The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	294	31737	4929051	terminase,portal,head,tail,holin,integrase,capsid,lysis,transposase	Escherichia_phage(38.71%)	41	21880:21894	43204:43218
WP_000752994.1|294_648_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_016244346.1|659_1055_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	89.4	3.2e-53
WP_000118193.1|1096_2122_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000201478.1|2177_2510_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_039267613.1|2519_3851_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.7e-231
WP_021546024.1|3831_5433_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	7.2e-309
WP_000198149.1|5429_5636_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|5632_7558_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453587.1|7532_8078_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001331705.1|8466_8700_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000079508.1|8757_9168_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001283922.1|9756_10032_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	2.4e-31
WP_000839225.1|10028_10526_-	KilA-N domain-containing protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_039267614.1|10727_11186_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	93.4	7.5e-70
WP_000992106.1|11182_11716_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000370550.1|11821_12094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001468348.1|12059_12404_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000839572.1|12408_12624_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001339397.1|12746_13424_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|13423_13771_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_039267615.1|13790_15362_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.1	3.2e-168
WP_000139994.1|16812_17178_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.2e-39
WP_039267616.1|17178_18234_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	5.7e-89
WP_024175747.1|18235_18514_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737634.1|18810_19203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|19346_19502_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000150294.1|19738_20404_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_039267617.1|20578_21004_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.8	1.1e-62
WP_001262357.1|21044_22115_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
21880:21894	attL	CCCTGCATCGTCTGC	NA	NA	NA	NA
WP_000693853.1|22186_22612_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|22608_22863_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|22942_23362_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_042046576.1|23720_24020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|24091_24310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449185.1|24877_25066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090551.1|25062_25266_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_021522781.1|25345_27817_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096344.1|27875_28079_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533618.1|28078_29104_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001325918.1|29339_30137_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_039267618.1|30474_31737_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	1.5e-72
43204:43218	attR	CCCTGCATCGTCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	104473	109634	4929051	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
WP_000381395.1|104473_106045_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|106064_106412_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|106411_107089_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001234629.1|107478_108297_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	2.6e-44
WP_000860087.1|108378_108858_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	1.2e-12
WP_039267628.1|108873_109350_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|109412_109634_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 3
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	144308	152043	4929051		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001033086.1|144308_145415_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.6	5.9e-44
WP_001332228.1|145407_145875_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_032139969.1|145861_146272_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000857507.1|146289_147165_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.6e-107
WP_001023648.1|147223_148123_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	8.2e-28
WP_039267632.1|148122_149208_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	2.6e-100
WP_000183029.1|149580_150474_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.4	1.3e-46
WP_001116045.1|150648_152043_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
>prophage 4
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	460848	533743	4929051	terminase,portal,holin,integrase,protease,lysis,tRNA,transposase	Enterobacteria_phage(69.35%)	90	490993:491009	533817:533833
WP_001283598.1|460848_461661_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|461660_462674_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|462739_463876_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|463974_464970_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|464966_466145_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|466409_467630_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|467788_469795_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|469915_470194_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|470227_470776_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|470775_471585_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|471584_472409_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|472412_473498_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|473532_474465_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|474630_475182_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|475501_476344_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|476345_476873_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|476869_477349_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|477345_477849_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000120670.1|477865_478618_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|478637_481286_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000032640.1|481366_481933_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195816.1|482498_482984_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|483186_485331_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|485330_486641_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|486821_487106_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|487477_488818_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|488875_489631_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|489924_490857_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
490993:491009	attL	CTGCAGGGGACACCATT	NA	NA	NA	NA
WP_000958671.1|491168_492326_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_039267649.1|492565_493342_-	acyltransferase	NA	C7U0W4	Enterobacteria_phage	99.1	3.0e-79
WP_000998059.1|496271_497810_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.5	5.9e-284
