The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	27381	70136	4134593	tRNA,transposase	Synechococcus_phage(50.0%)	43	NA	NA
WP_010929577.1|27381_28332_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28413_28749_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28773_29208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247164.1|29240_30458_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30463_30961_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31168_32104_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32313_33105_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33147_34569_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_005012067.1|34724_35675_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35671_36862_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37111_38023_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|38024_40163_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40159_40699_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40702_41431_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41417_42311_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003814410.1|42381_42777_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42786_43317_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_023997043.1|43445_43745_-	DUF1974 domain-containing protein	NA	NA	NA	NA	NA
WP_010930208.1|43762_44713_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45298_45847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45818_46055_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46182_47076_+	membrane protein	NA	NA	NA	NA	NA
WP_010929590.1|48245_49493_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49489_50104_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_005012067.1|50239_51190_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51232_52489_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_014906036.1|52600_53665_+	porin	NA	NA	NA	NA	NA
WP_010929592.1|53722_54457_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54462_55053_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|55077_55767_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55763_56525_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56604_57504_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57597_58548_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59348_60575_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010929596.1|60574_60994_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61177_62119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62542_63517_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63573_64155_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64167_64470_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64588_65647_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65681_66953_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67582_68764_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|69185_70136_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	185440	243944	4134593	tRNA,transposase	Planktothrix_phage(22.22%)	53	NA	NA
WP_014486111.1|185440_186391_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929608.1|186387_188262_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
WP_003807102.1|189609_190314_-	DUF2837 family protein	NA	NA	NA	NA	NA
WP_003807104.1|190310_191417_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010929610.1|191678_192272_-	sugar transferase	NA	NA	NA	NA	NA
WP_023853419.1|192268_193456_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_010929612.1|193518_194778_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010929613.1|194801_195890_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
WP_010929614.1|195897_196998_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
WP_003807114.1|197001_197577_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003807115.1|197580_198633_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_010929615.1|198763_199771_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_010929616.1|199772_201059_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_010929617.1|201255_202059_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_010929618.1|202055_202922_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010929619.1|202996_204127_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003807131.1|204126_204966_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
WP_010930208.1|205079_206030_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929620.1|206947_207550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929621.1|207579_208233_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003807138.1|208365_209622_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	6.2e-66
WP_023853421.1|209702_210569_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003818417.1|210644_210920_+	YbeD family protein	NA	NA	NA	NA	NA
WP_010929623.1|210927_211590_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003807146.1|211651_212653_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003807148.1|212667_213216_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
WP_010929624.1|213273_214170_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_010929625.1|214166_215228_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
WP_010929626.1|215263_216214_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929627.1|217113_218307_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010929628.1|218388_219018_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010927242.1|219079_219763_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|219772_221455_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815933.1|221742_222090_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_003815930.1|222180_222498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930525.1|222780_223797_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815929.1|223872_224673_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003815927.1|224669_225545_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019248181.1|225555_226848_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929634.1|226890_227931_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929635.1|228036_228858_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005012067.1|228958_229909_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905488.1|230007_230913_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
WP_003815918.1|230909_231743_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010929637.1|232579_233590_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_019247800.1|233586_233976_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929638.1|234869_236123_+	amidase	NA	NA	NA	NA	NA
WP_010929639.1|236213_237914_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_010929640.1|238340_238988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050457416.1|238986_240426_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_023853394.1|240536_240821_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010929512.1|240848_241727_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|242993_243944_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	272726	318707	4134593	tRNA,transposase	Diachasmimorpha_longicaudata_entomopoxvirus(14.29%)	38	NA	NA
WP_010930892.1|272726_273677_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929659.1|275120_276023_-	YgcG family protein	NA	NA	NA	NA	NA
WP_003815889.1|276000_276630_-	LemA family protein	NA	NA	NA	NA	NA
WP_010929660.1|276912_278343_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
WP_010929661.1|278376_279006_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003815895.1|279054_280662_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
WP_010929663.1|280686_281370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815898.1|281451_281928_-	bacterioferritin	NA	NA	NA	NA	NA
WP_010929664.1|284201_284729_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_010929665.1|284820_285636_+	META and DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_003808370.1|285696_286431_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_010929666.1|286468_288547_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
WP_003808374.1|288796_289069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446322.1|289170_290256_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010929668.1|290259_292164_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_014486044.1|292160_295835_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_010929670.1|295895_296459_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
WP_003808385.1|296466_296889_-	glyoxalase	NA	NA	NA	NA	NA
WP_010929671.1|296916_297336_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_077274090.1|297364_297811_-	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	29.4	1.2e-08
WP_003808391.1|297937_298435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808393.1|298589_300860_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_019249381.1|300935_302141_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|302239_303190_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|303288_304239_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929673.1|304341_304977_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
WP_010929674.1|304973_305867_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_010929675.1|306261_307362_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_010929676.1|307443_307818_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_010929677.1|307877_310742_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
WP_010929678.1|310886_311627_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929679.1|311696_312908_+	CoA transferase	NA	NA	NA	NA	NA
WP_162483239.1|313276_313579_+	MerR family DNA-binding protein	NA	NA	NA	NA	NA
WP_005012067.1|313677_314628_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930048.1|314726_315677_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818201.1|316225_316600_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929807.1|316674_317733_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|317756_318707_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	340996	347345	4134593	integrase	Acinetobacter_phage(16.67%)	10	338284:338306	353100:353122
338284:338306	attL	GCGCTGCAGGCCAGCCTGGCCGA	NA	NA	NA	NA
WP_010929843.1|340996_341986_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010926403.1|341982_342183_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929845.1|342295_342637_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_019247983.1|342647_343832_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929847.1|343868_344396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929848.1|344453_345101_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929849.1|345097_346084_-	DNA recombinase	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010926410.1|346087_346270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|346266_346644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929850.1|346877_347345_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
353100:353122	attR	GCGCTGCAGGCCAGCCTGGCCGA	NA	NA	NA	NA
>prophage 5
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	449874	495474	4134593	tail,tRNA,transposase	uncultured_Caudovirales_phage(25.0%)	53	NA	NA
WP_005012067.1|449874_450825_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929970.1|452258_453545_+	membrane protein	NA	NA	NA	NA	NA
WP_010929971.1|453710_454019_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446243.1|454040_454685_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.5e-11
WP_003807038.1|454725_456516_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_010929972.1|456628_457489_+	endonuclease	NA	NA	NA	NA	NA
