The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	340786	402763	4329554	transposase,integrase	Bacillus_virus(18.18%)	53	371401:371449	400172:400220
WP_082802155.1|340786_340894_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039004561.1|342938_343256_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_039004490.1|343252_344257_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039004491.1|344253_345237_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039004492.1|345241_346777_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	4.7e-15
WP_039004493.1|346861_347857_-	rhamnose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039004495.1|348884_350987_+	bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_039004496.1|350999_352274_+	L-rhamnose catabolism isomerase	NA	NA	NA	NA	NA
WP_039004499.1|353086_353803_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.1	1.2e-18
WP_039004500.1|353796_354501_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039004501.1|354628_355333_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_039004502.1|355446_356295_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039004504.1|357817_358708_+	NAD(P)-dependent oxidoreductase	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	22.5	1.5e-10
WP_039004562.1|358983_359232_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_082802156.1|359599_359806_-	30S ribosomal protein S21	NA	M1HLV7	Pelagibacter_phage	58.7	1.1e-07
WP_039004507.1|360526_360814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156477396.1|361548_361704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039004508.1|361866_363123_+	Hint domain-containing protein	NA	NA	NA	NA	NA
WP_039004509.1|363288_363804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039004510.1|363904_364318_-	VOC family protein	NA	NA	NA	NA	NA
WP_082802157.1|364711_364894_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_039004511.1|364894_365923_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_039004512.1|365919_366492_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_039004513.1|366495_366714_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_039004514.1|366825_367287_-	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_039004515.1|367287_367773_-	UPF0262 family protein	NA	NA	NA	NA	NA
WP_039004516.1|367781_369083_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_039004517.1|369087_369567_-	DUF2948 family protein	NA	NA	NA	NA	NA
WP_039004518.1|369563_370829_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_039004519.1|370846_371026_-	hypothetical protein	NA	NA	NA	NA	NA
371401:371449	attL	CATTGGTAATGACGAGGTCGGGAGTTCAATTCTCCCCAGCAGCACCATA	NA	NA	NA	NA
WP_039004520.1|371596_372763_-|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	32.5	1.7e-49
WP_039004521.1|373179_373596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052275131.1|373604_376715_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.8	4.1e-18
WP_156477397.1|376725_377319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052275133.1|377366_378692_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_039004522.1|378688_380878_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.9	4.6e-24
WP_039004523.1|381377_382013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156477398.1|382196_383945_-	hypothetical protein	NA	Q4ZD27	Staphylococcus_phage	37.8	1.6e-43
WP_062628110.1|384058_384490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004525.1|384479_384686_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039004526.1|385272_385647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082802159.1|387008_387668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156477400.1|387908_388866_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	24.7	2.1e-13
WP_039001699.1|388994_390047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052274773.1|390288_391695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039001698.1|391963_395356_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_039001697.1|395709_396060_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052274772.1|396031_397288_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_062628112.1|397503_399075_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.3	7.2e-96
WP_039000107.1|399129_399483_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_039000108.1|399479_399863_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062628113.1|400514_401267_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.5	3.8e-42
400172:400220	attR	CATTGGTAATGACGAGGTCGGGAGTTCAATTCTCCCCAGCAGCACCATA	NA	NA	NA	NA
WP_062628114.1|401263_402763_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	983739	1018721	4329554	plate,transposase	uncultured_Caudovirales_phage(25.0%)	34	NA	NA
WP_039002372.1|983739_985080_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_039002371.1|985112_986564_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_039002370.1|986572_986875_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_039002369.1|986871_987486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062628143.1|987498_989061_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.6	2.4e-19
WP_062628144.1|989021_989597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039002367.1|989719_992473_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.6	1.2e-77
WP_156477414.1|992517_993510_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_039002365.1|993506_995381_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_039002364.1|995390_995885_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_039002363.1|995877_996702_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_039002362.1|996781_997267_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_039002361.1|997347_998835_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_039002360.1|998838_999351_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_052274836.1|999428_1000475_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_039002446.1|1000809_1001196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039002358.1|1001199_1001820_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_039002357.1|1001853_1002276_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_039002356.1|1002272_1002677_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_039002355.1|1002673_1004098_+	DUF4384 domain-containing protein	NA	NA	NA	NA	NA
WP_052274849.1|1004120_1005572_-	caspase family protein	NA	NA	NA	NA	NA
