, complete sequence	43621	21297	27662	43621	integrase	Pseudomonas_phage(20.0%)	10	22344:22372	26314:26342
WP_032420263.1|21297_21663_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	3.7e-11
WP_002353166.1|21898_22267_-	hypothetical protein	NA	NA	NA	NA	NA
22344:22372	attL	GTGCGTTTCAACCGGGTATAGCGCACGTT	NA	NA	NA	NA
WP_032420243.1|22666_23131_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	41.5	9.5e-20
WP_002353172.1|23228_23477_+	post-segregation antitoxin CcdA family protein	NA	NA	NA	NA	NA
WP_002353175.1|23476_23800_+	CcdB family protein	NA	NA	NA	NA	NA
WP_002353195.1|23961_24153_+	ribbon-helix-helix domain-containing protein	NA	A0A0A7RUX5	Clostridium_phage	55.6	7.8e-05
WP_002353184.1|24403_24793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032420248.1|25406_26174_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	42.7	2.0e-14
WP_020316843.1|26409_26853_+	antirestriction protein	NA	NA	NA	NA	NA
26314:26342	attR	AACGTGCGCTATACCCGGTTGAAACGCAC	NA	NA	NA	NA
WP_002353182.1|27014_27662_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	28.3	4.1e-05
>prophage 3
NZ_CP010374	Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-43.621kb, complete sequence	43621	32226	33827	43621		Enterobacteria_phage(100.0%)	2	NA	NA
WP_000027057.1|32226_33087_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|33269_33827_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
>prophage 4
NZ_CP010374	Enterobacter hormaechei subsp. steigerwaltii strain 34977 plasmid p34977-43.621kb, complete sequence	43621	39901	42971	43621	transposase	Escherichia_phage(66.67%)	3	NA	NA
WP_004199214.1|39901_40927_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|40923_41703_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|42089_42971_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