WP_077598842.1|457485_458565_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_005015810.1|458544_459495_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033461521.1|459512_459740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929974.1|459736_460621_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033446233.1|462137_462572_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_039249767.1|462534_463533_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247922.1|464662_465220_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247923.1|465195_465546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814657.1|465714_466509_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_010931416.1|466505_467555_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814652.1|467554_468244_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003814650.1|468330_468828_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_010931417.1|468859_470176_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_010931418.1|470192_471167_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003814643.1|471203_471662_-	protein TolR	NA	NA	NA	NA	NA
WP_003814641.1|471661_472342_-	protein TolQ	NA	NA	NA	NA	NA
WP_010931419.1|472344_472773_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814636.1|472825_474556_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_003814635.1|474621_475194_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_010931420.1|475174_475861_+	response regulator	NA	NA	NA	NA	NA
WP_010931421.1|476216_476888_+	SOS response-associated peptidase	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
WP_010931422.1|477216_477438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926433.1|477437_477719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931423.1|477715_478231_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_010931424.1|478230_478782_-	lysozyme	NA	NA	NA	NA	NA
WP_010931425.1|478760_479003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931426.1|479007_479820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926428.1|479819_480083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124740660.1|480123_480321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931428.1|480301_480718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931429.1|480722_484679_-	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
WP_010931430.1|484671_485061_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931431.1|485057_485591_-	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931432.1|485658_486018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931433.1|486027_488640_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931434.1|488665_488956_-	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_003813412.1|488973_489303_-	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931435.1|489312_489831_-	hypothetical protein	NA	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_010931436.1|490085_490586_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931437.1|490593_491016_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931438.1|491012_491411_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931439.1|491407_491803_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_162096760.1|491802_491991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|492004_492487_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931442.1|492549_492801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929956.1|493475_494426_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|494523_495474_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	617991	729556	4134593	tRNA,protease,transposase,terminase	Bacillus_phage(17.65%)	105	NA	NA
WP_076879541.1|617991_618942_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446133.1|619417_620308_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_010931496.1|620304_621126_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_019247235.1|621325_621817_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_019247236.1|621835_622909_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_023853086.1|622955_624059_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_003808577.1|624134_624755_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003808574.1|624775_625285_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.1	1.2e-28
WP_003808570.1|625339_625591_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.4	1.6e-18
WP_010931494.1|625654_626788_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_003808567.1|626795_627182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931493.1|627178_629698_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003808563.1|630126_630465_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003808562.1|630461_630968_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_010931492.1|631029_631830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931491.1|631940_632882_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931490.1|632975_634511_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931489.1|636190_638041_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-17
WP_003808549.1|638044_638878_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931488.1|638877_639819_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929956.1|640129_641080_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931487.1|641119_642091_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039249903.1|642232_644521_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003808542.1|644827_645736_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010931485.1|645790_646756_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931484.1|646830_648492_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010931483.1|648563_649274_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|649422_650373_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814152.1|651071_651455_+	membrane protein	NA	NA	NA	NA	NA
WP_010927005.1|651512_652115_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_003820995.1|652132_652534_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010931482.1|652649_653561_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814161.1|653557_654139_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003814165.1|654933_655668_+	arginyltransferase	NA	NA	NA	NA	NA
WP_010931480.1|655708_656758_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003814172.1|656905_657484_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_010931479.1|657870_658848_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_019248367.1|658941_663336_-	dermonecrotic toxin	NA	NA	NA	NA	NA
WP_003814178.1|663536_664385_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931477.1|664543_665356_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015810.1|665411_666362_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931453.1|666460_667261_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_003814185.1|667322_667706_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_033446148.1|667717_669070_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	2.1e-51
WP_003814188.1|669357_669687_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_033462323.1|669689_670439_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010931456.1|670621_671542_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_003814195.1|671588_671801_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931457.1|671823_672246_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_010931458.1|672262_673363_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931459.1|673459_674977_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003814203.1|675052_675892_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_033446149.1|675913_676786_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814206.1|676876_677971_-	porin	NA	NA	NA	NA	NA
WP_010931401.1|678231_679182_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|679280_680231_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814209.1|680314_680674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931461.1|681055_682093_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_010931462.1|682409_683750_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931463.1|683759_684212_-	membrane protein	NA	NA	NA	NA	NA
WP_003814217.1|684308_685490_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_023995141.1|685555_686581_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003814221.1|686621_686861_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931464.1|686930_688520_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_010931465.1|688519_689068_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003814226.1|689148_689721_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010927008.1|689739_690651_-	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814230.1|690724_691693_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010931466.1|691815_692889_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_010931467.1|692893_694714_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_005015810.1|694790_695741_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446132.1|695829_696165_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003819076.1|696298_696949_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_010931468.1|696970_698389_-	amidase	NA	NA	NA	NA	NA
WP_019248554.1|698458_699214_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247734.1|699182_699941_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014905407.1|699951_700833_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931472.1|700849_701557_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_010931473.1|701559_702318_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931474.1|702527_704270_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010925795.1|704262_704787_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931475.1|704826_705621_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248926.1|705788_706862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|706960_707911_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247378.1|708162_708369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931451.1|708440_709052_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_023853179.1|709606_709858_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_161633094.1|709850_710540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|710796_711747_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247942.1|712386_712872_+|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_010931447.1|712858_714136_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_010931446.1|714138_715557_+	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931445.1|715585_716641_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931444.1|716646_716889_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931443.1|717011_717614_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_019248169.1|720156_721872_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.1	9.1e-60
WP_003814006.1|721882_722374_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_010930015.1|722446_723463_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|723630_724410_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003814003.1|724428_724956_-	lipoprotein	NA	NA	NA	NA	NA
WP_005019401.1|724954_725161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814002.1|725249_725519_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003821234.1|725609_727769_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003814000.1|727889_728609_+	lipoprotein	NA	NA	NA	NA	NA
WP_005013747.1|728605_729556_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	970645	1020241	4134593	holin,tRNA,transposase	uncultured_Mediterranean_phage(50.0%)	41	NA	NA
WP_005012067.1|970645_971596_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811933.1|971894_972632_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_010930143.1|973067_973391_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811929.1|973425_973986_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003811927.1|974106_974982_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003817154.1|974994_975942_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_019247393.1|976043_976337_+	response regulator	NA	NA	NA	NA	NA
WP_039250083.1|976363_978421_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003811919.1|978435_978936_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930145.1|979009_980716_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