WP_000612591.1|497859_498207_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|498203_498584_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_039267915.1|498991_499894_-	antirepressor	NA	Q0H8C7	Salmonella_phage	99.0	1.0e-171
WP_000620145.1|499956_500130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410001.1|500126_500279_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_024173454.1|500393_500642_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.7	1.5e-08
WP_021557681.1|500641_501178_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_077635758.1|501230_501674_-	hypothetical protein	NA	I6S1K6	Salmonella_phage	98.6	1.2e-80
WP_000954425.1|501654_502098_-	SocA family protein	NA	I6R0L8	Salmonella_phage	98.6	1.8e-81
WP_039267651.1|502678_504544_-	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	98.4	0.0e+00
WP_039267652.1|504543_505908_-	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	98.9	3.9e-239
WP_039267653.1|505918_506608_-	hypothetical protein	NA	I6S1K1	Salmonella_phage	96.1	1.7e-113
WP_039267654.1|506610_507066_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	3.0e-87
WP_000785531.1|507065_507767_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_039267655.1|507766_509185_-	packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	99.4	6.0e-275
WP_001558142.1|509194_509656_-	phage DNA stabilization protein	NA	A5VW70	Enterobacteria_phage	99.3	1.6e-83
WP_001389518.1|509636_509825_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_001558143.1|509866_511120_-	hypothetical protein	NA	A5VW72	Enterobacteria_phage	99.8	7.5e-237
WP_000372589.1|511138_512032_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818372.1|512122_514321_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.4	0.0e+00
WP_000200770.1|514322_515738_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	7.5e-278
WP_000113731.1|515734_516175_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807790.1|516177_516420_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	1.1e-35
WP_001059339.1|516720_517245_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001139677.1|517447_517600_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	98.0	8.1e-21
WP_000092261.1|517587_518055_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	4.6e-75
WP_000229392.1|518051_518528_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_039267656.1|518511_518835_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	99.1	2.9e-52
WP_001235421.1|519507_520131_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	1.5e-113
WP_000994515.1|520127_520316_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_021512402.1|520312_520675_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	99.2	3.5e-62
WP_000002228.1|520671_520962_-	DUF1364 domain-containing protein	NA	K7P7N7	Enterobacteria_phage	100.0	3.4e-52
WP_001279421.1|520961_521231_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000950973.1|521223_521400_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000386646.1|521392_521812_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|521814_521991_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|521987_522398_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_024189664.1|522597_522918_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	70.2	1.5e-32
WP_000229808.1|523026_523233_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_021512405.1|523308_524745_-	AAA family ATPase	NA	A0A220NRL4	Escherichia_phage	98.5	5.3e-271
WP_016063113.1|524734_525634_-	DNA replication protein O	NA	K7PH26	Enterobacteria_phage	100.0	1.2e-164
WP_000166207.1|525626_525773_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_021512406.1|525805_526102_-	phage regulatory protein CII	NA	K7PKU6	Enterobacteria_phage	99.0	1.2e-47
WP_000276885.1|526217_526403_-	helix-turn-helix domain-containing protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|526483_527134_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_021512407.1|527448_527748_+	hypothetical protein	NA	C6ZCW1	Enterobacteria_phage	98.0	5.5e-45
WP_039267657.1|527756_528200_+	hypothetical protein	NA	A4KWU0	Enterobacteria_phage	97.3	5.4e-81
WP_000638547.1|529367_529499_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|529483_529636_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031365.1|529892_530498_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|530497_530881_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|530904_531201_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|531295_531814_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_021512411.1|531810_532110_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	5.6e-58
WP_000161575.1|532111_532684_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000253289.1|532683_532968_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000002106.1|532960_533245_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|533317_533485_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|533542_533743_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
533817:533833	attR	CTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 5
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	749889	843160	4929051	terminase,portal,head,plate,tail,holin,protease,capsid,lysis,tRNA,transposase	Shigella_phage(37.7%)	99	NA	NA
WP_000083664.1|749889_750627_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|750758_752093_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|752125_753007_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|753109_753697_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|753752_754136_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|754440_755130_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_039267667.1|755177_756215_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|756421_756841_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|756909_757608_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082937.1|757639_760300_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|760413_761769_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|761814_762138_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_039267668.1|762134_763433_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_001350770.1|771916_774490_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|774619_775351_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079114.1|775347_776328_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|776462_777200_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|777469_777811_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|777914_777962_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200106.1|778060_779221_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|779263_780385_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|780395_781466_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|781675_782041_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|782189_782708_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|782697_783924_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|783939_784422_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|784498_784846_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|784887_785655_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_039267669.1|785685_786234_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|786252_786501_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|786637_787999_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|788165_788957_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|788977_790264_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|790318_790912_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|791034_791913_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|791998_793660_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|793808_794150_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|794211_794502_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|794491_794968_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|795099_795582_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|796738_797527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|797614_797908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|798118_798892_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_052251038.1|799883_801671_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000998059.1|801681_803220_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.5	5.9e-284
