The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	410190	451463	4930963	integrase,protease,transposase	Lysinibacillus_phage(20.0%)	47	410602:410616	456410:456424
WP_032608281.1|410190_411480_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.0	1.0e-84
410602:410616	attL	GGCGGCCAGCAGTTG	NA	NA	NA	NA
WP_032608282.1|411501_412014_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004364974.1|412017_412914_-	cation transporter	NA	NA	NA	NA	NA
WP_029396360.1|413009_413417_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_016807974.1|413865_414336_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_016807973.1|414396_414933_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	64.8	9.5e-56
WP_016807972.1|414997_415240_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_004115558.1|415223_415472_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_044596300.1|415608_416274_+	PilL N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_032608284.1|416270_417029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608285.1|417040_417763_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608286.1|417741_418377_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_032608287.1|418382_418916_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608288.1|418915_419488_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_032608290.1|419498_419987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608291.1|419979_422079_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_006785966.1|422071_422830_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_032610154.1|422920_423268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608292.1|423452_423800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003029734.1|423799_424042_+	TIGR03758 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_006785968.1|424077_424464_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_004115534.1|424476_424833_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_004115533.1|424829_425489_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_006785972.1|425488_426439_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608294.1|426428_427931_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016151320.1|427941_428310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608297.1|428309_428720_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_032608298.1|428719_431578_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_032608299.1|431574_431952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608300.1|432036_432981_-	Abi family protein	NA	NA	NA	NA	NA
WP_127341290.1|433190_433484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087744867.1|433732_434853_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.9e-51
WP_071886161.1|434886_435741_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_032608304.1|435949_436348_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608305.1|436344_437337_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032608306.1|437336_438812_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_004115513.1|438822_439161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029593071.1|439163_440687_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004115509.1|440711_441113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077791480.1|441313_441829_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	9.2e-32
WP_029591133.1|441831_443103_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	60.5	8.1e-146
WP_028016388.1|444453_445422_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071886162.1|445803_446298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048859499.1|446360_447032_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_006786007.1|448001_448901_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_032608310.1|448967_449585_-	recombinase family protein	NA	NA	NA	NA	NA
WP_010791757.1|449780_451463_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
456410:456424	attR	GGCGGCCAGCAGTTG	NA	NA	NA	NA
>prophage 2
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	458068	487499	4930963	integrase,transposase	uncultured_Caudovirales_phage(66.67%)	28	454806:454822	476258:476274
454806:454822	attL	CCGGGGTGCACGCCACC	NA	NA	NA	NA
WP_000427623.1|458068_459073_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_074422537.1|459254_459431_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_003100858.1|459466_459793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|460047_460404_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032608318.1|461621_462590_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.2e-45
WP_002718009.1|462771_463332_+	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_000427614.1|465171_466176_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001549890.1|467044_467377_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025801347.1|467382_468096_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	5.1e-97
WP_001549888.1|468153_468582_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_044596299.1|468631_469915_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	1.3e-175
WP_001549886.1|470010_470364_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|470847_472326_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_004118529.1|472344_473172_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.3	4.9e-51
WP_001549953.1|473243_474440_-	MFS transporter	NA	NA	NA	NA	NA
WP_004118534.1|474968_475343_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_011977829.1|475617_476766_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
476258:476274	attR	CCGGGGTGCACGCCACC	NA	NA	NA	NA
WP_004118538.1|477119_477452_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_004118540.1|477583_478141_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118541.1|478301_481310_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_021443905.1|481621_481969_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_011405610.1|481965_482604_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_011405609.1|482684_483338_-	phenylmercury resistance protein MerG	NA	NA	NA	NA	NA
WP_011405608.1|483373_485083_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-34
