The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	17341	76757	3762666	protease,tRNA,transposase	Bacillus_virus(11.11%)	53	NA	NA
WP_009904317.1|17341_18643_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.0	3.6e-93
WP_009904316.1|18800_19067_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_009904315.1|19107_20418_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.8	1.3e-79
WP_009889706.1|20638_21349_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_009889704.1|21420_23727_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.9	7.1e-84
WP_009904313.1|24057_25020_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	44.6	3.2e-62
WP_025404821.1|25183_25927_+	DNA mismatch repair protein MutS	NA	NA	NA	NA	NA
WP_009904310.1|25952_26573_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_009889694.1|26833_27952_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.5	2.2e-22
WP_080554737.1|28057_28903_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_009889690.1|28904_29843_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_009904308.1|29998_31246_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009904306.1|31706_33176_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	34.1	1.4e-72
WP_009889688.1|33267_33948_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_019254651.1|33925_35851_+	bifunctional transcriptional regulator/glucokinase	NA	NA	NA	NA	NA
WP_009904302.1|36679_36889_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009889686.1|37334_38135_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009904300.1|38211_38871_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009889682.1|38929_39655_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	5.4e-30
WP_009904298.1|39681_40917_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.5	6.9e-25
WP_009904296.1|41703_42162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009904294.1|43693_44830_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.9	7.4e-42
WP_009904292.1|44844_45459_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.7	8.1e-27
WP_009889661.1|45922_47059_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.0	3.7e-49
WP_004186056.1|47138_47660_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2I2L4Y7	Orpheovirus	36.8	5.6e-13
WP_004185707.1|47656_48094_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_009904291.1|48157_49351_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_019254645.1|49907_51011_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_009904289.1|51591_53151_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_038708302.1|53191_53866_+	LysE family transporter	NA	NA	NA	NA	NA
WP_019254643.1|53940_54924_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_009904286.1|55033_55327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009904284.1|55752_56751_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_009889645.1|56835_57399_+	YggT family protein	NA	NA	NA	NA	NA
WP_009889644.1|57414_57771_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_009889642.1|57792_58179_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.5	1.7e-22
WP_009904282.1|58793_60014_+|protease	serine protease	protease	NA	NA	NA	NA
WP_009904281.1|60282_61125_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	24.3	7.5e-07
WP_009904279.1|61361_62246_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009904278.1|62378_63353_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_009904277.1|63541_65479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772925.1|65622_66645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009904271.1|67379_68102_+	DUF5343 domain-containing protein	NA	NA	NA	NA	NA
WP_011544796.1|68172_68475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227358.1|68535_68853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039336678.1|69187_70444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039336681.1|70560_70923_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_029227479.1|70922_71270_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	70.1	4.7e-40
WP_009906954.1|71299_72862_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	2.1e-143
WP_144410512.1|73257_74378_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.8e-49
WP_052689349.1|74408_74780_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144410513.1|74862_75363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410514.1|75522_76757_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.4e-102
>prophage 2
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	290796	301340	3762666	transposase	unidentified_phage(14.29%)	8	NA	NA
WP_009904055.1|290796_292341_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	2.5e-24
WP_009889265.1|292376_292904_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009889263.1|292900_293584_+	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_009904054.1|293648_294464_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
WP_045143256.1|294665_295886_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	92.4	1.7e-225
WP_039336891.1|295952_297962_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.9	4.8e-52
WP_009889258.1|297993_299124_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_009904051.1|299387_301340_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	6.6e-147
>prophage 3
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	603388	649974	3762666	plate,transposase,integrase	Burkholderia_virus(25.0%)	39	613811:613852	657409:657450
WP_019255984.1|603388_604489_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009906861.1|604452_606291_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009888597.1|606371_606854_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_009906860.1|606911_607415_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009888594.1|607487_608978_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009888592.1|608994_609513_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_043036367.1|609549_610239_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_025404121.1|610612_611227_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009906858.1|611335_612682_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009888580.1|612678_613464_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
613811:613852	attL	CGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAATCA	NA	NA	NA	NA
WP_029227469.1|614036_615401_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_009906856.1|615431_615815_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_009906855.1|615798_616122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009906854.1|616503_617031_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	60.5	7.9e-55
WP_009906853.1|617027_617777_+	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	57.5	1.0e-60
WP_009906852.1|617787_619002_+	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	68.2	5.5e-144
WP_144410517.1|619330_621895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410518.1|621904_623146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906848.1|623475_624678_-	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_029227466.1|624674_630038_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	5.4e-42