WP_000612591.1|803269_803617_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|803613_803994_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000381395.1|804598_806170_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|806189_806537_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|806536_807214_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_039267923.1|807268_807736_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	60.4	8.0e-43
WP_000356380.1|807735_808338_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_001089535.1|808309_808753_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_039267671.1|808755_809499_-	hypothetical protein	NA	U5P0I1	Shigella_phage	85.0	3.0e-60
WP_000785328.1|810078_811137_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|811123_811549_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_039267673.1|811548_812097_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.4	4.7e-95
WP_000999498.1|812096_813176_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|813172_814501_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|814561_816397_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_039267674.1|816538_816808_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	1.7e-42
WP_000090998.1|816807_817164_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_021512429.1|817163_818660_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	5.0e-272
WP_000497751.1|818643_818814_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_021512430.1|818822_819383_-	hypothetical protein	NA	S5FM61	Shigella_phage	99.5	4.0e-105
WP_000213503.1|819379_819886_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|819860_820271_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|820267_820591_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|820593_820794_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|820843_822049_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|822063_822714_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|822691_823933_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|823932_824115_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|824126_825623_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|825856_826351_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|826476_826827_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_001332386.1|827475_827727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|827797_828235_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|828231_828708_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|828694_829000_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|829151_829487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|829672_830425_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|830438_831428_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|831435_832233_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|832252_832642_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001332383.1|832962_833616_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|833615_834110_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|834106_835048_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|835037_835217_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|835392_835944_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|835987_836188_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|836278_836953_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|837155_837668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|838136_838499_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|838564_839389_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|839516_840041_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001331174.1|841059_841266_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001339397.1|842135_842813_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624599.1|842812_843160_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	2.2e-45
>prophage 6
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	920766	927906	4929051		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|920766_923328_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|923433_924090_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|924140_924908_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|925103_926012_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|926008_927271_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|927267_927906_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 7
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	1589496	1599805	4929051	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_000381395.1|1589496_1591068_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1591087_1591435_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1591434_1592112_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000675504.1|1592530_1593007_-	bacterioferritin	NA	NA	NA	NA	NA
WP_000289085.1|1593078_1593273_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_000773166.1|1593441_1596144_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	1.5e-40
WP_000031783.1|1596435_1597620_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|1597690_1599805_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
>prophage 8
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	2541003	2611681	4929051	transposase	Stx2-converting_phage(38.1%)	58	NA	NA
WP_000998059.1|2541003_2542542_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.5	5.9e-284
WP_000839281.1|2542813_2543011_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000777541.1|2543022_2543511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854753.1|2543507_2543882_-	toxin	NA	NA	NA	NA	NA
WP_001278232.1|2543971_2544340_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692303.1|2544502_2544724_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186710.1|2544786_2545263_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860065.1|2545274_2545754_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234631.1|2545835_2546654_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.1e-44
WP_001278287.1|2546752_2546986_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001097306.1|2546991_2547669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001593697.1|2547816_2548497_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001116802.1|2548699_2549584_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_000778605.1|2552070_2552601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075491.1|2553270_2554002_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_153275894.1|2554112_2555341_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	6.1e-175