WP_011405607.1|485270_485546_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|485559_485910_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_032608321.1|485981_486416_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|486494_487499_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	1290055	1337367	4930963	tail,terminase,holin,head,transposase	Cronobacter_phage(36.36%)	68	NA	NA
WP_032608689.1|1290055_1290286_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	94.7	5.7e-34
WP_032608690.1|1290294_1290534_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	2.8e-28
WP_032608691.1|1290511_1290823_-	DUF2591 family protein	NA	E5AGF4	Erwinia_phage	47.4	1.0e-14
WP_032608692.1|1290822_1291041_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	4.6e-17
WP_127341288.1|1291319_1291520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608697.1|1291516_1291735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608698.1|1291731_1292283_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.3	2.2e-55
WP_164088318.1|1292279_1292447_-	hypothetical protein	NA	G8C7S7	Escherichia_phage	92.7	5.6e-23
WP_032608699.1|1292443_1292872_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.1	1.5e-72
WP_032608700.1|1292868_1293549_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	95.1	6.9e-128
WP_032608701.1|1293545_1294391_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	55.4	4.5e-68
WP_032608703.1|1294409_1294694_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	1.9e-47
WP_000607101.1|1294766_1294976_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	97.1	3.9e-34
WP_023294196.1|1294972_1295131_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	96.2	5.8e-22
WP_044596295.1|1295127_1295322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042862569.1|1295663_1296137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608706.1|1296643_1296841_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	92.2	1.0e-23
WP_025760147.1|1296999_1297356_-	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	90.7	7.7e-54
WP_032608707.1|1297473_1297899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608708.1|1297895_1298354_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	49.3	1.8e-39
WP_032608710.1|1298350_1298596_-	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	50.0	4.4e-16
WP_016042178.1|1298811_1299501_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	100.0	2.2e-126
WP_016042179.1|1299611_1299839_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
WP_001514165.1|1299868_1300435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013095956.1|1300523_1300691_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	78.2	2.1e-14
WP_032608714.1|1300677_1301763_+	replication protein	NA	E5AGE9	Erwinia_phage	45.6	2.3e-85
WP_032608716.1|1301759_1303133_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.7	4.9e-165
WP_059555724.1|1303122_1303437_+	hypothetical protein	NA	I6PDF7	Cronobacter_phage	42.3	9.2e-11
WP_032608717.1|1303433_1303868_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	40.5	1.4e-09
WP_032608719.1|1303864_1304050_+	hypothetical protein	NA	K7P7P5	Enterobacteria_phage	91.8	1.6e-26
WP_032608720.1|1305152_1305608_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	66.9	2.9e-53
WP_032608721.1|1305607_1305778_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	92.9	2.4e-21
WP_032608722.1|1305770_1306406_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	85.4	1.1e-92
WP_032608723.1|1306515_1307205_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.5e-53
WP_032608724.1|1307481_1307883_+	membrane protein	NA	NA	NA	NA	NA
WP_001514184.1|1307879_1308155_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_032608725.1|1308158_1308599_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.1	4.4e-51
WP_044596275.1|1308595_1308982_+	DUF2570 domain-containing protein	NA	A0A2H4FNE5	Salmonella_phage	44.0	5.5e-05
WP_032608726.1|1309278_1309797_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.3	2.1e-92
WP_003859853.1|1310392_1310623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608731.1|1310842_1311493_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	99.5	9.2e-114
WP_032608733.1|1311489_1313052_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	93.2	8.8e-304
WP_032608735.1|1313080_1314538_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.4	9.8e-156
WP_063612943.1|1314464_1315463_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.4	2.1e-112
WP_032608737.1|1315497_1315914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608738.1|1315985_1317374_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.2	3.3e-153
WP_017693196.1|1317377_1317812_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	1.4e-49
WP_006808954.1|1317822_1318920_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.5	7.6e-161
WP_032608740.1|1318929_1319295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006808952.1|1319297_1319678_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
WP_032608741.1|1319677_1319851_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.9	2.7e-12
WP_032608742.1|1319850_1320201_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	8.9e-39
WP_032608743.1|1320203_1320668_+	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	45.5	1.2e-30
WP_032608745.1|1320664_1321048_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_052238023.1|1321147_1321642_+	HNH endonuclease	NA	G0ZNE5	Cronobacter_phage	50.7	1.0e-32
WP_000427623.1|1321823_1322828_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032608746.1|1323091_1323835_+	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	81.6	2.2e-71
WP_032608748.1|1323892_1324582_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.1	3.5e-55
WP_032608750.1|1324576_1324864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608752.1|1324979_1327886_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	39.0	1.3e-127
WP_032608753.1|1327885_1328383_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.1	3.7e-86
WP_015571561.1|1328382_1328853_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_032608754.1|1328866_1329232_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.8	4.6e-62
WP_032608755.1|1329218_1331696_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.5	0.0e+00
WP_032608756.1|1331754_1333971_+	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.4	1.0e-39
WP_032608758.1|1334504_1334891_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	56.6	1.3e-17
WP_032608759.1|1334978_1336451_-	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_032608760.1|1336443_1337367_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.8	1.4e-160