WP_010930146.1|981579_982632_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_003811911.1|982684_983074_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_003817162.1|983082_983715_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_010930525.1|983814_984831_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003819773.1|985661_986669_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014486064.1|986665_988309_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_010930149.1|988305_989193_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003809396.1|989333_989807_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930151.1|989796_990819_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_015041211.1|990815_992243_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010930525.1|993180_994197_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003809411.1|994528_995464_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
WP_010930154.1|995513_997394_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003809416.1|997460_997805_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
WP_010930155.1|997949_999086_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_023853534.1|999082_1000156_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003809423.1|1000313_1001750_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010930157.1|1001840_1002482_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010930525.1|1002816_1003833_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_033461720.1|1004165_1006898_+	pertactin autotransporter	NA	NA	NA	NA	NA
WP_010930160.1|1006964_1008386_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003809431.1|1008649_1009366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809432.1|1009450_1009768_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003819794.1|1009808_1010222_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010930161.1|1010223_1010583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853525.1|1010625_1012170_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930163.1|1012253_1013084_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_010930164.1|1013118_1014273_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930165.1|1014315_1015188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809441.1|1018799_1019264_+	barstar family protein	NA	NA	NA	NA	NA
WP_005013747.1|1019290_1020241_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	1035494	1102833	4134593	tRNA,transposase	Catovirus(28.57%)	47	NA	NA
WP_005012067.1|1035494_1036445_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633091.1|1037025_1037733_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_003812707.1|1038091_1039078_-	homoserine kinase	NA	NA	NA	NA	NA
WP_010930178.1|1039217_1040231_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005012067.1|1040227_1041178_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812703.1|1041290_1041749_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|1041785_1043099_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_010930180.1|1043116_1043488_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_010930182.1|1045089_1045818_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_019248112.1|1045799_1048649_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1048861_1049812_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248175.1|1049979_1050804_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_010930185.1|1050803_1051682_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930186.1|1052586_1053702_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699602.1|1053730_1054525_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930188.1|1054521_1056387_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_003812436.1|1056465_1057098_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930189.1|1057094_1057397_-	membrane protein	NA	NA	NA	NA	NA
WP_010930190.1|1057439_1058960_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
WP_010926447.1|1058966_1059722_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010926448.1|1059751_1060856_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010930191.1|1060958_1062659_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.3e-50
WP_010930192.1|1062640_1063618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247537.1|1063627_1064908_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003812422.1|1064900_1065596_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
WP_010928340.1|1065629_1066457_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_019248079.1|1066738_1069969_+	autotransporter SphB3	NA	NA	NA	NA	NA
WP_010930196.1|1070704_1074631_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_029443925.1|1074803_1077278_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_019248398.1|1077277_1078246_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816844.1|1078315_1079161_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_003812405.1|1079228_1079783_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_010930198.1|1079829_1080780_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_095585339.1|1080878_1081511_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010930200.1|1081682_1083965_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930201.1|1084119_1086816_-	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_010930202.1|1086941_1087430_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813631.1|1089840_1092711_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_010930204.1|1092756_1093971_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813626.1|1094200_1095628_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_023853245.1|1095725_1096817_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_010930206.1|1096829_1097588_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003813621.1|1097675_1098578_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1098574_1099525_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930207.1|1099654_1100638_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813618.1|1100692_1101415_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930208.1|1101882_1102833_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	1457518	1513012	4134593	tRNA,transposase	Streptococcus_virus(16.67%)	47	NA	NA
WP_010930416.1|1457518_1458007_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_010930417.1|1458124_1458703_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010930418.1|1458808_1459177_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023994932.1|1459183_1460296_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_010930419.1|1460982_1462185_+	MFS transporter	NA	NA	NA	NA	NA
WP_010930420.1|1462388_1465049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930421.1|1465061_1468466_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_023995689.1|1469132_1471358_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
WP_010930423.1|1471404_1471731_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010930424.1|1471781_1472390_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_010931070.1|1472488_1473439_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|1473536_1474487_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930425.1|1474556_1475321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446226.1|1475317_1475854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930427.1|1476020_1476872_-	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
WP_010928449.1|1476931_1477558_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_010929577.1|1477554_1478505_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809954.1|1479397_1480303_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_023994740.1|1480320_1481442_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_010930436.1|1481530_1482145_-	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930435.1|1482804_1483992_-	cupin	NA	NA	NA	NA	NA
WP_033446228.1|1483988_1486586_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
WP_010930433.1|1486840_1487056_+	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_010930432.1|1487511_1488066_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
WP_010930431.1|1488333_1488894_+	membrane protein	NA	NA	NA	NA	NA
WP_023853587.1|1489005_1490310_+	imelysin	NA	NA	NA	NA	NA
WP_019247498.1|1490306_1491818_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_019248041.1|1491923_1492925_+	imelysin family protein	NA	NA	NA	NA	NA
WP_019249265.1|1492914_1494027_+	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|1494125_1495076_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809983.1|1495181_1496015_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_010930623.1|1496028_1496787_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930624.1|1496948_1497941_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930625.1|1498158_1498935_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_010930626.1|1499042_1499825_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003809992.1|1499951_1501538_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.0	1.9e-35
WP_010930627.1|1501562_1502426_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_020699633.1|1502633_1503413_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_003809999.1|1503405_1503915_-	cyclophilin	NA	NA	NA	NA	NA
WP_010930629.1|1504043_1504727_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930630.1|1504966_1506427_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	27.9	2.5e-34
WP_003820119.1|1506446_1507091_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_003810007.1|1507127_1508093_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_010930742.1|1508191_1509142_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443761.1|1509202_1510237_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_010930633.1|1510336_1511602_+	aspartate kinase	NA	NA	NA	NA	NA
WP_010929632.1|1511995_1513012_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	1913695	1970993	4134593	transposase	Pseudomonas_phage(33.33%)	49	NA	NA
WP_005012808.1|1913695_1914646_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|1914744_1915482_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|1915671_1916430_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|1916476_1917466_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|1917643_1918612_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|1920151_1921120_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|1921128_1922070_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1922543_1923554_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|1923544_1925059_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_039250293.1|1925055_1926402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930475.1|1926404_1927439_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|1927488_1929114_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_010929591.1|1929666_1930617_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|1930721_1931669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|1931722_1933537_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|1933529_1934204_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023995112.1|1934333_1937408_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_019247905.1|1937421_1937721_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|1938035_1938659_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010930493.1|1938902_1939772_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|1939749_1940694_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|1940779_1941706_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|1941818_1942598_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|1942588_1943785_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_019248077.1|1943815_1944766_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|1944987_1945677_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|1945741_1946497_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|1946548_1947541_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|1947550_1948504_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|1948619_1949582_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|1950983_1951412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1951408_1952359_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930503.1|1952652_1953375_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1953813_1955001_-	MFS transporter	NA	NA	NA	NA	NA