WP_000792543.1|2555533_2557582_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
WP_039267755.1|2561312_2561879_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001593693.1|2562125_2562743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958492.1|2562766_2563000_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001167444.1|2563277_2563826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018808.1|2564946_2565966_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	4.3e-17
WP_001317566.1|2566223_2566667_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000699820.1|2566745_2567018_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000470229.1|2567040_2568429_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001101067.1|2568425_2569256_+	transketolase	NA	NA	NA	NA	NA
WP_000609007.1|2569248_2570202_+	transketolase family protein	NA	NA	NA	NA	NA
WP_131501864.1|2570464_2570578_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_000919997.1|2571428_2572787_+	YadA-like family protein	NA	Q9MCI8	Enterobacteria_phage	76.1	5.6e-20
WP_000884152.1|2572848_2573304_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000760916.1|2573688_2574027_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000859647.1|2575279_2575969_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000983423.1|2575968_2577525_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001293447.1|2577690_2578515_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000551919.1|2578671_2580015_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000803221.1|2581509_2582826_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_089581225.1|2582996_2583182_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_001313273.1|2583190_2583298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001313270.1|2585169_2587140_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000977396.1|2587158_2587950_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_000381395.1|2588252_2589824_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2589843_2590191_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2590190_2590868_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001171523.1|2591236_2591617_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612556.1|2591613_2591961_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	4.8e-61
WP_039267757.1|2592056_2593649_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.5e-181
WP_000624717.1|2593679_2594030_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.2e-40
WP_000422741.1|2594026_2594452_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_039267758.1|2596664_2600162_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
WP_001283626.1|2601172_2601694_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|2601690_2602644_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188254.1|2602730_2605055_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879160.1|2605099_2606002_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125181.1|2605998_2606997_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|2606993_2607950_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|2607950_2608718_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|2609274_2609532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039267759.1|2610529_2611681_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	7.5e-42
>prophage 9
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	2786073	2790049	4929051		Enterobacteria_phage(100.0%)	7	NA	NA
WP_021038237.1|2786073_2786646_-	phage polarity suppression protein (Psu)	NA	Q7M2A1	Enterobacteria_phage	96.2	1.2e-93
WP_021038238.1|2786719_2787220_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001606455.1|2787216_2787951_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.6	9.4e-131
WP_001149160.1|2788503_2788770_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032226384.1|2788766_2789321_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001244665.1|2789313_2789601_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|2789593_2790049_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
>prophage 10
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	3102766	3177107	4929051	plate,tRNA,protease	uncultured_Mediterranean_phage(10.0%)	60	NA	NA
WP_000753936.1|3102766_3104191_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
WP_000929439.1|3104345_3105503_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|3105556_3105943_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186656.1|3106253_3107078_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_001094597.1|3107108_3109781_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|3109842_3110637_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|3111004_3111730_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|3111864_3112716_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|3112862_3113588_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|3113737_3114295_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811911.1|3114386_3115583_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|3115771_3116530_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922441.1|3116542_3117400_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001298422.1|3117411_3118764_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3118793_3121226_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3121347_3121833_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139272.1|3121836_3122862_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3122966_3123422_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3123425_3124214_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139678.1|3124213_3125362_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569434.1|3125358_3125955_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294798.1|3125991_3129474_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
WP_000055742.1|3129486_3130446_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_000901082.1|3132742_3133132_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176515.1|3133196_3134495_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000026223.1|3134542_3134803_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417059.1|3134789_3134990_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|3135155_3135701_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635525.1|3135697_3136120_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239186.1|3136133_3136844_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000360464.1|3136999_3137824_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_039267780.1|3137876_3139595_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094006.1|3139705_3140413_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3140409_3140814_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|3140931_3141747_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294590.1|3141786_3142440_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3142432_3143464_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_039267781.1|3143651_3144224_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997016.1|3149985_3150789_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	6.0e-38