WP_144410519.1|629925_630885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906846.1|631323_633126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906845.1|633122_633602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029227464.1|633598_634765_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_080558212.1|635433_635775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906843.1|635883_636852_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.0	4.1e-57
WP_045143258.1|636924_637920_+	endonuclease	NA	A6XMH8	Bacillus_virus	37.8	9.4e-49
WP_009906841.1|637931_638159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906840.1|638225_639152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227462.1|639148_640171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227461.1|640232_641039_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_029227460.1|641173_641473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906835.1|641474_642128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227459.1|642105_642447_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069246059.1|642623_643943_+	hypothetical protein	NA	A0A0A8J8N7	Ralstonia_phage	49.4	1.2e-88
WP_069246068.1|644010_645120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906830.1|645635_647972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410520.1|648051_648702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410514.1|648739_649974_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.4e-102
657409:657450	attR	CGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAATCA	NA	NA	NA	NA
>prophage 4
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	1072346	1128461	3762666	protease,transposase,tRNA,portal,integrase	Burkholderia_virus(13.33%)	50	1064117:1064133	1094691:1094707
1064117:1064133	attL	ATGATCTTCGCGTCGTT	NA	NA	NA	NA
WP_009906631.1|1072346_1073750_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_009906630.1|1073918_1075148_+|integrase	tyrosine-type recombinase/integrase	integrase	Q858E8	Salmonella_phage	38.7	1.2e-66
WP_038711569.1|1075246_1075846_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	66.0	1.1e-47
WP_144410526.1|1075877_1077115_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	9.9e-157
WP_009907005.1|1078117_1080970_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.2	6.6e-71
WP_009907004.1|1081114_1081456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405247.1|1081452_1081710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907001.1|1082249_1082729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525824.1|1082728_1082899_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_009906999.1|1083129_1083642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405250.1|1084050_1084992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405251.1|1084960_1086061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158345901.1|1086087_1086216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906996.1|1086691_1087267_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	41.2	1.0e-23
WP_144410514.1|1087414_1088648_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.4e-102
WP_144410527.1|1088760_1089423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902046.1|1089415_1090429_-	ParA family protein	NA	Q7M293	Enterobacteria_phage	31.5	1.8e-31
WP_009902049.1|1091927_1092152_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_009902051.1|1092564_1093725_+	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_009902052.1|1093789_1093945_+	lipoprotein	NA	NA	NA	NA	NA
WP_009902063.1|1094609_1095170_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
1094691:1094707	attR	AACGACGCGAAGATCAT	NA	NA	NA	NA
WP_009902065.1|1095656_1096004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902068.1|1096224_1096779_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_009902070.1|1096906_1097323_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_009902073.1|1097725_1098820_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.1	1.0e-19
WP_019256023.1|1098816_1099758_+	3-methyladenine DNA glycosylase 2	NA	NA	NA	NA	NA
WP_009902082.1|1099907_1101521_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_009902084.1|1101536_1102985_-	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	34.4	3.4e-31
WP_009902086.1|1103227_1103776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902090.1|1104569_1105151_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_162486552.1|1105307_1106153_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	85.1	3.0e-133
WP_009902093.1|1106225_1106510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019254355.1|1107194_1107677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902097.1|1107783_1109817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902099.1|1110458_1110959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902101.1|1111316_1112363_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_144410528.1|1112496_1113021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410512.1|1114128_1115248_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.8e-49
WP_045143286.1|1115551_1115884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009893658.1|1116376_1116781_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_009902108.1|1116819_1117689_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_009902110.1|1117808_1118825_-	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009893648.1|1119262_1120318_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009902112.1|1120546_1123156_-	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.6	3.8e-17
WP_009902114.1|1123365_1123737_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_009902115.1|1123797_1124985_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.3e-22
WP_009893641.1|1125217_1125721_+	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	31.5	3.2e-13
WP_009902117.1|1125752_1126739_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	3.9e-07
WP_009893639.1|1126859_1127495_+	LysE family translocator	NA	NA	NA	NA	NA
WP_009902119.1|1127603_1128461_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	1854465	1865346	3762666	protease	Streptococcus_phage(16.67%)	9	NA	NA
WP_009903323.1|1854465_1856580_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.3e-57
WP_019256450.1|1856845_1857355_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.0e-14
WP_080555088.1|1857550_1857766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009892615.1|1858026_1858605_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_009903329.1|1858869_1860129_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_039337770.1|1860293_1861889_+	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004196460.1|1862000_1862204_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_009892611.1|1862734_1863049_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_025405293.1|1863045_1865346_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	3.6e-168
>prophage 6
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	1992215	2050902	3762666	protease,transposase,coat	Bacillus_virus(18.18%)	54	NA	NA