WP_010930505.1|1955004_1955355_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1957104_1958076_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1958089_1958803_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1958807_1959725_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1959831_1960128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065465821.1|1960226_1961177_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930509.1|1962335_1965269_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_003810969.1|1965268_1965613_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_004568496.1|1965609_1967238_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_010930510.1|1967234_1967714_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_033446177.1|1967713_1967995_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_010930511.1|1967991_1968318_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005013747.1|1968473_1969424_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247780.1|1969467_1970010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|1970042_1970993_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	2021221	2086778	4134593	tRNA,protease,transposase	Lake_Baikal_phage(20.0%)	58	NA	NA
WP_076879559.1|2021221_2022172_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930538.1|2022168_2022642_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446178.1|2022803_2023742_+	membrane protein	NA	NA	NA	NA	NA
WP_010930540.1|2023743_2024952_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_010930541.1|2025056_2025563_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930542.1|2025565_2028427_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930543.1|2028416_2029382_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_076879560.1|2029441_2031442_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.0	9.7e-21
WP_005012067.1|2031540_2032491_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930545.1|2032487_2032862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812548.1|2033123_2034332_+	aminotransferase	NA	NA	NA	NA	NA
WP_003812546.1|2034328_2036629_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
WP_010926400.1|2036681_2039294_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033446179.1|2039653_2041561_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
WP_010930547.1|2041575_2042472_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010930548.1|2042478_2043618_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_003812536.1|2043617_2044439_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_010930549.1|2046009_2046339_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010930550.1|2046721_2047978_+	autotransporter Phg	NA	NA	NA	NA	NA
WP_003812526.1|2048054_2048336_+	membrane protein	NA	NA	NA	NA	NA
WP_003812524.1|2048377_2048698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930551.1|2049004_2049208_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
WP_003812519.1|2049291_2049858_+	DUF924 family protein	NA	NA	NA	NA	NA
WP_010930553.1|2050203_2050404_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
WP_076879561.1|2050515_2051094_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
WP_010930555.1|2051272_2052583_+	trigger factor	NA	NA	NA	NA	NA
WP_003812508.1|2052585_2053239_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
WP_010930556.1|2053343_2054648_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
WP_010930557.1|2054836_2057290_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
WP_019247936.1|2057413_2058364_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930559.1|2058591_2059815_+	CoA transferase	NA	NA	NA	NA	NA
WP_010930560.1|2059880_2060852_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930561.1|2060918_2061320_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019248062.1|2061333_2062137_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003812491.1|2062133_2062565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930563.1|2062561_2063719_+	thiolase	NA	NA	NA	NA	NA
WP_010930564.1|2063740_2064517_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930565.1|2066729_2067398_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_003812478.1|2067390_2068032_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_019248063.1|2068066_2068798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247934.1|2068815_2069028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2069598_2070549_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930566.1|2072106_2072757_-	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
WP_010930567.1|2072885_2074088_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010930568.1|2074165_2076202_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_010930569.1|2076454_2076946_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_003812463.1|2077161_2077674_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_010930570.1|2077691_2078903_+	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_003812460.1|2078940_2079351_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
WP_003812458.1|2079352_2079676_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
WP_003812456.1|2079678_2080191_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_010930571.1|2080320_2082183_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	3.0e-101
WP_003812453.1|2082192_2082534_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003812452.1|2082533_2082728_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_010930572.1|2082852_2083746_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005013747.1|2083742_2084693_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|2084817_2085627_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005015810.1|2085827_2086778_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	2129946	2149841	4134593	tRNA,transposase	Salmonella_phage(33.33%)	22	NA	NA
WP_005012067.1|2129946_2130897_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931011.1|2130893_2131928_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003816758.1|2132036_2132675_+	DedA family protein	NA	NA	NA	NA	NA
WP_019247724.1|2132969_2133197_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003820420.1|2133319_2134033_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010931070.1|2134277_2135228_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816756.1|2135422_2135872_+	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
WP_010929584.1|2135868_2136819_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931008.1|2136929_2138378_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_023853496.1|2138492_2138738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879566.1|2138877_2139828_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929584.1|2139925_2140876_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812834.1|2141211_2141409_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003812832.1|2141424_2141784_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_010926359.1|2141858_2142881_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.6	1.0e-26
WP_010931007.1|2142893_2145311_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_023852697.1|2145328_2145658_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	2.7e-13
WP_003812822.1|2145716_2146127_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931005.1|2146626_2147718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931004.1|2147901_2148498_+	lipoprotein	NA	NA	NA	NA	NA
WP_004567479.1|2148597_2148780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929591.1|2148890_2149841_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	2466893	2530958	4134593	tRNA,protease,transposase	Pseudomonas_phage(30.0%)	55	NA	NA
WP_005012067.1|2466893_2467844_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931247.1|2467942_2468806_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_010931246.1|2468802_2469702_-	TonB family protein	NA	NA	NA	NA	NA
WP_019248069.1|2469739_2471623_-	RNB domain-containing ribonuclease	NA	NA	NA	NA	NA
WP_010931244.1|2471694_2472288_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003814955.1|2472298_2473669_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_023853327.1|2473751_2474300_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003814953.1|2474378_2474813_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_003814952.1|2474902_2475352_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003814951.1|2475361_2476708_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010931242.1|2477673_2478771_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_010931241.1|2478782_2479724_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_010931240.1|2479896_2480400_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003814943.1|2480680_2480920_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_080478561.1|2480897_2482307_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_010931239.1|2482436_2483564_+	membrane-bound O-acyltransferase	NA	A0A125RNP0	Pseudomonas_phage	30.8	3.7e-25
WP_023853325.1|2483583_2485038_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	25.1	7.3e-26
WP_023853329.1|2485045_2485606_-	YggT family protein	NA	NA	NA	NA	NA
WP_010931236.1|2485759_2486287_-	histone H1-like DNA-binding protein	NA	NA	NA	NA	NA
WP_003814929.1|2486604_2487801_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	28.9	1.0e-33
WP_010931235.1|2487822_2490750_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	43.9	3.4e-171
WP_019247415.1|2491055_2494118_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_003814925.1|2494679_2495132_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023998238.1|2495333_2495843_+	lipoprotein	NA	NA	NA	NA	NA
WP_010931233.1|2495911_2497099_+	MFS transporter	NA	NA	NA	NA	NA
WP_033446281.1|2497102_2498509_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010931231.1|2498644_2501104_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|2501100_2502051_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931230.1|2502149_2502824_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931229.1|2503120_2504617_+	membrane protein	NA	NA	NA	NA	NA
WP_003820592.1|2504733_2506122_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.5	4.6e-54
WP_003820593.1|2506227_2506617_+	VOC family protein	NA	NA	NA	NA	NA
WP_019248167.1|2506628_2507321_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_010931228.1|2507335_2508172_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931227.1|2508174_2508984_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	2.6e-33
WP_010931226.1|2510240_2510915_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023853313.1|2510928_2511480_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004567741.1|2511538_2512903_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004567739.1|2513244_2514342_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010927106.1|2514637_2515066_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_010931224.1|2515075_2515468_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003820599.1|2515656_2516721_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_010931223.1|2516757_2517504_+	membrane protein	NA	NA	NA	NA	NA
WP_003814883.1|2517591_2517963_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	56.9	4.7e-30
WP_010931222.1|2518032_2519169_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_010931221.1|2519174_2520590_-	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	46.9	1.9e-18
WP_005012067.1|2520681_2521632_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814877.1|2521899_2523129_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003820605.1|2523164_2523821_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003814873.1|2524037_2525285_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.7	1.1e-99
WP_003814871.1|2525442_2525925_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_023853315.1|2526919_2527483_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_047122802.1|2527688_2528813_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.3	3.8e-38