WP_000648548.1|3150785_3151700_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3151940_3152741_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211705.1|3152818_3153589_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3153635_3154994_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052743.1|3155065_3155821_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|3155854_3156577_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3156573_3157041_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|3157105_3157837_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001049698.1|3158374_3159160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013181.1|3159499_3159979_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000073801.1|3159996_3161355_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001331531.1|3161365_3164833_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001331530.1|3164912_3166355_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000614314.1|3167116_3169876_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	4.7e-82
WP_001282178.1|3169885_3170650_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000224516.1|3170654_3172001_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|3172003_3172528_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|3172524_3173817_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|3173821_3174871_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863402.1|3174834_3176676_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946068.1|3176681_3177107_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 11
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	3772083	3847463	4929051	terminase,portal,head,tail,plate,integrase,protease,capsid,lysis,transposase	Salmonella_phage(62.5%)	82	3771984:3772009	3806975:3807000
3771984:3772009	attL	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_039267819.1|3772083_3773136_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
WP_000900883.1|3773324_3773516_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047327.1|3773531_3774101_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_039267820.1|3774226_3774478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|3774480_3774990_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956188.1|3774997_3775294_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	1.3e-22
WP_000934004.1|3775379_3775628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963854.1|3775710_3776052_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	2.3e-55
WP_001244228.1|3776119_3776353_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000752613.1|3776352_3776580_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_039267821.1|3776576_3777434_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	4.1e-162
WP_039267822.1|3777430_3779845_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
WP_001154434.1|3779997_3780186_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217562.1|3780196_3780430_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_000215882.1|3780558_3781299_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	91.1	7.8e-133
WP_000402159.1|3781703_3782972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520347.1|3783020_3784052_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.0	1.1e-169
WP_001098431.1|3784051_3785818_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_001544407.1|3785960_3786794_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.5	4.3e-124
WP_000742500.1|3786810_3787869_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	6.4e-181
WP_000059193.1|3787872_3788523_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	4.3e-111
WP_000673506.1|3788618_3789083_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	6.0e-75
WP_000868180.1|3789082_3789286_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	2.0e-30
WP_000171568.1|3789289_3789505_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069895.1|3789485_3789998_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	4.4e-87
WP_000727853.1|3789999_3790377_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080915.1|3790373_3790802_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	2.1e-45
WP_001039950.1|3790897_3791329_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	2.0e-72
WP_000829116.1|3791321_3791765_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.6	1.6e-56
WP_001108703.1|3791805_3793638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993745.1|3793706_3794285_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	90.1	6.3e-98
WP_000177590.1|3794281_3794641_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268280.1|3794627_3795536_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086824.1|3795528_3796134_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_039267823.1|3796130_3797528_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.4	6.3e-152
WP_039267824.1|3797529_3797964_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.9	9.1e-49
WP_039267825.1|3797935_3798529_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	64.5	3.1e-60
WP_039267826.1|3798528_3799023_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	94.1	1.3e-80
WP_000905030.1|3799053_3799620_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	3.2e-86
WP_039267827.1|3799762_3800935_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
WP_001207660.1|3800944_3801460_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|3801514_3801817_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|3801831_3801951_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_039267828.1|3801943_3805021_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	0.0e+00
WP_000980389.1|3805017_3805503_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.8e-67
WP_001544414.1|3805499_3806600_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	3.5e-174
WP_000972391.1|3806690_3806909_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|3807144_3808830_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3806975:3807000	attR	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_001195230.1|3809507_3809765_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	1.0e-23
WP_001201575.1|3809924_3810212_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|3810977_3811880_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|3811967_3812444_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|3812793_3813906_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|3814000_3815134_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105433.1|3815143_3816097_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|3816093_3816939_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|3816998_3817487_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149763.1|3817527_3818655_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.3e-27
WP_001295905.1|3818683_3819415_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|3819640_3820309_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|3820308_3821025_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|3821031_3821763_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|3821780_3822509_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001298306.1|3822726_3823242_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|3823367_3823691_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255187.1|3823687_3824518_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001305933.1|3824514_3825528_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136572.1|3825626_3827057_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566391.1|3827067_3828069_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815373.1|3828105_3829824_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	5.2e-31