WP_052274835.1|1005650_1006727_-	OmpA family protein	NA	NA	NA	NA	NA
WP_039002354.1|1007134_1008508_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_052274834.1|1008847_1010200_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_039002353.1|1010295_1011924_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.8	2.4e-17
WP_039002352.1|1012104_1012725_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_039002351.1|1012893_1013436_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_039002350.1|1013432_1014131_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_039002442.1|1014303_1014873_+	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_052274833.1|1014943_1015450_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_169798699.1|1015511_1015904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062628145.1|1016361_1017933_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.3	7.2e-96
WP_039000107.1|1017987_1018341_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_039000108.1|1018337_1018721_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	2176232	2223964	4329554	terminase,transposase,integrase	Ralstonia_phage(16.67%)	41	2171387:2171401	2183213:2183227
2171387:2171401	attL	TGCTGCCCATCCACA	NA	NA	NA	NA
WP_039001030.1|2176232_2177432_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	39.3	2.9e-68
WP_039001029.1|2177737_2179072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156477450.1|2179109_2179394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082802250.1|2180154_2181327_-	AAA family ATPase	NA	G8DDJ2	Micromonas_pusilla_virus	28.2	5.9e-26
WP_156477558.1|2182337_2183249_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
2183213:2183227	attR	TGTGGATGGGCAGCA	NA	NA	NA	NA
WP_038999946.1|2183407_2183932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156477559.1|2184101_2184245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038999945.1|2184363_2186238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082802252.1|2186746_2188624_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_038999941.1|2189346_2190441_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_062628210.1|2190803_2191199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004122.1|2191407_2192460_-	response regulator	NA	NA	NA	NA	NA
WP_082802253.1|2192456_2194256_-	PAS domain-containing protein	NA	B5LWN0	Feldmannia_species_virus	28.4	5.7e-12
WP_156477451.1|2194225_2194702_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039004124.1|2194884_2195253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039004126.1|2196314_2197415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062628211.1|2197483_2199772_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_039004129.1|2199768_2200545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039004130.1|2200701_2202876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052275095.1|2203253_2203451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156477452.1|2203516_2203756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052275097.1|2203966_2204617_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_052275098.1|2204709_2205690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004133.1|2205745_2206510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062628212.1|2206965_2207262_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039004322.1|2208237_2209299_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_039004323.1|2209585_2210566_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_039004324.1|2210664_2211996_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_039004325.1|2212022_2212871_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_082802255.1|2212867_2214382_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	1.3e-14
WP_039004327.1|2214378_2215353_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039004328.1|2215349_2216336_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_052275119.1|2216391_2217519_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_169798730.1|2217822_2218515_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_039004331.1|2218561_2219131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039004332.1|2219997_2220225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082802256.1|2220221_2220329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082802257.1|2220444_2220702_-	DUF4389 domain-containing protein	NA	NA	NA	NA	NA
WP_062628125.1|2220741_2222238_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_062628126.1|2222234_2222987_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	2.2e-42
WP_039004181.1|2223496_2223964_+|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	48.9	4.0e-34
>prophage 4
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	2375390	2422779	4329554	terminase,transposase,integrase	Staphylococcus_phage(14.29%)	41	2389048:2389107	2421111:2421172
WP_062628233.1|2375390_2376551_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	1.0e-38
WP_039002951.1|2376633_2378019_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_062628234.1|2379198_2380104_+	AEC family transporter	NA	NA	NA	NA	NA
WP_062628235.1|2380221_2380647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039003153.1|2382716_2384216_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052274934.1|2384295_2384733_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_062628125.1|2384784_2386281_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_062628126.1|2386277_2387030_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	2.2e-42
WP_062628237.1|2387396_2388071_+	hypothetical protein	NA	NA	NA	NA	NA
2389048:2389107	attL	TGAATCACAAAACTGAACTCAACGGAATCCTATCGATTCAATATTTAAGCTCGACGCTTT	NA	NA	NA	NA
WP_039001685.1|2389530_2390262_+	YrhK family protein	NA	NA	NA	NA	NA
WP_039001684.1|2390527_2390803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039001683.1|2391122_2392640_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_039001695.1|2392636_2393386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039001682.1|2393477_2394485_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_039001681.1|2394627_2395713_+	isocitrate/isopropylmalate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_039001680.1|2395709_2396720_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_039001679.1|2396724_2397402_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082802269.1|2397522_2397762_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_039001694.1|2398236_2399244_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_039001678.1|2399683_2400616_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_082802270.1|2400675_2401083_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_082802271.1|2401060_2402101_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_039001677.1|2402133_2403000_+	dioxygenase	NA	NA	NA	NA	NA