>prophage 4
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	2600789	2653546	4930963	lysis,tail,plate,terminase,holin,head,integrase,portal,capsid,protease	Erwinia_phage(24.32%)	62	2613455:2613469	2654831:2654845
WP_022651351.1|2600789_2601836_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	1.3e-19
WP_017384219.1|2602088_2602850_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_023314251.1|2602846_2603437_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_003856794.1|2603473_2604349_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003856793.1|2604446_2605067_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_023314252.1|2605063_2605957_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_071524153.1|2606084_2606129_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_032609352.1|2606223_2607786_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_032609354.1|2607785_2609381_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	1.2e-50
WP_032609355.1|2609384_2610743_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
WP_003856780.1|2610753_2611947_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_032609356.1|2611946_2612756_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_032609358.1|2612930_2614142_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
2613455:2613469	attL	GAAAATGACGAAAGT	NA	NA	NA	NA
WP_003856774.1|2614138_2614372_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_003856769.1|2614658_2615291_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_032609359.1|2615573_2615978_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_003856765.1|2616003_2616747_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_023324803.1|2616760_2617300_+	septation protein A	NA	NA	NA	NA	NA
WP_032609360.1|2617480_2619667_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_023314256.1|2619765_2620161_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_017384230.1|2620199_2620928_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_003856755.1|2621149_2621446_+	YciI family protein	NA	NA	NA	NA	NA
WP_032609363.1|2621589_2622066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609364.1|2622122_2623013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609365.1|2623129_2623351_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	69.9	6.0e-25
WP_032609366.1|2623427_2624597_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	76.9	4.0e-160
WP_032609367.1|2624593_2625058_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	4.2e-60
WP_032609369.1|2625070_2627518_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.1	4.6e-283
WP_032609370.1|2627507_2627630_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	1.0e-13
WP_032609371.1|2627662_2627965_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	1.4e-27
WP_032609372.1|2628021_2628540_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	8.5e-78
WP_032609374.1|2628552_2629746_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	8.3e-185
WP_032609376.1|2630120_2630636_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	36.8	4.4e-18
WP_032609378.1|2632491_2633022_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	1.5e-90
WP_032609381.1|2633014_2633923_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	83.1	3.2e-136
WP_023338715.1|2633928_2634279_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	69.8	1.5e-38
WP_032609382.1|2634275_2634917_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	83.1	1.6e-97
WP_032609384.1|2635048_2635780_+	UPF0489 family protein	NA	NA	NA	NA	NA
WP_032609386.1|2635849_2636299_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.5	2.6e-51
WP_032609387.1|2636291_2636759_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	6.5e-61
WP_072163335.1|2636721_2636967_-|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	1.0e-28
WP_038421124.1|2636854_2637280_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	70.1	9.2e-46
WP_032609391.1|2637276_2637786_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.9	1.7e-78
WP_032609392.1|2637769_2637991_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_032609394.1|2637981_2638185_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	76.1	6.1e-24
WP_032609395.1|2638184_2638691_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.2	7.1e-61
WP_038421123.1|2638790_2639546_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	65.3	7.5e-75
WP_032609400.1|2639549_2640617_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.3	3.9e-170
WP_032609401.1|2640672_2641527_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	72.2	1.0e-112
WP_032609402.1|2641693_2643463_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.7	1.1e-302
WP_032609403.1|2643464_2644490_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.9	2.1e-168
WP_032609405.1|2644817_2646017_+	ATP-binding protein	NA	A0A0P0IKU8	Acinetobacter_phage	32.6	3.4e-53
WP_032609407.1|2646019_2646538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128751144.1|2647219_2647777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609411.1|2647921_2648206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609413.1|2648202_2650500_-	replication endonuclease	NA	Q858T4	Yersinia_virus	75.5	0.0e+00
WP_014884151.1|2650501_2650765_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	57.0	2.0e-22
WP_014884152.1|2650787_2651006_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	62.1	3.8e-11
WP_014884153.1|2651072_2651573_-	hypothetical protein	NA	M1SV55	Escherichia_phage	75.9	7.4e-71
WP_014884154.1|2651739_2652015_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	85.6	6.8e-42
WP_014884155.1|2652139_2652439_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.9e-38
WP_032609415.1|2652535_2653546_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.1	1.2e-147
2654831:2654845	attR	GAAAATGACGAAAGT	NA	NA	NA	NA
>prophage 5
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	2890479	2944943	4930963	coat,integrase,terminase,holin	Pectobacterium_phage(26.67%)	58	2902402:2902418	2949630:2949646
WP_022651452.1|2890479_2891442_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_022651453.1|2891438_2893823_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_022651454.1|2893798_2894560_-	molecular chaperone	NA	NA	NA	NA	NA