WP_000178694.1|3829956_3830925_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|3830936_3832589_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|3832732_3833632_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|3833952_3834648_-	aquaporin Z	NA	NA	NA	NA	NA
WP_001351020.1|3836729_3837686_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746477.1|3837836_3838952_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_039267829.1|3838948_3840895_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	2.5e-37
WP_000410785.1|3840967_3841192_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3841514_3841835_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3841865_3844142_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000381395.1|3845524_3847096_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3847115_3847463_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
>prophage 12
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	4099076	4184270	4929051	terminase,portal,head,tail,integrase,protease,capsid,lysis,tRNA,transposase	Enterobacteria_phage(46.03%)	102	4121417:4121434	4192884:4192901
WP_001298466.1|4099076_4100183_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4100236_4100698_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|4100707_4101361_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4101532_4102783_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|4102896_4104039_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|4104028_4104265_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|4104404_4104644_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|4104627_4104954_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|4104953_4105175_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|4105561_4105753_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|4105725_4105908_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|4105904_4106585_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|4106581_4107367_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|4107372_4107669_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|4107744_4107888_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|4107856_4108021_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|4108093_4108462_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|4108644_4108845_-	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|4109058_4109640_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_097292506.1|4109656_4109938_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.4	6.3e-27
WP_001171554.1|4109940_4110321_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4110317_4110665_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998059.1|4110714_4112253_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.5	5.9e-284
WP_000438342.1|4112356_4112539_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|4112815_4113568_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|4113564_4114122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|4114161_4114857_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|4114932_4115148_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|4115289_4115586_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000788872.1|4116513_4117215_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|4117211_4117502_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|4117575_4118016_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|4118012_4118540_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|4118536_4118713_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|4118715_4119057_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|4119263_4119626_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|4119622_4119763_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|4119848_4120232_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|4120420_4121503_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
4121417:4121434	attL	TTTATTATAAATTTCAGC	NA	NA	NA	NA
WP_000839596.1|4122091_4122307_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|4122306_4122804_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4123020_4123203_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4123293_4123587_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4124067_4124394_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4124600_4124783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|4125253_4126825_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4126844_4127192_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4127191_4127869_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000867568.1|4128051_4128600_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|4128571_4130500_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|4130483_4130690_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|4130686_4132279_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253914.1|4132268_4133774_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|4133810_4134158_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|4134215_4135244_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|4135295_4135670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|4135662_4136016_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|4136027_4136606_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|4136602_4136998_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001351266.1|4137005_4137746_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|4137761_4138184_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|4138165_4138600_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_144318835.1|4139975_4141157_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	5.9e-159
WP_039267844.1|4141153_4141483_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152619.1|4141482_4142181_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847666.1|4142928_4143501_+|tail	tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
WP_001596836.1|4147328_4147928_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	1.1e-105
WP_039267845.1|4147992_4150056_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	5.2e-126
WP_000654168.1|4150052_4150331_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_000355360.1|4150343_4150637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011831.1|4150838_4151618_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021512022.1|4152816_4153653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064572249.1|4153869_4154088_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_021580844.1|4154169_4154460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512026.1|4154504_4154801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512028.1|4155048_4156320_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_024189624.1|4156383_4156932_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_021512030.1|4157110_4157515_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_021512031.1|4157670_4158150_-	DUF4756 family protein	NA	NA	NA	NA	NA