WP_011401892.1|1992215_1992734_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_029227331.1|1993128_1994139_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009903493.1|1994245_1995061_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_009903496.1|1995248_1996004_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_009903498.1|1996272_1999257_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_039337803.1|1999575_2000565_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_009903508.1|2000564_2002544_+	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_009903510.1|2002548_2003739_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_009903511.1|2003871_2005179_-	MFS transporter	NA	NA	NA	NA	NA
WP_009903513.1|2005216_2005975_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019254930.1|2006065_2007505_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009892455.1|2007665_2008193_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.2	5.3e-51
WP_009903525.1|2008352_2008850_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	45.8	8.0e-09
WP_127447052.1|2008946_2010533_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_162486542.1|2010445_2010670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009903529.1|2011068_2012247_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_009903531.1|2012393_2014079_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	1.0e-92
WP_004193987.1|2014139_2014478_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_009892446.1|2014734_2015823_-	porin	NA	NA	NA	NA	NA
WP_009903535.1|2016436_2017417_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009892444.1|2017508_2018006_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039337815.1|2018076_2018856_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-16
WP_009907008.1|2018878_2019592_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009892440.1|2019588_2020278_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_009903541.1|2020488_2021265_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009903542.1|2021647_2022346_+	pirin family protein	NA	NA	NA	NA	NA
WP_009892437.1|2022568_2023114_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_009892436.1|2023356_2024082_+	response regulator	NA	W8CYM9	Bacillus_phage	35.4	1.9e-30
WP_009903549.1|2024065_2025379_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_009892434.1|2025442_2025709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009892433.1|2026203_2027961_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_009903552.1|2028014_2029355_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	6.3e-32
WP_025405256.1|2029539_2030046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405255.1|2030042_2030594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009892428.1|2030881_2031079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903562.1|2031210_2032629_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_009903564.1|2032621_2033215_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	60.5	7.3e-25
WP_009903568.1|2033377_2033989_-	membrane protein	NA	NA	NA	NA	NA
WP_009903571.1|2034532_2035906_-	MFS transporter	NA	NA	NA	NA	NA
WP_009903573.1|2036024_2036528_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_009903574.1|2036738_2037119_-	DUF5594 family protein	NA	NA	NA	NA	NA
WP_009892420.1|2037277_2037649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903575.1|2038164_2038545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019254695.1|2038716_2039256_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_019254694.1|2039355_2040507_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_025405253.1|2040697_2040922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405252.1|2042511_2042997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080940519.1|2043351_2044005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410514.1|2044021_2045255_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.4e-102
WP_080558216.1|2045271_2045757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410533.1|2045751_2046309_-	sce7726 family protein	NA	A0A2K9VCS3	Lactobacillus_phage	30.9	7.9e-05
WP_144410534.1|2046500_2047587_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	9.9e-44
WP_009906756.1|2048527_2049373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410526.1|2049665_2050902_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	9.9e-157
>prophage 7
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	2123149	2171885	3762666	head,tail,transposase,tRNA,portal,integrase,terminase,capsid	Pseudomonas_phage(30.77%)	48	2153873:2153899	2172058:2172084
WP_009903714.1|2123149_2124043_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_009903716.1|2124085_2124976_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_039337842.1|2125300_2128825_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	36.0	6.0e-183
WP_009892328.1|2128862_2130653_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.3	6.8e-50
WP_009903733.1|2130706_2131798_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_009903737.1|2132114_2133257_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_009903739.1|2133256_2134555_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_025405191.1|2134551_2135799_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_009903742.1|2135885_2137061_+	putative lipopolysaccharide heptosyltransferase III	NA	NA	NA	NA	NA
WP_009892318.1|2137332_2138097_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009892315.1|2138537_2138921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903745.1|2139161_2139719_-	FUSC family protein	NA	NA	NA	NA	NA
WP_009903746.1|2140005_2141268_-	MFS transporter	NA	NA	NA	NA	NA
WP_025405189.1|2141264_2142254_-	photosystem reaction center subunit H	NA	NA	NA	NA	NA
WP_009903749.1|2142839_2143292_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_009903751.1|2143754_2144648_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_039337845.1|2145992_2147246_+	MFS transporter	NA	NA	NA	NA	NA
WP_009903765.1|2147312_2147777_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_009903767.1|2147868_2148198_-	cold-shock protein	NA	NA	NA	NA	NA
WP_009892299.1|2148715_2149009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039337846.1|2149365_2149635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255668.1|2149941_2150655_+	phospholipase C accessory protein PlcR	NA	NA	NA	NA	NA
WP_025369481.1|2150726_2152103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903769.1|2152271_2153660_-	purine permease	NA	H9YQ34	environmental_Halophage	52.4	1.1e-26
2153873:2153899	attL	CCTACATCAGCACGATGTCGTACTGCT	NA	NA	NA	NA
WP_009903778.1|2154376_2154829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410538.1|2155063_2155552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410539.1|2155615_2156233_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009903782.1|2156238_2156499_-	hypothetical protein	NA	I6NSR8	Burkholderia_phage	73.2	4.2e-25
WP_009903783.1|2156639_2157215_+	SocA family protein	NA	NA	NA	NA	NA
WP_009903786.1|2158342_2158660_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_039337850.1|2158649_2159939_-|portal	phage portal protein	portal	F8TVA0	EBPR_siphovirus	45.9	2.2e-90