WP_005015810.1|2528958_2529909_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2530007_2530958_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	2595925	2729851	4134593	tRNA,transposase	Bacillus_virus(20.0%)	121	NA	NA
WP_003813026.1|2595925_2597041_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003813022.1|2597141_2597960_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010931185.1|2598057_2598669_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010931184.1|2598828_2600205_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.5	2.2e-109
WP_003813017.1|2600267_2600726_+	cytochrome c	NA	NA	NA	NA	NA
WP_003813013.1|2600810_2601506_-	cytochrome b561	NA	NA	NA	NA	NA
WP_003813010.1|2601567_2601849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931182.1|2602411_2603164_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003813006.1|2603208_2604285_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012067.1|2604281_2605232_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486100.1|2605334_2605997_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019249309.1|2606091_2606262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247599.1|2606614_2607616_+	amidase	NA	NA	NA	NA	NA
WP_003818702.1|2607618_2608815_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486098.1|2608835_2609639_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_019247598.1|2609719_2610016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247597.1|2610046_2610610_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014486097.1|2610650_2611508_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818698.1|2611515_2612265_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	6.2e-29
WP_014486096.1|2612286_2613159_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014486095.1|2613187_2613967_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486094.1|2614000_2614798_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003808978.1|2617452_2617845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486091.1|2617838_2618699_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003818691.1|2618702_2619665_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014486089.1|2620441_2621131_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.8e-12
WP_010930208.1|2621991_2622942_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931181.1|2623054_2623924_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010926062.1|2623994_2624690_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010931179.1|2624679_2625189_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010931178.1|2625185_2626406_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931177.1|2626353_2627256_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_023997744.1|2628141_2629428_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931176.1|2629466_2630840_+	amidase	NA	NA	NA	NA	NA
WP_010931175.1|2630878_2631580_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_010931174.1|2631878_2632868_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003809010.1|2632968_2633430_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931173.1|2633445_2633994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931172.1|2634135_2635611_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
WP_010931171.1|2635716_2636808_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010931170.1|2636811_2637594_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019248105.1|2637603_2638392_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.0	6.7e-34
WP_010931168.1|2639517_2639952_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_010931167.1|2639948_2640959_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003809025.1|2641002_2641929_-	VOC family protein	NA	NA	NA	NA	NA
WP_003809026.1|2642215_2642584_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|2642800_2643751_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931165.1|2643795_2646222_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.2e-86
WP_010931164.1|2646270_2646963_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
WP_010931163.1|2647035_2648235_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_003819549.1|2648252_2649158_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931162.1|2649273_2650203_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931161.1|2650228_2651575_+	MFS transporter	NA	NA	NA	NA	NA
WP_019247888.1|2651587_2652352_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.5	3.1e-12
WP_010931159.1|2652365_2653148_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|2653340_2654291_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931158.1|2654351_2655461_-	porin	NA	NA	NA	NA	NA
WP_003815281.1|2655973_2656810_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_010931157.1|2656936_2657845_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2657841_2658792_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|2659177_2659720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930176.1|2660755_2661706_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247402.1|2661947_2662316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248356.1|2662361_2663486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003820818.1|2664620_2665361_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931155.1|2665464_2666085_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931154.1|2666086_2668195_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003820814.1|2668339_2668999_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003820813.1|2669030_2669495_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_019248355.1|2669770_2669956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931153.1|2670007_2670760_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931152.1|2670766_2672029_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_023852748.1|2672070_2673309_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820806.1|2674386_2675514_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_003814524.1|2675524_2676352_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010931150.1|2676338_2677205_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010931149.1|2678571_2678976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446288.1|2679338_2680250_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003820799.1|2680264_2680975_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931147.1|2680971_2682216_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820797.1|2682217_2682652_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_003814535.1|2682680_2682986_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_010930176.1|2683350_2684301_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931144.1|2684832_2685630_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248416.1|2685677_2686331_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003814544.1|2686287_2687376_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_003814547.1|2687540_2689766_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_023852715.1|2692043_2692940_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005012067.1|2693060_2694011_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931141.1|2694007_2695699_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
WP_010931140.1|2695760_2696957_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003814552.1|2696970_2697849_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929220.1|2697955_2699002_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_003814554.1|2699065_2699476_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814555.1|2699486_2700959_+	magnesium transporter	NA	NA	NA	NA	NA
WP_010931139.1|2702101_2703253_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_003813114.1|2703400_2704411_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	3.6e-16
WP_010931138.1|2704581_2705547_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_033446289.1|2705721_2706552_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813109.1|2706638_2706905_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003820295.1|2706909_2707821_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_010931136.1|2707870_2709733_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003813103.1|2709889_2710687_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_010926331.1|2710906_2711287_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003813095.1|2711334_2711658_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_003813094.1|2711750_2712023_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_010931135.1|2712038_2712494_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_019248136.1|2712610_2713447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003813089.1|2713443_2714817_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	58.2	4.0e-135
WP_019248137.1|2714837_2715806_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003813085.1|2715885_2716863_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003813082.1|2716967_2718647_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	36.9	1.5e-70
WP_003813079.1|2718726_2719191_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003813077.1|2719193_2719646_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_010931132.1|2719862_2721050_+	alanine transaminase	NA	NA	NA	NA	NA
WP_003813074.1|2721046_2722351_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_010931131.1|2722347_2723754_+	threonine synthase	NA	NA	NA	NA	NA
WP_003813070.1|2723967_2724189_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_005012808.1|2724397_2725348_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812917.1|2725404_2726517_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|2728900_2729851_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	2739497	2790159	4134593	protease,transposase	uncultured_Mediterranean_phage(28.57%)	34	NA	NA
WP_005012067.1|2739497_2740448_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931120.1|2740615_2742007_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_010931119.1|2742079_2742658_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_019247560.1|2742774_2744172_+	chloride channel protein	NA	NA	NA	NA	NA
WP_010931117.1|2744287_2745493_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_003820399.1|2745592_2746111_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_003812875.1|2746205_2746451_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820400.1|2746678_2746993_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_023853340.1|2747091_2752272_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_010931115.1|2752268_2754437_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_010931114.1|2754492_2756808_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_003820402.1|2756812_2758132_+	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_014905522.1|2758150_2759824_+	MCE family protein	NA	NA	NA	NA	NA
WP_010931111.1|2759828_2760497_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010931110.1|2760653_2764475_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005015810.1|2764805_2765756_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812857.1|2765777_2766923_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|2767071_2768001_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812851.1|2767997_2769086_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_010931109.1|2769082_2769886_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812846.1|2769882_2770614_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931108.1|2770671_2771961_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931107.1|2772057_2772660_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812839.1|2777213_2777552_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931105.1|2778259_2778526_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012067.1|2780232_2781183_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931103.1|2781179_2782511_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931102.1|2783771_2785772_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003819722.1|2785764_2786406_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_003809276.1|2786402_2786810_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_010931101.1|2786806_2787607_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_010931100.1|2787681_2788386_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931099.1|2788417_2789212_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_010929956.1|2789208_2790159_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	2891236	2960792	4134593	transposase	Planktothrix_phage(33.33%)	58	NA	NA