WP_032609535.1|2894576_2895125_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_003859701.1|2895132_2895705_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_032609537.1|2896131_2897391_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003859699.1|2897436_2897940_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032659185.1|2897959_2899969_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_032609542.1|2899973_2900903_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003859696.1|2900899_2901787_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003859695.1|2901910_2902489_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
2902402:2902418	attL	CCAGCATTTGTAAACGC	NA	NA	NA	NA
WP_006811111.1|2902491_2902851_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003859692.1|2903638_2904067_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_003859691.1|2904082_2905507_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_023314361.1|2905481_2906285_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003859689.1|2906438_2907419_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_032609545.1|2907433_2908948_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	28.7	9.0e-11
WP_017384422.1|2909019_2910009_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_032610249.1|2910325_2910883_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_032609548.1|2911385_2911889_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_032609551.1|2912030_2913374_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_003859683.1|2913454_2913706_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_003859682.1|2913812_2913896_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_032609552.1|2914110_2915529_+	MFS transporter	NA	NA	NA	NA	NA
WP_003859680.1|2915572_2916211_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_003859678.1|2916456_2916795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044596268.1|2916995_2917493_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_003859673.1|2917529_2917766_-	YecH family protein	NA	NA	NA	NA	NA
WP_032609553.1|2917958_2919170_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_003859671.1|2919486_2920155_-	YecA family protein	NA	NA	NA	NA	NA
WP_003859669.1|2920566_2921688_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003859667.1|2921756_2922671_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032609554.1|2922682_2923957_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003859662.1|2923953_2924829_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_003859661.1|2924825_2925542_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
WP_032609555.1|2925705_2926176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651459.1|2926181_2927108_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003859653.1|2927137_2927461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154817219.1|2927550_2927913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609556.1|2928212_2928572_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.5	2.4e-15
WP_032609557.1|2928568_2929108_-	lysozyme	NA	H6WRZ4	Salmonella_phage	89.3	2.2e-92
WP_023295991.1|2929088_2929319_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	71.0	2.9e-22
WP_023295990.1|2929468_2929831_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	75.0	3.5e-46
WP_032609558.1|2929827_2930769_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.7	5.5e-160
WP_032609559.1|2930765_2932247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048859468.1|2932276_2934523_-	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	46.0	3.8e-66
WP_032609560.1|2934543_2936154_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	8.4e-225
WP_032609561.1|2936150_2936492_-	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	3.7e-21
WP_032609562.1|2936552_2936963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609563.1|2936962_2937721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886171.1|2938947_2939142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077870381.1|2939210_2939624_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	61.9	2.0e-37
WP_071886172.1|2940175_2940499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610253.1|2940549_2942742_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.9	6.5e-103
WP_032609565.1|2942738_2943299_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.3	2.9e-47
WP_032609566.1|2943301_2943484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609568.1|2943694_2943943_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	39.5	6.4e-07
WP_032609570.1|2943926_2944943_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.0	2.8e-125
2949630:2949646	attR	CCAGCATTTGTAAACGC	NA	NA	NA	NA
>prophage 6
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	3045966	3054816	4930963		Escherichia_phage(28.57%)	7	NA	NA
WP_032609643.1|3045966_3046971_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.3e-33
WP_032609644.1|3048445_3049612_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.2e-111
WP_023294999.1|3049865_3051272_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_023295000.1|3051407_3051956_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
WP_032609645.1|3051966_3052857_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	4.8e-28
WP_032609646.1|3052869_3053736_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.8e-110
WP_032103484.1|3053751_3054816_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
>prophage 7
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	3472655	3618322	4930963	lysis,tail,terminase,holin,coat,head,integrase,portal,tRNA,capsid,plate	Escherichia_phage(27.68%)	164	3491996:3492010	3616079:3616096
WP_003860666.1|3472655_3473381_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_003860668.1|3473513_3474317_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_003860669.1|3474378_3475359_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_003860670.1|3475349_3475988_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_022651600.1|3476113_3477391_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_003860673.1|3477391_3478531_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_003860675.1|3478703_3479126_+	DoxX family protein	NA	NA	NA	NA	NA
WP_003860678.1|3479179_3480433_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.0e-100
WP_032665849.1|3480737_3481928_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003860685.1|3482004_3482343_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_003860687.1|3482423_3483761_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.0	2.0e-09