WP_039337852.1|2159938_2160118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045143274.1|2160130_2162023_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	44.9	5.2e-133
WP_009906764.1|2162079_2163600_-|terminase	terminase	terminase	B5WZR8	Pseudomonas_phage	79.2	1.1e-229
WP_009906765.1|2163581_2164022_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	60.4	1.2e-40
WP_029227453.1|2164123_2164375_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_085955234.1|2164902_2166112_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.4	9.2e-99
WP_009903789.1|2166765_2167314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009903790.1|2167313_2167541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009903792.1|2167537_2167774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009903794.1|2167766_2168045_-	hypothetical protein	NA	Q3HQY6	Burkholderia_phage	67.1	6.7e-21
WP_009903795.1|2168037_2168289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009903797.1|2168281_2168476_-	hypothetical protein	NA	A0A1W6JTA7	Pseudomonas_phage	49.0	6.1e-05
WP_080558124.1|2168468_2168654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009903800.1|2168947_2169235_-	hypothetical protein	NA	A0A1B0VRK7	Pseudomonas_phage	47.9	3.7e-06
WP_009903802.1|2169314_2169545_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_144410540.1|2169793_2170552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029227343.1|2170643_2171885_-|integrase	site-specific integrase	integrase	Q6J1Q2	Burkholderia_virus	45.1	1.0e-81
2172058:2172084	attR	CCTACATCAGCACGATGTCGTACTGCT	NA	NA	NA	NA
>prophage 8
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	2435760	2564810	3762666	plate,transposase,tRNA,integrase,coat	Burkholderia_virus(19.23%)	100	2435706:2435753	2449238:2449285
2435706:2435753	attL	CTTCTAAGCCGTAGGTCACACGTTCGAATCGTGTAGGGCGGGCCAGTC	NA	NA	NA	NA
WP_029227432.1|2435760_2436855_-|integrase	site-specific integrase	integrase	K7PKD7	Enterobacteria_phage	36.9	2.6e-60
WP_009905983.1|2437370_2437910_-	hypothetical protein	NA	A0A127KN88	Pseudomonas_phage	66.7	7.1e-11
WP_038711425.1|2438865_2439171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080558189.1|2440547_2441144_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_144410542.1|2442490_2442691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410526.1|2442890_2444128_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	9.9e-157
WP_080940521.1|2444140_2445175_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	31.2	5.8e-17
WP_099975745.1|2445240_2445978_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_009905961.1|2445980_2446265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905959.1|2446443_2446626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227429.1|2446618_2447116_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	93.3	1.3e-83
WP_009905952.1|2447112_2447658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905951.1|2447654_2448134_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	81.3	2.0e-57
WP_144410543.1|2448103_2448367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905950.1|2448448_2449093_+	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	89.5	1.6e-113
WP_025405127.1|2450937_2451843_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	75.1	4.9e-129
2449238:2449285	attR	CTTCTAAGCCGTAGGTCACACGTTCGAATCGTGTAGGGCGGGCCAGTC	NA	NA	NA	NA
WP_009905947.1|2451975_2453262_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	72.0	1.7e-172
WP_009905946.1|2453578_2453914_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009905945.1|2454217_2455696_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_009910381.1|2456456_2456675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905942.1|2458166_2460017_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_025405123.1|2460045_2461473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009891791.1|2461496_2461763_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_009905937.1|2462288_2465087_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	2.0e-27
WP_009905935.1|2465089_2465923_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_025987447.1|2466059_2466617_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009906995.1|2466613_2467213_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009906968.1|2467700_2468300_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009906969.1|2468296_2470702_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_039338284.1|2470808_2471387_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_025405119.1|2472747_2476083_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009906870.1|2476060_2476555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038708366.1|2477313_2477805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955234.1|2477919_2479129_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.4	9.2e-99
WP_009905926.1|2480170_2480503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905925.1|2480520_2480826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905924.1|2480838_2483661_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.7	2.5e-30
WP_009905923.1|2483664_2484681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255073.1|2484683_2487707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050807625.1|2487988_2488435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410544.1|2489386_2490506_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	5.2e-48
WP_155772931.1|2490813_2491533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410514.1|2491598_2492833_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.4e-102
WP_085952127.1|2492912_2494150_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_144410546.1|2494222_2495276_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.5e-44
WP_009891742.1|2496263_2496527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891740.1|2496726_2497008_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009905907.1|2497493_2498420_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_038708373.1|2498464_2499754_-	MFS transporter	NA	NA	NA	NA	NA
WP_009891734.1|2500169_2501063_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019255106.1|2501871_2502417_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009905900.1|2502469_2503030_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038708375.1|2503112_2503637_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009905896.1|2503654_2504494_+	molecular chaperone	NA	NA	NA	NA	NA
WP_039337972.1|2504538_2506950_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009905886.1|2506965_2507931_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025987396.1|2508341_2510414_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.0	1.2e-29
WP_009891722.1|2510414_2511047_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_009905880.1|2511756_2512599_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009905879.1|2512616_2513810_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_009905877.1|2514034_2515618_-	acid phosphatase	NA	NA	NA	NA	NA