WP_076879576.1|2891236_2892187_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811244.1|2892285_2892897_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930290.1|2893131_2894259_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930289.1|2894369_2895458_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
WP_003811259.1|2895510_2896362_-	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_003811262.1|2896381_2897263_-	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_010930288.1|2897439_2898753_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_003811267.1|2898963_2899797_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_010930287.1|2899793_2900375_+	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
WP_005015810.1|2900728_2901679_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930286.1|2901694_2902810_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003811272.1|2902912_2903839_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_010930285.1|2903838_2905077_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003811277.1|2905073_2905841_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
WP_003811279.1|2905841_2906543_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	7.8e-18
WP_019247793.1|2906624_2907071_-	glutamate racemase	NA	NA	NA	NA	NA
WP_010930283.1|2907960_2908599_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012808.1|2909367_2910318_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811293.1|2910539_2910917_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003811295.1|2911064_2911562_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_010930291.1|2911558_2912086_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003811298.1|2912219_2913035_+	exported protein	NA	NA	NA	NA	NA
WP_010930292.1|2913047_2914229_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003811301.1|2914276_2915170_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_010930293.1|2915296_2915767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930294.1|2915892_2916720_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_003811306.1|2916748_2917525_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_023852802.1|2917521_2917797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930295.1|2917811_2918276_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930296.1|2918287_2918989_-	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_003811310.1|2919098_2919599_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
WP_010930297.1|2919681_2920860_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_003811313.1|2922487_2922823_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930298.1|2923010_2924459_+	CoA transferase	NA	NA	NA	NA	NA
WP_023852799.1|2924516_2924861_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
WP_003811316.1|2924967_2925507_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_023852768.1|2926647_2927055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247530.1|2927287_2927719_-	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
WP_010930300.1|2927900_2928305_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010930301.1|2929541_2929865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926674.1|2929867_2930755_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003811322.1|2930787_2931213_-	universal stress protein	NA	NA	NA	NA	NA
WP_019247534.1|2931284_2931638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811324.1|2931877_2932384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930302.1|2932422_2933754_-	transcriptional regulator PtsJ	NA	NA	NA	NA	NA
WP_003811326.1|2933813_2934629_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010930303.1|2934625_2935480_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_019248253.1|2938542_2941107_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_010930305.1|2942473_2944228_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_010930306.1|2944224_2946345_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_010930307.1|2946349_2948545_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_010930308.1|2948541_2951883_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_010930208.1|2954685_2955636_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811361.1|2955701_2955881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247449.1|2955997_2956753_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010930310.1|2956739_2957885_-	DUF3182 family protein	NA	NA	NA	NA	NA
WP_005012067.1|2958792_2959743_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|2959841_2960792_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	3149933	3267173	4134593	tRNA,protease,holin,integrase,transposase	Staphylococcus_phage(12.5%)	96	3213743:3213761	3268441:3268459
WP_005012067.1|3149933_3150884_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446265.1|3152447_3153599_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003810297.1|3153967_3154204_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_010930711.1|3154267_3154435_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_023853105.1|3154548_3156444_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	2.3e-19
WP_010931070.1|3156607_3157558_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247822.1|3157834_3158272_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_003810260.1|3158394_3158907_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930709.1|3158903_3160106_+	MFS transporter	NA	NA	NA	NA	NA
WP_003818515.1|3160183_3162841_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.0	3.3e-173
WP_003810254.1|3162856_3163516_+	lipoprotein	NA	NA	NA	NA	NA
WP_003818514.1|3163518_3164574_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_010930708.1|3164695_3165955_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.7	1.1e-91
WP_003810249.1|3165951_3166347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930707.1|3166369_3167764_-	amidase family protein	NA	NA	NA	NA	NA
WP_010930706.1|3167945_3168893_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003810239.1|3168889_3169162_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_047122782.1|3169226_3169670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003820758.1|3176199_3176676_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931267.1|3176828_3177941_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_010931268.1|3178008_3178569_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_010929235.1|3178592_3178925_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010931269.1|3178908_3180597_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003820749.1|3180716_3181505_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_005012808.1|3182212_3183163_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814611.1|3183607_3183919_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003820745.1|3183918_3184449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3184611_3185562_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820744.1|3185851_3186316_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_010931270.1|3186330_3187836_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_010931271.1|3188089_3189697_+	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_003814620.1|3189752_3190658_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005013747.1|3191098_3192049_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818450.1|3192187_3192940_+	uracil-DNA glycosylase	NA	A0A1Y0B680	Bovine_alphaherpesvirus	47.5	2.5e-46
WP_023853440.1|3193214_3194903_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.6e-48
WP_004566001.1|3194922_3196182_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010931274.1|3196196_3197291_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	50.5	2.4e-50
WP_010931275.1|3197287_3199351_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	36.6	5.3e-14
WP_010931276.1|3199426_3200107_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003807204.1|3200384_3201758_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_003818444.1|3201759_3202779_+	histone deacetylase family protein	NA	A0A2K9L473	Tupanvirus	31.7	3.4e-22
WP_003818443.1|3202842_3203814_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|3203878_3204829_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3204927_3205878_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003807199.1|3205976_3206819_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_010931277.1|3206818_3207154_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010931278.1|3207224_3208643_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.4	8.7e-40
WP_003807194.1|3208922_3209963_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_003818441.1|3210042_3210294_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_010925730.1|3210404_3211568_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.8	5.0e-126
WP_010931279.1|3211851_3212706_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_010931280.1|3212702_3213593_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_003807183.1|3213635_3214547_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
3213743:3213761	attL	GCGCGCCCGCGCGCTGGCC	NA	NA	NA	NA
WP_010931281.1|3214573_3215266_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_010931282.1|3215280_3216261_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	30.5	3.3e-14
WP_019248128.1|3216273_3218415_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003818434.1|3218463_3219432_-	putative membrane protein	NA	NA	NA	NA	NA
WP_019247300.1|3219422_3220091_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_010931286.1|3220051_3220987_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931287.1|3220983_3221880_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010931288.1|3221876_3222599_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	1.1e-11
WP_019248127.1|3222589_3222754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003807166.1|3222927_3223431_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_010931290.1|3223707_3224823_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_003807164.1|3224965_3225430_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_010931291.1|3225577_3226117_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003807162.1|3226138_3227473_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.6	3.5e-43
WP_003807161.1|3227486_3227792_-	copper-binding protein	NA	NA	NA	NA	NA
WP_003807159.1|3228216_3228777_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|3228875_3229826_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003808356.1|3229841_3230345_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853362.1|3230341_3231778_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_010931296.1|3232497_3232977_+	membrane protein	NA	NA	NA	NA	NA
WP_004566249.1|3233128_3233428_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010931294.1|3233688_3234270_-	CGNR zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_010925959.1|3234357_3235242_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003808340.1|3235377_3236133_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003808339.1|3236154_3236835_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010931293.1|3236846_3237956_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	7.5e-23
WP_029443900.1|3237962_3239441_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_005012808.1|3239753_3240704_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905963.1|3242145_3243717_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019247179.1|3244049_3245903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248316.1|3245947_3248512_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_010929577.1|3248930_3249881_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274087.1|3252746_3253241_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_005013747.1|3253257_3254208_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879586.1|3254194_3254395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931301.1|3254391_3255603_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010931302.1|3255618_3258570_-	restriction endonuclease subunit M	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