WP_039001676.1|2403009_2404059_+	DUF475 domain-containing protein	NA	K4JUR1	Caulobacter_phage	42.8	1.9e-63
WP_052274770.1|2404534_2404987_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039001675.1|2404986_2406222_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_039001674.1|2406581_2407115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052274768.1|2407627_2409574_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_082802272.1|2409806_2410151_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_082802273.1|2410132_2410747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039001673.1|2411804_2412101_-	DUF2218 domain-containing protein	NA	NA	NA	NA	NA
WP_052274767.1|2412202_2413105_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039001672.1|2413114_2414059_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	34.4	4.0e-41
WP_039001671.1|2414051_2414999_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_039001670.1|2414991_2415753_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.5	2.0e-11
WP_039001669.1|2416519_2416981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039001668.1|2417032_2417512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052274766.1|2417805_2419320_+	DNA modification methylase	NA	E9P620	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	31.4	1.9e-53
WP_052274765.1|2419319_2419739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052274764.1|2419725_2421126_+|terminase	phage terminase large subunit	terminase	A0A1B1IUW7	uncultured_Mediterranean_phage	33.2	8.8e-61
WP_062628238.1|2421279_2422779_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
2421111:2421172	attR	AAAGCGTCGAGCTTAAATATTGAATCGATAGGATTCCGTTGAGTTCAGTTTTGTGATTCATG	NA	NA	NA	NA
>prophage 5
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	2432327	2469131	4329554	terminase,tail,transposase	Acidithiobacillus_phage(37.5%)	30	NA	NA
WP_082802277.1|2432327_2432738_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_062628145.1|2432738_2434310_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.3	7.2e-96
WP_039000107.1|2434364_2434718_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_039000108.1|2434714_2435098_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062628239.1|2435183_2435558_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	9.6e-23
WP_039004683.1|2436830_2437127_+	DUF3489 domain-containing protein	NA	NA	NA	NA	NA
WP_039004684.1|2437123_2437549_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	37.2	6.6e-12
WP_062628241.1|2437545_2439192_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	47.8	4.9e-87
WP_062628242.1|2439660_2440548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082802279.1|2440673_2442134_+	ParB N-terminal domain-containing protein	NA	K4HZA5	Acidithiobacillus_phage	38.1	6.8e-72
WP_052275155.1|2442130_2442673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082802280.1|2442650_2444099_+|terminase	phage terminase large subunit	terminase	A0A218MNA2	uncultured_virus	31.7	9.4e-50
WP_062628243.1|2445062_2449154_-	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_169798737.1|2449165_2451364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004689.1|2452497_2454204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004690.1|2454200_2457128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004691.1|2457124_2458378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052275157.1|2458378_2458813_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_039004692.1|2458816_2459644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052275158.1|2459647_2460760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156477464.1|2460756_2461086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052275159.1|2461089_2461752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004693.1|2461748_2461982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052275160.1|2461978_2463334_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_039004694.1|2463330_2464335_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_039004695.1|2464338_2465139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004698.1|2465135_2465870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039004700.1|2465882_2466368_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_039004701.1|2466397_2467930_-|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	24.0	3.3e-21
WP_039004704.1|2468423_2469131_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	30.5	1.2e-21
>prophage 6
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	3136253	3147004	4329554		Enterobacteria_phage(50.0%)	7	NA	NA
WP_039004347.1|3136253_3137294_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.4	1.4e-92
WP_039004346.1|3137290_3138130_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	40.1	7.4e-39
WP_039004345.1|3138132_3139005_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.9	2.2e-94
WP_039004344.1|3139663_3143356_+	vitamin B12-dependent ribonucleotide reductase	NA	A0A1X9SGV9	Bradyrhizobium_phage	55.6	0.0e+00
WP_039004343.1|3143623_3144190_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_039004342.1|3144203_3145958_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	28.2	3.1e-47
WP_039004341.1|3146254_3147004_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	3.7e-05
>prophage 7
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	3551357	3603866	4329554	transposase,integrase	Enterobacteria_phage(42.86%)	39	3567571:3567592	3601575:3601596
WP_039003157.1|3551357_3552269_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169798750.1|3552301_3552799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062628334.1|3552869_3553244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156477507.1|3553276_3553648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062628336.1|3554014_3554392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062628337.1|3554680_3555061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052274659.1|3555592_3555904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052274658.1|3556548_3556848_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_039000938.1|3556884_3558309_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_039000937.1|3558331_3559138_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_082802349.1|3559127_3560039_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039000933.1|3561076_3562237_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039000931.1|3562379_3563288_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062628338.1|3563703_3564510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039000928.1|3564544_3565939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156477508.1|3565935_3567162_-	hypothetical protein	NA	NA	NA	NA	NA