WP_009905875.1|2515851_2517279_+	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_009905874.1|2517324_2518185_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_009905872.1|2518181_2518361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905871.1|2518286_2520386_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_009905870.1|2520672_2521059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905869.1|2521077_2521554_+	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	2.0e-20
WP_009891706.1|2521839_2523549_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.9	2.8e-186
WP_038709125.1|2523829_2524039_+	ornithine acetyltransferase	NA	NA	NA	NA	NA
WP_009905865.1|2524568_2525375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905864.1|2525468_2526689_-	CoA transferase	NA	NA	NA	NA	NA
WP_009905863.1|2527131_2529756_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	7.1e-80
WP_009905862.1|2530184_2531150_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080940522.1|2531234_2532833_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_025405102.1|2533384_2534923_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	24.8	5.0e-09
WP_009905853.1|2535387_2535942_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_009891685.1|2536034_2536370_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_009891683.1|2536559_2537708_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_019255838.1|2537967_2538417_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_009905849.1|2538421_2539357_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025405101.1|2539349_2541587_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	27.5	1.2e-08
WP_009891678.1|2541583_2542288_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	8.7e-09
WP_009905842.1|2542352_2543156_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_009905840.1|2543155_2544076_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_045143295.1|2544072_2546076_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_025405099.1|2546086_2548087_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_009891669.1|2548100_2548901_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.6e-14
WP_009891668.1|2548913_2550059_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009891666.1|2550159_2551209_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009905831.1|2551458_2552340_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009905830.1|2552332_2553352_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_025405098.1|2553364_2554402_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004193727.1|2554563_2554794_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_009905819.1|2555051_2555438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193573.1|2555728_2556433_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_009891653.1|2556429_2557794_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009891650.1|2557804_2560198_+	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_009905817.1|2560289_2560895_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_009891646.1|2560971_2561856_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.3	1.1e-69
WP_009905815.1|2561942_2564810_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	6.7e-148
>prophage 9
NZ_CP008914	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762666	3672998	3681749	3762666		Tanapox_virus(16.67%)	8	NA	NA
WP_009904406.1|3672998_3673910_+	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.8	9.2e-19
WP_009889864.1|3674279_3675203_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_009889862.1|3675381_3676623_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009904404.1|3676717_3677620_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_009889858.1|3677954_3678272_-	competence protein ComE	NA	NA	NA	NA	NA
WP_009904403.1|3678343_3679336_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009889854.1|3679393_3680380_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	6.7e-15
WP_009904402.1|3680348_3681749_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.4e-79
>prophage 1
NZ_CP008915	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966450	380033	421486	2966450	integrase,tail,transposase,tRNA,plate	Burkholderia_virus(43.24%)	48	392104:392123	425713:425732
WP_009895739.1|380033_381074_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.0	1.7e-93
WP_009899222.1|381204_382428_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009895742.1|382507_382720_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_019254422.1|382886_383333_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	3.3e-22
WP_009899227.1|383429_385307_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
WP_009895748.1|385353_385692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899229.1|385750_387793_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_144410555.1|388132_388348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899231.1|388441_388732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127446954.1|388712_389111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009899232.1|389202_389703_-	hypothetical protein	NA	A0A2H4N7D9	Pectobacterium_phage	54.3	2.0e-31
WP_009899233.1|390036_390393_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	76.8	1.1e-44
WP_009899234.1|390483_391098_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	83.4	2.2e-93
WP_009899237.1|391194_391527_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	58.2	2.5e-22
WP_009899239.1|391558_392812_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	69.1	7.2e-155
392104:392123	attL	CGAGCGGCGCGACGGCCGCG	NA	NA	NA	NA
WP_009899242.1|392808_394605_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	80.2	4.3e-278
WP_009899243.1|394619_395585_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	70.3	1.4e-102
WP_009899245.1|395598_395910_-	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	80.0	1.7e-33
WP_155772941.1|395906_396350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906820.1|396424_396667_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	90.0	7.3e-32
WP_050789956.1|396797_397217_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	51.4	6.7e-25
WP_052689340.1|397282_398146_+	hypothetical protein	NA	A4JWN9	Burkholderia_virus	29.3	2.4e-24
WP_009906937.1|398648_398996_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	79.1	1.2e-43
WP_025405408.1|398998_399607_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	79.8	3.9e-90
WP_155275021.1|399771_400206_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	69.3	4.4e-43
WP_009906940.1|400202_400541_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	82.7	4.0e-44
WP_009906941.1|400537_400870_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	77.8	1.9e-46
WP_025405411.1|401202_401517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906942.1|401687_402152_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	60.1	3.9e-42
WP_009906943.1|402148_402394_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	62.5	1.7e-20
WP_009906944.1|402397_403831_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	87.2	4.7e-243
WP_009906945.1|403832_404357_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	90.2	2.9e-86
WP_009906946.1|404661_404991_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	65.7	1.8e-25