WP_019247951.1|3258571_3261328_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_010931304.1|3261838_3262885_-	Fic family protein	NA	NA	NA	NA	NA
WP_010931305.1|3263226_3264354_-|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
WP_010931306.1|3264633_3265725_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010931307.1|3265797_3266580_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010931308.1|3266576_3267173_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
3268441:3268459	attR	GGCCAGCGCGCGGGCGCGC	NA	NA	NA	NA
>prophage 18
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	3311331	3370900	4134593	transposase	Staphylococcus_phage(33.33%)	50	NA	NA
WP_005012808.1|3311331_3312282_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931334.1|3313111_3313999_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931335.1|3315586_3317062_+	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013747.1|3317160_3318111_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931336.1|3318515_3319160_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_019247677.1|3319184_3319769_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_014905506.1|3319869_3320487_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_010931337.1|3320489_3322205_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_010931338.1|3322201_3322510_-	urease subunit beta	NA	NA	NA	NA	NA
WP_003814828.1|3322526_3323144_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_010931340.1|3323188_3323491_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_003814832.1|3323591_3324446_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_124740609.1|3324633_3324858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929281.1|3325027_3325300_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929282.1|3325717_3326125_-	GFA family protein	NA	NA	NA	NA	NA
WP_010931341.1|3326494_3327289_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010927102.1|3327389_3328625_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003814852.1|3328693_3329710_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931342.1|3329721_3331098_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003814856.1|3331094_3332291_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814858.1|3332287_3333826_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_010931343.1|3333822_3335082_-	YeaH/YhbH family protein	NA	NA	NA	NA	NA
WP_010931344.1|3338738_3339833_-	CoA transferase	NA	NA	NA	NA	NA
WP_019248373.1|3339825_3341160_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_003808193.1|3341113_3341797_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019248372.1|3341822_3342986_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004566224.1|3342982_3343984_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931346.1|3343983_3344856_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931347.1|3344852_3345602_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931348.1|3345598_3346390_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931349.1|3346386_3347526_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047122778.1|3347801_3348587_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486103.1|3348620_3349403_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010931351.1|3349406_3349796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931352.1|3350935_3351799_+	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931353.1|3351834_3352923_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_005013747.1|3352919_3353870_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247959.1|3354223_3357202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003818344.1|3358128_3359007_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_005013747.1|3360955_3361906_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931354.1|3361902_3362370_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_010931355.1|3362412_3363183_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010927090.1|3363203_3364004_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931356.1|3364014_3365424_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_003814739.1|3365518_3366304_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010929632.1|3366543_3367560_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814742.1|3367667_3368060_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931357.1|3368197_3368878_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_023994844.1|3368882_3369854_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014905422.1|3369949_3370900_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	3377054	3436352	4134593	tRNA,transposase	Acinetobacter_phage(27.27%)	47	NA	NA
WP_003820957.1|3377054_3378818_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931362.1|3378929_3379808_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003814250.1|3379920_3380736_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003814252.1|3380739_3380991_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_010930158.1|3381075_3382092_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814254.1|3382422_3382644_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019247693.1|3385004_3385922_-	DMT family transporter	NA	NA	NA	NA	NA
WP_019247692.1|3386419_3387628_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931365.1|3387707_3389279_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814275.1|3389396_3390332_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003814277.1|3390520_3391465_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814283.1|3392032_3397750_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_010931367.1|3397755_3398883_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814287.1|3398938_3399565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929632.1|3399836_3400853_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010927020.1|3400948_3401659_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931368.1|3401655_3402645_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931369.1|3402740_3404372_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931370.1|3404374_3405112_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247745.1|3405267_3406140_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_023852703.1|3406489_3407629_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814300.1|3407625_3408285_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003814302.1|3408356_3408989_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_010931372.1|3409018_3409537_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_010931373.1|3409547_3410657_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003814312.1|3410703_3411558_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931374.1|3411559_3412462_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039250731.1|3413698_3414634_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905441.1|3416389_3417379_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931375.1|3417554_3418343_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_003817833.1|3418339_3419371_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_003815390.1|3419389_3419953_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_019248071.1|3420008_3421529_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	32.0	3.1e-43
WP_010931377.1|3421792_3422497_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_023852620.1|3422504_3423233_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003815381.1|3423347_3423722_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003815379.1|3423764_3425054_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_010931378.1|3425050_3426220_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_010931379.1|3426216_3427056_+	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931380.1|3427115_3428051_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_005012067.1|3428063_3429014_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931381.1|3429112_3430075_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_003817821.1|3430106_3430466_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931382.1|3430590_3431493_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_010931383.1|3431494_3433267_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_003815367.1|3433301_3434078_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005012808.1|3435401_3436352_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	3451289	3516704	4134593	transposase	Planktothrix_phage(66.67%)	49	NA	NA
WP_005012067.1|3451289_3452240_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931392.1|3452369_3453503_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931393.1|3453546_3454452_-	hydrolase	NA	NA	NA	NA	NA
WP_023852622.1|3454454_3456155_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931394.1|3456151_3457072_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003817805.1|3457079_3458057_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014905459.1|3458115_3459159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815317.1|3461133_3461370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931396.1|3461496_3462360_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815315.1|3462448_3463270_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003815313.1|3463349_3464087_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931397.1|3464083_3465076_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_010931398.1|3465228_3465852_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931399.1|3465896_3467045_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|3469368_3470319_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_080320275.1|3470417_3471368_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012808.1|3473797_3474748_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929184.1|3476885_3478115_+	spore maturation protein	NA	NA	NA	NA	NA
WP_003814419.1|3478117_3479560_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_010931414.1|3479664_3480810_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_010931413.1|3480841_3481639_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931412.1|3481663_3483223_-	chaperone SurA	NA	NA	NA	NA	NA
WP_010931411.1|3483219_3485592_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931410.1|3485701_3486805_+	phosphotransferase	NA	NA	NA	NA	NA
WP_010931409.1|3486804_3487497_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003814436.1|3487640_3488342_+	membrane protein	NA	NA	NA	NA	NA
WP_003814437.1|3488326_3488704_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_005012067.1|3489435_3490386_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814441.1|3490545_3491418_-	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_003814443.1|3491758_3491977_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_010929975.1|3492016_3493396_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010929976.1|3493437_3494835_-	amidase family protein	NA	NA	NA	NA	NA
WP_010927038.1|3494874_3496527_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
WP_010929977.1|3496530_3497415_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929978.1|3497414_3498356_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929980.1|3500220_3501036_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814459.1|3501103_3501673_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|3501673_3502624_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814461.1|3503278_3504376_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_003814462.1|3504409_3505675_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005012067.1|3505832_3506783_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929982.1|3507026_3507617_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_010929983.1|3507632_3510077_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003814467.1|3510196_3511168_-	FecR family protein	NA	NA	NA	NA	NA