3567571:3567592	attL	ATGTTGGCCCATGGGCCAACAT	NA	NA	NA	NA
WP_062628126.1|3567616_3568369_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	2.2e-42
WP_062628125.1|3568365_3569862_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_062628339.1|3570192_3574266_-	DUF1998 domain-containing protein	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.0	2.3e-24
WP_082802350.1|3574346_3576380_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	26.2	3.4e-21
WP_156477509.1|3576270_3579444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156477510.1|3580766_3581789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062628112.1|3581875_3583447_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.3	7.2e-96
WP_039000107.1|3583501_3583855_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_039000108.1|3583851_3584235_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_039001013.1|3584961_3585330_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_039001006.1|3585494_3586643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052274672.1|3587582_3588098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052274673.1|3588174_3588690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039001007.1|3589160_3589586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039001008.1|3590019_3593412_+	DEAD/DEAH box helicase	NA	J2YAJ8	Acanthamoeba_polyphaga_lentillevirus	29.2	1.2e-39
WP_039001009.1|3593419_3593914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039001010.1|3594306_3595362_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.4	1.4e-15
WP_156477511.1|3597718_3599179_+	multidrug transporter	NA	NA	NA	NA	NA
WP_062628342.1|3599676_3600318_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_169798751.1|3600758_3601046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082802439.1|3601301_3601409_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_062628126.1|3601620_3602373_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.9	2.2e-42
3601575:3601596	attR	ATGTTGGCCCATGGGCCAACAT	NA	NA	NA	NA
WP_062628125.1|3602369_3603866_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	3868070	3904206	4329554	transposase,integrase	Tetraselmis_virus(20.0%)	33	3862922:3862936	3914556:3914570
3862922:3862936	attL	AGAAAAAATTGACCC	NA	NA	NA	NA
WP_082802443.1|3868070_3869831_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_052274661.1|3869831_3871667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169798759.1|3872146_3872518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169798760.1|3872491_3873265_+	AAA family ATPase	NA	A0A0R6PGP8	Moraxella_phage	25.8	2.5e-09
WP_156477400.1|3873651_3874609_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	24.7	2.1e-13
WP_052274663.1|3875093_3876884_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_039000970.1|3877060_3879523_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.5	1.0e-43
WP_039000969.1|3879569_3879926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039000968.1|3879922_3880843_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_039000973.1|3881112_3882057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039000967.1|3882143_3883421_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_052274662.1|3883714_3884263_+	hypothetical protein	NA	A0A1D7XFL1	Escherichia_phage	33.1	8.6e-12
WP_039000966.1|3884190_3884904_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.8	3.2e-19
WP_156477400.1|3885316_3886274_+|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	24.7	2.1e-13
WP_169798761.1|3886271_3886409_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_039000978.1|3886640_3886931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039000977.1|3886927_3887593_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_052274667.1|3888170_3888491_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_156477525.1|3888788_3889382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052274666.1|3889326_3889851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039002764.1|3891480_3893097_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_082802444.1|3893140_3893551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039002763.1|3893973_3894879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052274893.1|3894875_3895787_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_179946770.1|3895943_3897059_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	8.3e-38
WP_039002760.1|3897119_3897959_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_039002759.1|3897978_3898476_+	GreA/GreB family elongation factor	NA	NA	NA	NA	NA
WP_062628364.1|3898886_3900014_+	alanine--glyoxylate aminotransferase family protein	NA	A0A0N9QIZ2	Chrysochromulina_ericina_virus	41.0	2.2e-78
WP_039003726.1|3901051_3902695_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	58.2	7.2e-171
WP_039003725.1|3902739_3903027_-	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	56.5	2.6e-20
WP_156477526.1|3903260_3903407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156477527.1|3903588_3903828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156477528.1|3903915_3904206_+|integrase	integrase	integrase	NA	NA	NA	NA
3914556:3914570	attR	AGAAAAAATTGACCC	NA	NA	NA	NA
>prophage 9
NZ_CP014327	Halocynthiibacter arcticus strain PAMC 20958 chromosome, complete genome	4329554	4145705	4215238	4329554	transposase,integrase	Planktothrix_phage(22.22%)	59	4184313:4184372	4211415:4211516
WP_062628194.1|4145705_4146761_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_039003277.1|4146844_4147573_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_039003278.1|4147577_4148711_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_052274949.1|4148707_4149658_-	ROK family protein	NA	NA	NA	NA	NA
WP_039003279.1|4149654_4150722_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_039003280.1|4151718_4152855_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_039003281.1|4152851_4153949_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	9.4e-26