WP_009906947.1|404962_405121_+	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	80.8	2.5e-17
WP_039339607.1|405271_407830_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	49.8	9.4e-186
WP_009906887.1|407831_408734_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	72.1	3.5e-71
WP_009906886.1|408733_408940_+	membrane protein	NA	A4JWL2	Burkholderia_virus	78.3	1.5e-25
WP_099975756.1|408936_410133_+	phage protein D	NA	A4JWL3	Burkholderia_virus	70.3	1.2e-135
WP_009906884.1|410129_410732_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	69.0	4.3e-65
WP_135351490.1|410745_410955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906962.1|412247_413342_+|transposase	IS5-like element ISButh6 family transposase	transposase	NA	NA	NA	NA
WP_009907016.1|413624_414068_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_009907015.1|414362_414716_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	82.9	4.2e-52
WP_009907014.1|414712_415864_+|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	79.9	2.3e-168
WP_009907013.1|415856_416438_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	86.5	1.5e-91
WP_009907012.1|416437_418402_+|tail	tail fiber protein	tail	Q45YG3	Burkholderia_virus	58.1	3.9e-131
WP_009907011.1|418417_419119_+|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	59.7	1.1e-59
WP_080558217.1|420217_421486_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.3e-39
425713:425732	attR	CGAGCGGCGCGACGGCCGCG	NA	NA	NA	NA
>prophage 2
NZ_CP008915	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966450	1876395	1943143	2966450	holin,plate	Aeromonas_phage(25.0%)	47	NA	NA
WP_009900960.1|1876395_1877346_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009900964.1|1877613_1878558_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900966.1|1879031_1880735_+	peptidase	NA	NA	NA	NA	NA
WP_009900968.1|1880853_1882080_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_009907969.1|1882138_1883281_-	porin	NA	NA	NA	NA	NA
WP_019254804.1|1883508_1884546_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009900970.1|1884542_1886096_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_009900971.1|1886258_1887131_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900972.1|1887274_1888150_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_009898039.1|1888236_1889892_-	APC family permease	NA	NA	NA	NA	NA
WP_009900973.1|1890071_1890935_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019254807.1|1891044_1892184_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009898044.1|1892204_1893446_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_009900977.1|1893497_1894283_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_009900978.1|1894279_1895461_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_009900979.1|1895465_1897391_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_009900980.1|1897393_1899457_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_009898053.1|1899517_1900051_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_009900981.1|1900198_1901170_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_009898057.1|1901241_1902516_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	6.9e-105
WP_009898058.1|1902924_1903950_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900982.1|1904142_1905342_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.4e-11
WP_009900983.1|1905687_1906704_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025405822.1|1906977_1908462_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_025987348.1|1908580_1910254_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.0	1.0e-55
WP_039339746.1|1910705_1911974_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_025405551.1|1912239_1913802_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_009906874.1|1913854_1914820_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009896564.1|1914952_1916524_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_039339117.1|1916520_1917798_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_009896560.1|1918077_1918977_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019255885.1|1919549_1919825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009900992.1|1920134_1920440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893756.1|1920595_1920955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893757.1|1921013_1924508_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009893758.1|1924504_1926232_-	OmpA family protein	NA	NA	NA	NA	NA
WP_009893759.1|1926314_1927676_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009900994.1|1927672_1928266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893761.1|1928271_1928661_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_009893763.1|1928700_1929417_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_009900995.1|1929419_1930490_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_009900996.1|1930489_1932706_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_039339121.1|1932709_1934998_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_025405827.1|1935166_1937458_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009901009.1|1937448_1940292_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
WP_009901010.1|1940294_1941284_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009901011.1|1941280_1943143_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP008915	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966450	2037151	2149312	2966450	portal,integrase,tail,transposase,capsid,holin,protease,head,terminase	Burkholderia_virus(78.46%)	100	2088230:2088259	2144683:2144712
WP_009901105.1|2037151_2037535_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_009901107.1|2038007_2038961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901108.1|2039252_2040302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011401450.1|2040305_2041352_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_025405852.1|2041364_2041934_-	acetyltransferase	NA	NA	NA	NA	NA
WP_029227266.1|2041926_2042958_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_019254319.1|2042887_2044096_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_009901115.1|2044317_2045361_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009901116.1|2045376_2046732_-	membrane protein	NA	NA	NA	NA	NA
WP_009901117.1|2047010_2048771_-	GNAT family N-acetyltransferase	NA	A0A2K9L470	Tupanvirus	37.0	1.5e-36
WP_009901118.1|2048796_2050149_-	lipopolysaccharide biosynthesis protein RfbH	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	36.1	1.0e-50
WP_009901119.1|2050152_2051238_-	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	29.6	1.1e-13
WP_009901121.1|2051228_2052005_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_009901124.1|2052001_2053219_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_009901125.1|2053223_2055776_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_162096848.1|2056541_2056940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901126.1|2057025_2057670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901127.1|2057671_2060659_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_080558076.1|2061017_2062730_-	thiamine pyrophosphate-binding protein	NA	M4QSI1	Ostreococcus_lucimarinus_virus	31.7	3.2e-65