WP_000287394.1|4158215_4158809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350582.1|4158809_4158989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039267846.1|4159207_4159765_-	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_021512035.1|4161781_4162051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144318836.1|4162335_4162611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001764625.1|4163409_4163913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512037.1|4163963_4166627_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_039267848.1|4168040_4168280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039267849.1|4168807_4170058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512041.1|4170282_4170564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077572384.1|4170632_4170830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001773958.1|4170899_4171334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512043.1|4172034_4172376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512045.1|4172748_4173279_+	lipoprotein	NA	NA	NA	NA	NA
WP_021512046.1|4173374_4173947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512047.1|4174550_4176032_-	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_001608347.1|4177129_4177438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512051.1|4178624_4178990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512052.1|4178986_4179292_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_000243502.1|4179687_4180245_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_021512053.1|4180297_4181761_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_021512054.1|4181873_4182887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512055.1|4183019_4184270_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.5	2.9e-79
4192884:4192901	attR	TTTATTATAAATTTCAGC	NA	NA	NA	NA
>prophage 13
NZ_CP005930	Escherichia coli APEC IMT5155 chromosome, complete genome	4929051	4915924	4928757	4929051	tail	Enterobacteria_phage(72.73%)	11	NA	NA
WP_000654167.1|4915924_4916203_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
WP_000290543.1|4916199_4918260_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000515327.1|4918318_4921801_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000847666.1|4921861_4922434_-|tail	tail assembly protein	tail	A0A0K2FJB0	Escherichia_phage	99.5	6.7e-84
WP_001152619.1|4923181_4923880_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_039267844.1|4923879_4924209_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_039267898.1|4924205_4926767_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.6	0.0e+00
WP_039267899.1|4926759_4927194_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	2.2e-63
WP_039267901.1|4927175_4927598_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.7	2.1e-58
WP_039268057.1|4927613_4928354_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	2.8e-130
WP_000683145.1|4928361_4928757_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
>prophage 1
NZ_CP005931	Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence	194170	15060	81185	194170	protease,transposase,integrase	Stx2-converting_phage(18.75%)	41	69879:69938	85069:85836
WP_001334006.1|15060_15381_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	41.0	3.5e-13
WP_000066154.1|18681_19287_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.0	1.7e-05
WP_193365817.1|20137_21727_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_040111966.1|21726_23145_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001084509.1|23257_24808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000661609.1|24834_25797_+	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_001513481.1|28371_29151_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_000255956.1|29150_30173_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000222760.1|31048_31336_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.3e-19
WP_001132900.1|31332_31584_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000774297.1|32546_33404_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001273588.1|33396_33879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|33871_33946_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083845.1|34177_34435_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001351576.1|34718_34925_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_040111969.1|35548_35761_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040111971.1|35896_36457_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704513.1|36559_37420_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_021512286.1|37478_38225_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	31.4	4.6e-08
WP_040111974.1|38244_43515_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450520.1|43596_43824_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_001339397.1|44432_45110_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|45109_45457_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|45476_47048_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_074400466.1|47258_49436_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	28.3	9.6e-06
WP_000271277.1|49480_50437_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933675.1|50521_51751_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_001442133.1|51854_55514_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.2e-45
WP_001298145.1|55653_56769_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000738422.1|59398_59692_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_193365816.1|60398_61626_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	8.8e-174
WP_000450493.1|62081_63275_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000974761.1|65537_66479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001318212.1|68052_69423_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
69879:69938	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000928805.1|72139_73327_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	54.7	7.8e-10
WP_001312823.1|74864_75023_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000280979.1|76294_77248_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_000771476.1|77680_78790_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001312822.1|78858_79761_+	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_001312821.1|80135_80324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066954.1|80444_81185_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
85069:85836	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCGATCCCTTCATTTAGTGACTGCCCCTGGGTTTTTCATGCTCTCCTGCGTCCTAGAGAACTTGCCAATAACCTACATTATTTTTGCTTTGCCATTACCAATCGTCCTGAACAAGTTCATTTTAAAGCCAAAGCGCTGCCCAACTTTTATCCTCAATACCACATCGTCAGCAGGAAATAACCTAATCCCTGTGTTGGGATCTTATAATCGCTAATGATAATTATTTACATTTTATAGCTTCTGCTATAAAACATAGTAGTTGCTATGTTTATTCTAATTTTGCTCACTATAGGTACTAAATCATGCTCTCAATAAAAAAAGTAACCATGCTCTTGGGGTGCCTAGTCCTCACCTGCTCGATAGCATTTCAGGCGAGTGCAGCTGAAAAATTCAAGGTCATTACAACTTTTACCATCATCGCAGATATGGCCAAAAACGTGGCTGGAGATGCTGCAGAAGTCTCATCCATAACCAAGCCTGGTGCAGAAATTCATGAGTATCAGCCTACCCCTGGCGATATTAAACGTGCGCAGGGGGCACAACTGATTCTCGCCAATGGTATGAATCTGGAATTGTGGTTCCAACGCTTTTACCAGCATCTCAATGGGGTTCCAGAAGTAATTGTCTCTTCGGGTGTGACGCCAGTAGGGATCACCGAAGGGCCCTATGAGGGCAAACCTAACCCCCATGCCTGGATGTCGCCAGATAAT	NA	NA	NA	NA
>prophage 2
NZ_CP005931	Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence	194170	116796	183584	194170	protease,transposase,integrase	Stx2-converting_phage(31.25%)	58	112733:112792	163004:165702