WP_023852739.1|3511299_3511824_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005012067.1|3511783_3512734_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929984.1|3512955_3515151_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_020699729.1|3515223_3515631_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|3515753_3516704_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	3567248	3622645	4134593	transposase	Lake_Baikal_phage(14.29%)	46	NA	NA
WP_005012067.1|3567248_3568199_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929806.1|3568320_3569574_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929805.1|3569551_3570514_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929804.1|3570645_3571140_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010929803.1|3571139_3572372_+	dehydratase	NA	NA	NA	NA	NA
WP_019247316.1|3573117_3573399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929802.1|3573385_3574372_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929801.1|3574515_3574920_+	RidA family protein	NA	NA	NA	NA	NA
WP_010929800.1|3575061_3578448_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929799.1|3578478_3579942_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_019247315.1|3579950_3581579_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010929797.1|3581664_3582324_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929796.1|3582353_3582794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929795.1|3583304_3583508_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	5.8e-14
WP_010929794.1|3583683_3584589_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|3588558_3589509_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929793.1|3589607_3590636_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_019247419.1|3590662_3591835_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003814681.1|3591960_3592938_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814685.1|3592948_3593920_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929791.1|3593986_3594772_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814691.1|3594764_3595997_-	CoA transferase	NA	NA	NA	NA	NA
WP_003814694.1|3596192_3596948_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_010929789.1|3597058_3597577_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_010929788.1|3599365_3600766_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003820700.1|3600865_3601210_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_003814701.1|3601298_3601769_+	universal stress protein	NA	NA	NA	NA	NA
WP_019247421.1|3602179_3602578_+	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_010929577.1|3602709_3603660_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814730.1|3606104_3606839_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
WP_003814728.1|3607248_3607428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814726.1|3607618_3608932_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929786.1|3608947_3610459_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929785.1|3610455_3611661_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_022997984.1|3611856_3612834_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446199.1|3612926_3613421_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003814720.1|3613550_3614609_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
WP_010927086.1|3614605_3616225_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_157734656.1|3616184_3616454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929784.1|3616412_3617516_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_010929783.1|3617512_3617968_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_003814709.1|3617973_3618897_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
WP_010929782.1|3618986_3619646_-	LysE family translocator	NA	NA	NA	NA	NA
WP_047122777.1|3619642_3620557_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010929577.1|3620645_3621596_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3621694_3622645_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	3848901	3905019	4134593	tRNA,protease,transposase	Bacillus_phage(28.57%)	46	NA	NA
WP_003815821.1|3848901_3849351_+|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_010929718.1|3850017_3850179_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_076879590.1|3850254_3850470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3850456_3851407_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929717.1|3852450_3852729_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010929716.1|3853871_3854420_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
WP_010929715.1|3854482_3856162_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
WP_010929714.1|3856158_3857910_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
WP_003817696.1|3857906_3858032_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_004567834.1|3858045_3859200_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_023852659.1|3859215_3860793_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010929712.1|3860918_3861464_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929711.1|3863703_3864684_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929710.1|3864697_3865822_+	CoA transferase	NA	NA	NA	NA	NA
WP_003814321.1|3865829_3867584_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929709.1|3867690_3868590_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814324.1|3868654_3869638_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929708.1|3869773_3870754_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929707.1|3870770_3872162_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929706.1|3872313_3872850_+|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_019247543.1|3872780_3874166_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_003814332.1|3874308_3874947_-	membrane protein	NA	NA	NA	NA	NA
WP_033461782.1|3875033_3876923_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	2.5e-79
WP_003814337.1|3876919_3877861_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003814339.1|3877966_3879016_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_010929704.1|3879268_3879970_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_010929703.1|3879966_3880665_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929702.1|3880665_3882021_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929701.1|3882017_3882509_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003814351.1|3882527_3883484_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814355.1|3884894_3886997_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814356.1|3887167_3888211_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814358.1|3888254_3888998_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814363.1|3890019_3890430_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_010929700.1|3891379_3892177_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012808.1|3892275_3893226_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_039251057.1|3893198_3894140_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3894136_3895087_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929681.1|3895201_3896203_-	HindIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_010929682.1|3896293_3896860_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010929683.1|3897178_3899092_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_010929684.1|3899133_3900564_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019247308.1|3900676_3902089_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818947.1|3902105_3902801_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3903019_3903970_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3904068_3905019_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP010323	Bordetella pertussis 137 chromosome, complete genome	4134593	4036974	4110295	4134593	protease,transposase	uncultured_Mediterranean_phage(16.67%)	55	NA	NA
WP_005012067.1|4036974_4037925_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931563.1|4037921_4039112_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_010931562.1|4039233_4039998_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_003807735.1|4040084_4041188_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010930158.1|4041379_4042396_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815102.1|4042677_4043166_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
WP_003817656.1|4044509_4045190_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
WP_010931560.1|4045251_4046103_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_010931559.1|4046099_4046897_-	thiazole synthase	NA	NA	NA	NA	NA
WP_010931558.1|4047000_4047894_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_010931557.1|4047905_4049795_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
WP_010931556.1|4050131_4053905_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
WP_005012067.1|4053901_4054852_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929826.1|4055160_4055853_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_003818232.1|4056226_4056727_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_023853391.1|4056833_4057754_+	bestrophin	NA	NA	NA	NA	NA
WP_010929823.1|4057770_4058247_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929822.1|4058340_4060191_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929821.1|4060246_4061005_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|4061032_4062466_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003818225.1|4062539_4063319_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929819.1|4063331_4064165_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020699616.1|4064173_4064944_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929818.1|4064943_4066008_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929817.1|4066159_4068787_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929816.1|4068850_4071472_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_003815964.1|4072399_4072858_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929815.1|4073136_4075380_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010929814.1|4075576_4077601_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_019248007.1|4077724_4078687_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929812.1|4078898_4080038_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929811.1|4080060_4081026_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004565905.1|4081221_4082412_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_003815955.1|4082425_4082671_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_010929810.1|4082699_4084721_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815953.1|4084767_4086375_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929808.1|4086475_4087645_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005013747.1|4090526_4091477_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929699.1|4091633_4091957_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_023853200.1|4092061_4093102_-	cyclase	NA	NA	NA	NA	NA
WP_010929697.1|4093107_4093887_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_003807672.1|4093932_4094229_-	YciI family protein	NA	NA	NA	NA	NA
WP_003807674.1|4094254_4094530_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_003819086.1|4094586_4095231_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010929696.1|4095230_4095917_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_033446325.1|4096115_4096898_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929694.1|4096948_4097674_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929693.1|4097705_4099055_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929692.1|4099166_4100099_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033454003.1|4100556_4103352_-|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
WP_023994893.1|4103945_4106789_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_010929689.1|4106959_4107679_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_010929688.1|4107717_4108266_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_019248089.1|4108420_4109320_+	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_005012808.1|4109344_4110295_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