WP_009893910.1|2062962_2063370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162486559.1|2063556_2063922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901130.1|2064072_2064765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901131.1|2064897_2068461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901132.1|2068474_2080843_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009901133.1|2080833_2081568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410512.1|2081818_2082939_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.8e-49
WP_144410526.1|2083214_2084452_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	9.9e-157
WP_038709965.1|2085631_2086051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410567.1|2086108_2086291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009899900.1|2086309_2088166_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2088230:2088259	attL	TGGCGGAGAGAGGGGGATTCGAACCCCCGA	NA	NA	NA	NA
WP_144410568.1|2088596_2089145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899898.1|2089141_2089423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899897.1|2090278_2090965_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	92.2	1.3e-121
WP_029227221.1|2091049_2091691_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	90.1	2.0e-108
WP_025990442.1|2091820_2092915_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	95.5	5.2e-202
WP_010109969.1|2092942_2093677_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	96.3	7.0e-134
WP_009899893.1|2093673_2094234_-	hypothetical protein	NA	A4JX23	Burkholderia_virus	94.1	6.1e-98
WP_009899892.1|2094429_2095311_-	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	81.6	2.4e-117
WP_009899891.1|2095474_2096017_-	lysozyme	NA	A4JX21	Burkholderia_virus	86.7	1.3e-73
WP_038709960.1|2096016_2096508_-	lysozyme	NA	Q6JIK8	Burkholderia_virus	87.7	4.7e-78
WP_004552929.1|2096500_2096713_-|holin	class II holin gp23	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
WP_009899887.1|2096755_2097499_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	72.0	1.4e-102
WP_099975702.1|2097498_2097726_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	73.3	4.6e-28
WP_009899885.1|2097803_2101118_-	DUF1983 domain-containing protein	NA	Q8W6T0	Burkholderia_virus	94.6	0.0e+00
WP_029227219.1|2101114_2101699_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	93.8	1.5e-94
WP_009899883.1|2101695_2102448_-	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	89.6	8.4e-135
WP_009899882.1|2102497_2103181_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	94.7	3.4e-127
WP_029227218.1|2103177_2104566_-|tail	tail fiber domain-containing protein	tail	Q8W6T4	Burkholderia_virus	89.6	3.7e-245
WP_009899880.1|2104574_2104913_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	96.4	4.4e-59
WP_039339132.1|2104909_2108974_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	90.0	0.0e+00
WP_009901135.1|2108987_2109266_-	DUF4035 domain-containing protein	NA	Q8W6T7	Burkholderia_virus	94.7	2.4e-39
WP_029227267.1|2109265_2109730_-|tail	tail assembly protein	tail	A4JX08	Burkholderia_virus	96.1	1.8e-79
WP_009901137.1|2109756_2110212_-	hypothetical protein	NA	Q8W6T9	Burkholderia_virus	95.3	1.1e-73
WP_009901138.1|2110274_2110622_-	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	92.2	6.8e-55
WP_009901139.1|2110618_2111041_-	HK97 gp10 family phage protein	NA	Q6JIM3	Burkholderia_virus	96.4	5.5e-67
WP_038710370.1|2111033_2111363_-|head	phage head closure protein	head	Q6JIM4	Burkholderia_virus	79.8	2.1e-45
WP_029227269.1|2111365_2111728_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	80.0	1.2e-46
WP_038710381.1|2111731_2111956_-	hypothetical protein	NA	Q6JIM6	Burkholderia_virus	75.3	6.1e-25
WP_029227270.1|2112018_2113275_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	94.5	8.1e-215
WP_009901144.1|2113277_2113964_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	95.2	3.7e-121
WP_009901146.1|2113944_2115258_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	81.2	1.0e-204
WP_029227271.1|2115254_2116928_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	80.8	2.7e-266
WP_029227272.1|2116927_2117407_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	82.1	9.0e-58
WP_009901149.1|2117526_2117736_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_059601806.1|2117978_2118236_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	98.8	7.0e-41
WP_009901152.1|2118232_2118628_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	96.1	5.0e-62
WP_009901154.1|2118661_2119141_-	hypothetical protein	NA	Q3HQX5	Burkholderia_phage	78.6	6.3e-19
WP_144410569.1|2119624_2119960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410570.1|2119949_2120360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901158.1|2120522_2121047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410571.1|2121758_2123777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102869147.1|2124173_2125373_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.2	5.4e-43
WP_009901163.1|2125517_2126165_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	93.0	9.2e-106
WP_009901164.1|2126173_2126434_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	95.3	9.9e-43
WP_009901165.1|2126409_2126691_-	hypothetical protein	NA	Q3HR03	Burkholderia_phage	77.9	1.1e-31
WP_038710377.1|2126744_2127167_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	71.1	2.2e-52
WP_009901169.1|2127163_2127538_-	hypothetical protein	NA	A4JX57	Burkholderia_virus	85.5	1.8e-53
WP_029227276.1|2127534_2128086_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	89.1	1.8e-86
WP_029227277.1|2128082_2129075_-	hypothetical protein	NA	Q6JIG0	Burkholderia_virus	97.6	5.5e-174
WP_009901173.1|2129228_2129489_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	86.0	3.8e-34
WP_029227278.1|2129485_2130307_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	97.8	9.2e-143
WP_009901176.1|2130341_2131316_-	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	77.4	2.0e-149
WP_009901177.1|2131753_2132044_+	DUF4145 domain-containing protein	NA	A4JX50	Burkholderia_virus	97.9	4.3e-47
WP_009901178.1|2132214_2132655_-	hypothetical protein	NA	Q8W6P5	Burkholderia_virus	97.9	8.8e-76
WP_009901179.1|2132838_2133075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901180.1|2133287_2133530_-	Cro/Cl family transcriptional regulator	NA	C7BGF8	Burkholderia_phage	71.4	5.4e-27
WP_009901181.1|2133615_2134008_+	hypothetical protein	NA	Q8W6P8	Burkholderia_virus	94.6	6.9e-64
WP_025987318.1|2134904_2135180_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	91.2	2.0e-41
WP_009901186.1|2135918_2136731_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	97.0	2.0e-142
WP_009901187.1|2137003_2137711_+	hypothetical protein	NA	Q6JII4	Burkholderia_virus	84.7	1.2e-109
WP_009901188.1|2137836_2138511_+	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	89.5	1.8e-112
WP_009901192.1|2140279_2141230_+	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	67.5	3.2e-123
WP_009901193.1|2141226_2141889_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	42.0	4.3e-34