112733:112792	attL	GTAACCGGCTCATTTAAACCGTCTGGTCTGTTTCCTCCGGCTCTACAAAAATAATGTCCA	NA	NA	NA	NA
WP_000016968.1|116796_117603_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.4	3.7e-56
WP_000504262.1|118282_119014_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	32.6	6.3e-26
WP_001442122.1|119635_120841_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.2	9.5e-205
WP_001233385.1|120837_121809_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.9	1.5e-112
WP_000549075.1|123153_124152_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001442123.1|124148_125060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696651.1|125136_126360_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_050575774.1|127766_128264_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.3	7.5e-39
WP_001209608.1|128326_128560_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000845935.1|130631_131066_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276275.1|131062_131782_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001332444.1|132056_132218_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001234485.1|133245_134067_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.5	7.7e-41
WP_000252676.1|134362_134953_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|135286_135670_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000332490.1|135859_136546_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001442099.1|136639_136867_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000340276.1|136900_137266_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|137280_137592_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399774.1|137613_138180_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|138190_138895_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000146685.1|138894_140322_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002787.1|140311_140902_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_001352845.1|140855_141086_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001038351.1|141097_141349_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_000809834.1|141345_141861_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001278690.1|141995_142217_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_001064245.1|142376_145004_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000099688.1|145000_145387_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001203720.1|145383_146016_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000830183.1|146012_147005_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_000777703.1|147013_147652_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_000821867.1|147648_149457_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_000864318.1|149483_149741_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_001030378.1|149733_150477_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_001513501.1|150841_151117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512271.1|151469_152015_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_071833523.1|151944_152286_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000944319.1|152651_154025_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_040111998.1|156843_157353_+	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_000850416.1|157366_158098_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000381395.1|160394_161966_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|161985_162333_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|162332_163010_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001190233.1|163735_164770_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	42.6	1.1e-73
WP_000377483.1|165329_165638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969988.1|165736_165919_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
163004:165702	attR	TGGACATTATTTTTGTAGAGCCGGAGGAAACAGACCAGACGGTTTAAATGAGCCGGTTACAATTGATATATAACATATGTTTTTTATTTCATTGCACTTGTCGATCATCGGGAATTTTGTCACAATTTCTCACGGATAGTGTTCACATTGTTTCTGACCTGGCGGGCGCTGCTTATGTATATAAGGGCCTGTGGTCGACGAATCAGCATACTCAGATCTTCCTGCGAACAATTTCTTTCAGCGTATCAGGCAGCACTATCGGATTATCTACGAGCGTTTTTGATTCACATTGTGTGTGAAACTTCATACATCATGATTCGCTTTCCCTACTCAGTTCTGATGATTGTTTTTTATTCTATTAACACGGAGTTAAGATTCTACCCTCGGTGTCCTCATTATTAATGAGGAATGCTACCTATCTAAAAACTGACCGAAACTTTGGGGCATCCCTGGAGGTTTCCAAGGAGAAAAACGGTGACAGTGATAGTGCCACATTGTGAGGAAATTCCTGAGAAACTCCTGGTTCACACACATAATTCAGGAGATTGCCATAGATAGTAACCAATTGTTTTATATTTTAAGACCATTAAATACGCGGCTACGATAGCGCTTTATATAATCATAAACTATAGAGATAAAATATCTGCTTCTCTGATAACACTAATTGAGTGTCTTAAACTAAGTAATTTCATTTTTCCCCCTTTAAAAGCAATATATGTGCAATAGTTGAAGTTAAAGCTGTGCTGCCAGAGTTGATAATAATTGTTCTGTCTGTTGCCATGATATGCATTCATCAGTAACAGACTGACCATACTCTAGCGGAAAACTATCGGATTGTTTTCCATCTTGTAAAAAGCTTTCCACCATAATGCCAGCTACATATCCTGGTATTTTTTTCCGATTATCTATAACTTGACGTGCAACGGAAATTTGCCGTTTAGCCACTTTACCGCTATTACCATGGCTACAATCAATTATCAGACGATGGTTAATGCCCTCATCATGCATTAATTTCACTGCCTTAGTTATATCAGACAAACCATAGTTAGGTTCTCTACCTCCACGTAATATTAGATGTCCATGTAGATTGCCATCGGTTAATAGTGTAGATATACTATTTGTTAAAGATGTCATATATACAATATGTTGTTCACGGGCTGCAATAATAGCGTCAATAGCTAAGTTAATATTTCCATCAGTACTGTTTTTAAATCCAACTGGACAATGTAAACCAGACGCAAGTTGACGATGCGTTTGTGATTCAGTGGTTCTGGCACCAATAGCACCCCAACATATTAAATCAGCAATATAGGGAGTAAGAAAAGGATCGAGGAATTCTGTAGCGGTTGCGACACGCATCGTTGTGATTGAAGACAAACACTGGCGAGCATATCGTATCCCTTTCTCAACATCATAACTTCCATTTAGATCAGGATCGTGCATTATTCCCTTCCAGCCTTTACGGGTTCGAGGTTTCTCAAAATAAGTGCGCATTACAATGTACATTTTCGATAAGTACTTATTCTGTAATACGAACAATCGCTTCGCATAATCAACTGCGGCCTGAACGTCATGGATTGAGCATGGACCAACAATCACAAGTAAGCGAGGATCTTTTCCCAGCAAAATATTCGCTATAATATCTCGTTGCAGAGAGATCCATGTTACGGTTTCTTCCGATACTGCGATTTCTTTATGAATCTCGCCCACAGTGGGTAAACTGCCAAGCAACTTCCCGCGGTAGATTAATTTACTAGCTGACTGCATCTTGTCTCCTAAAAGCGCTATTTCAGACCATCAGTTGCACACATTAGATGATAATGATAATCATTTACTGTATAATTGGCAATATATGGGGATTCATAGTCATTTCTGAGATAATATACGTTAGGCCTTCTCTCCCGTACGGAAATCACTTGTTTTCCGTAAATTACCTGAATCTTAATCCCTGAGCTGCGGCTAGCTGTGGAACTCACAAAAGCTGACCGGGCCGTGGCACAGCCTCTCTGCTGGCAGAACAGCGTACTGCAGAAGTCGTCGTACTGCCGCTGGTCCCGGCATCAGGTCTGCCCGCAGATGGCACTTCTGCCACTGATCTGCCGGTGGAGCTGAACGGCATGACATATCAGGCCTGCCGTGGGGATTTTGTGGTGCGCCTCGACGGCAGCACCTGTCTGCAGTTATAGAATAAAGAAGGCGGGGAGGTACGCAGGGAGGGCGATCCGCTGGAAGTGGCGTAGTGGCTGTAGGCCTGTAATGATGCAGGAATAGAAGTTCGTGTACAGGTTAATGAAAGCATCACCCCGTAAAAACATGCCGGCACGGTTTACACATCATTCCATGGTGGCAGCCGGTTAACTTTCCTGCGCCACCAGTGGAAAGAGGCCATGAGCAGTCCGAACAAAAAACCACTCGTGATACTTATAATAATGGCCTCACCTGCTACCATTCCTGACGGCCCCCAGTACATAAACCACATTGCACATCCCCAGGAAATACCCCATAAGCCCCCCATCAGCAGCGTAACCTGCCAGAACGGCATAAAGGGCAATGGCGGAAGCCGGATACCCAGCCGCCAGAGAATACGCAGCAGAGGAGGAGCATAATTACTCCGCCACATCTTTTTGCTGTCCATCAGGGCAATTGCCCGGGCTTTTTTTGCTCAAAAGTCACAGGAGCACCTCCGTTCCATGATGTAA	NA	NA	NA	NA
WP_001324224.1|165915_166113_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000489608.1|166794_168069_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001183604.1|168043_170158_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|170327_170639_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|170616_170853_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|171793_172063_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_001017347.1|172059_173040_+	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_001171554.1|173115_173496_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|173492_173840_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_040112007.1|177333_181467_-|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	2.3e-295
WP_040112009.1|182432_183584_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	3.4e-42