WP_179946750.1|4155250_4156750_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_039003282.1|4156917_4157673_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039003283.1|4157673_4159458_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_039003305.1|4160519_4161644_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_039003284.1|4161653_4162364_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039003306.1|4162476_4163631_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039003285.1|4163630_4164521_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_039003286.1|4164520_4165024_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_039003287.1|4165070_4165661_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_039003288.1|4165660_4166950_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_039003289.1|4166976_4168035_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_039003290.1|4168088_4168559_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_039003291.1|4168571_4169849_+	methylamine utilization protein MauG	NA	NA	NA	NA	NA
WP_039003292.1|4170178_4171483_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_039003293.1|4171547_4172429_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_039003294.1|4172437_4173322_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_039003295.1|4173332_4174379_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	2.9e-24
WP_039003296.1|4174375_4175368_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_156477534.1|4175456_4175615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039003299.1|4176572_4176932_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_039003307.1|4176928_4177138_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_062628146.1|4177630_4178791_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.0	2.0e-42
WP_052275048.1|4178787_4179984_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_052275049.1|4180107_4180332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039003817.1|4181207_4181387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052275051.1|4181897_4182440_-	acetyltransferase	NA	NA	NA	NA	NA
WP_039003820.1|4182703_4183252_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_052275050.1|4183656_4184358_-	hypothetical protein	NA	NA	NA	NA	NA
4184313:4184372	attL	CCAAGTCGAAGCGATGACGCTTGCGGATCGGATTGTCGTGCTCAATGGCGGAAACGTCGA	NA	NA	NA	NA
WP_156477535.1|4184657_4184900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062628384.1|4185078_4185831_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	38.5	2.9e-42
WP_039000982.1|4188748_4189639_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_039000990.1|4189653_4193097_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	22.2	4.6e-26
WP_039000983.1|4193284_4194307_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_039000984.1|4194359_4194785_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039000985.1|4194777_4194984_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_039000986.1|4195076_4195997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082802379.1|4196777_4197203_+	GFA family protein	NA	NA	NA	NA	NA
WP_052274668.1|4197600_4198041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039000989.1|4198285_4198807_+	DUF1775 domain-containing protein	NA	NA	NA	NA	NA
WP_052274669.1|4198912_4200472_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_062628388.1|4200777_4201965_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.4	1.4e-80
WP_062628389.1|4202372_4203587_+|integrase	site-specific integrase	integrase	Q5QF66	Pseudomonas_virus	24.6	6.8e-09
WP_062628390.1|4203702_4204791_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039000370.1|4204871_4206134_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_039000371.1|4206130_4207687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039000372.1|4207722_4208985_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039000373.1|4209055_4210003_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_039000374.1|4209999_4210830_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_039000375.1|4210833_4211841_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.1e-25
4211415:4211516	attR	CCAAGTCGAAGCGATGACGCTTGCGGATCGGATTGTCGTGCTCAATGGCGGAAACGTCGAACAGGTTGGCTCTCCGATGGAGCTATATGAAAACCCTGCGAG	NA	NA	NA	NA
WP_039000376.1|4211849_4212860_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_082802380.1|4212972_4213773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039000377.1|4214302_4215238_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.8	2.8e-26
>prophage 1
NZ_CP014328	Halocynthiibacter arcticus strain PAMC 20958 plasmid unnamed, complete sequence	46566	0	2556	46566		Ralstonia_phage(100.0%)	2	NA	NA
WP_039003166.1|1195_1501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062628418.1|2001_2556_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	53.1	8.3e-39
>prophage 2
NZ_CP014328	Halocynthiibacter arcticus strain PAMC 20958 plasmid unnamed, complete sequence	46566	12015	14467	46566	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_156477579.1|12015_13150_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	31.5	7.7e-23
WP_039000072.1|13215_13482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039000070.1|13867_14467_+	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	40.9	4.8e-24
>prophage 3
NZ_CP014328	Halocynthiibacter arcticus strain PAMC 20958 plasmid unnamed, complete sequence	46566	24039	32764	46566	transposase	Halorubrum_phage(33.33%)	7	NA	NA
WP_052274563.1|24039_25767_-	Eco57I restriction-modification methylase domain-containing protein	NA	Q8V6N5	Halorubrum_phage	23.3	2.3e-18
WP_039000029.1|26134_27310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169798778.1|27312_28683_-	AAA family ATPase	NA	O03951	Escherichia_phage	26.2	5.5e-15
WP_039000028.1|28723_29635_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039000027.1|30114_30888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039000026.1|31208_31418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039002321.1|31516_32764_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	43.8	3.4e-88
>prophage 4
NZ_CP014328	Halocynthiibacter arcticus strain PAMC 20958 plasmid unnamed, complete sequence	46566	45158	46310	46566	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_039002466.1|45158_46310_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.0e-38