WP_009901194.1|2141891_2142221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025987319.1|2142269_2142512_-	hypothetical protein	NA	Q6JIJ4	Burkholderia_virus	84.6	3.1e-30
WP_009901196.1|2142520_2142730_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	91.3	1.8e-31
WP_009901198.1|2143370_2144570_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.6	1.1e-107
WP_009901199.1|2144842_2146858_-	VC_2705 family sodium/solute symporter	NA	NA	NA	NA	NA
2144683:2144712	attR	TGGCGGAGAGAGGGGGATTCGAACCCCCGA	NA	NA	NA	NA
WP_045143316.1|2146851_2147232_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_009901201.1|2147329_2149312_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.3	8.9e-83
>prophage 4
NZ_CP008915	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966450	2649018	2673417	2966450	transposase	uncultured_virus(28.57%)	33	NA	NA
WP_080558217.1|2649018_2650287_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.3e-39
WP_157779363.1|2650361_2650895_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_144410512.1|2650966_2652087_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.8e-49
WP_144410514.1|2652211_2653445_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.4e-102
WP_009906959.1|2654072_2654303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906958.1|2654400_2654718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975758.1|2654805_2654955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906957.1|2655289_2655574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906956.1|2655863_2656076_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_080558217.1|2656165_2657434_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.3e-39
WP_034175064.1|2658731_2658917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907020.1|2658917_2659184_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_029227483.1|2659275_2660874_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_006480091.1|2661241_2661973_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_080001171.1|2662209_2662413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227484.1|2662608_2663031_-	HicB family protein	NA	NA	NA	NA	NA
WP_009907027.1|2663155_2663977_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_029227485.1|2664073_2664253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907030.1|2665239_2665527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907031.1|2665575_2665848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012339007.1|2665911_2666109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907033.1|2666645_2666963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907034.1|2667125_2667386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012339006.1|2667657_2667897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012339005.1|2667965_2668205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907039.1|2668928_2669132_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	5.9e-19
WP_155772935.1|2669360_2669516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907041.1|2669673_2669919_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_038711778.1|2670013_2670298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907043.1|2670546_2670744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039336681.1|2671115_2671478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_029227479.1|2671477_2671825_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	70.1	4.7e-40
WP_009906954.1|2671854_2673417_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	2.1e-143
>prophage 5
NZ_CP008915	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966450	2723710	2782141	2966450	holin,transposase,plate	Leptospira_phage(25.0%)	44	NA	NA
WP_009898227.1|2723710_2725906_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_144410576.1|2725986_2727074_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	3.4e-44
WP_004523721.1|2727393_2727813_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|2727832_2728159_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523719.1|2728631_2729324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080558009.1|2730146_2730503_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_009898259.1|2730979_2732122_-	porin	NA	NA	NA	NA	NA
WP_009898264.1|2732754_2733678_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009898267.1|2734295_2734598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275044.1|2735244_2735478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255401.1|2735591_2736791_-	transcriptional regulator CynR	NA	NA	NA	NA	NA
WP_019255400.1|2736790_2738215_-	TolC family protein	NA	NA	NA	NA	NA
WP_009898285.1|2738208_2739108_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009894707.1|2739109_2739334_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_038708432.1|2739330_2741397_-	FUSC family protein	NA	NA	NA	NA	NA
WP_009898294.1|2742406_2743948_-	membrane protein	NA	NA	NA	NA	NA
WP_155275045.1|2744295_2744652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039339343.1|2745496_2747392_+	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	6.9e-08
WP_009898304.1|2747467_2748919_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_080558013.1|2748990_2749197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025987413.1|2749169_2749763_-	membrane protein	NA	NA	NA	NA	NA
WP_009898306.1|2750348_2750903_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_038708388.1|2750984_2751710_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_009898310.1|2751869_2754566_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009898312.1|2754585_2755131_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025987410.1|2755161_2755851_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_029227146.1|2755853_2757530_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009898320.1|2757873_2758413_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009898321.1|2758446_2759946_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009894730.1|2760146_2760629_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_019255186.1|2760756_2761299_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_025405980.1|2761304_2762654_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009898325.1|2762650_2763952_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009898327.1|2763966_2767875_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009898329.1|2768065_2768635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039339348.1|2768735_2771429_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-35
WP_004523693.1|2771503_2771773_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_029227147.1|2771785_2775238_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038709601.1|2775130_2776489_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.6	7.6e-110
WP_009894750.1|2776521_2777550_-	fimbrial protein	NA	NA	NA	NA	NA
WP_009898344.1|2777605_2778676_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_009898345.1|2778694_2779744_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009894755.1|2779740_2781621_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009894757.1|2781622_2782141_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