WP_003860689.1|3483757_3484510_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_032610263.1|3484506_3485940_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	27.9	6.8e-16
WP_032609857.1|3486472_3490360_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	7.7e-131
WP_022651605.1|3490627_3492178_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
3491996:3492010	attL	GAGAAAGAAAAAGAG	NA	NA	NA	NA
WP_022651606.1|3492065_3492605_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
3491996:3492010	attL	GAGAAAGAAAAAGAG	NA	NA	NA	NA
WP_032609859.1|3492629_3493265_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_032609861.1|3493268_3494633_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_003860700.1|3494642_3495539_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_003860702.1|3495657_3496506_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003860704.1|3496562_3496823_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
WP_003860706.1|3496819_3497200_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003860707.1|3497199_3497931_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003860708.1|3498006_3498714_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003860709.1|3498731_3499637_-	GTPase Era	NA	NA	NA	NA	NA
WP_003860711.1|3499633_3500314_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_003860712.1|3500537_3501512_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003860714.1|3501527_3503333_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_044596260.1|3503515_3503839_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.5	4.1e-22
WP_044596259.1|3503838_3504078_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	70.5	2.2e-25
WP_044596258.1|3504160_3505459_-	hypothetical protein	NA	G8C7K5	Escherichia_phage	71.8	1.6e-170
WP_017694300.1|3505518_3505752_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	77.9	3.0e-30
WP_044596257.1|3505859_3506531_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	7.6e-87
WP_044596256.1|3506531_3506846_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	3.6e-31
WP_044596255.1|3506889_3510465_-|tail	phage tail protein	tail	G8C7R4	Escherichia_phage	87.8	0.0e+00
WP_023295178.1|3510520_3511120_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	95.5	1.1e-100
WP_044596254.1|3511107_3511839_-	C40 family peptidase	NA	G8C7R2	Escherichia_phage	95.9	4.5e-149
WP_044596253.1|3511851_3512622_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	96.1	9.2e-145
WP_044596252.1|3512621_3512972_-|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	90.5	4.4e-54
WP_023295182.1|3513057_3513444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596251.1|3513500_3516554_-|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	79.7	0.0e+00
WP_016247126.1|3516553_3516841_-	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	61.5	1.2e-17
WP_044596250.1|3516858_3517197_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	94.6	1.9e-54
WP_045325446.1|3517262_3518075_-	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	49.1	2.4e-50
WP_044596249.1|3518218_3519151_-|tail	major tail protein	tail	G8C7Q3	Escherichia_phage	98.7	1.1e-165
WP_025759418.1|3519197_3519644_-	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	90.6	5.1e-71
WP_039270145.1|3519633_3520233_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	89.9	1.0e-98
WP_039270143.1|3520234_3520588_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	89.7	1.2e-51
WP_039270141.1|3520589_3521072_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	95.6	5.7e-84
WP_044596248.1|3521074_3521320_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	58.0	1.3e-15
WP_032621539.1|3521359_3522496_-|coat	coat protein	coat	G8C7P7	Escherichia_phage	92.6	8.4e-195
WP_044596247.1|3522512_3523265_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	94.0	1.3e-127
WP_022651635.1|3523372_3523582_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	48.5	1.0e-13
WP_044596246.1|3523585_3524692_-	phage Mu F like family protein	NA	G8C7P5	Escherichia_phage	90.2	7.4e-188
WP_044596245.1|3524693_3526097_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	95.3	6.8e-255
WP_044596244.1|3526101_3527406_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	1.3e-146
WP_044596243.1|3527383_3528382_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	6.7e-39
WP_044596242.1|3528855_3529053_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	93.8	3.4e-27
WP_044596241.1|3529142_3529421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596240.1|3529548_3529728_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	79.5	1.0e-14
WP_044596288.1|3529684_3529954_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.1	9.0e-31
WP_044596239.1|3529961_3530591_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	86.6	3.9e-101
WP_048240575.1|3530590_3530872_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	4.4e-20
WP_023295203.1|3530858_3531245_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	78.1	3.0e-43
WP_044596238.1|3532100_3532910_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	70.9	9.1e-111
WP_044596237.1|3532906_3533047_-	YlcG family protein	NA	NA	NA	NA	NA
WP_044596236.1|3533043_3533400_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	95.8	1.4e-63
WP_022651648.1|3533396_3533678_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	100.0	7.2e-47
WP_032645668.1|3533680_3533881_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	66.7	3.7e-21
WP_017693509.1|3533886_3534486_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	87.8	2.7e-99
WP_071886175.1|3534522_3534771_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	87.8	4.5e-37
WP_006811588.1|3534886_3535120_-	DinI family protein	NA	A0A0M4REN2	Salmonella_phage	79.2	5.2e-27
WP_044596235.1|3535263_3537243_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.0	3.7e-206
WP_044596234.1|3537239_3537986_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.1	7.5e-67
WP_044596233.1|3537988_3538393_-	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	76.0	3.3e-13
WP_022651653.1|3538392_3538725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596232.1|3538721_3538982_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	73.5	8.1e-29
WP_044596231.1|3538985_3539672_-	DUF1627 domain-containing protein	NA	NA	NA	NA	NA
WP_044596230.1|3539688_3540441_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	83.2	1.5e-115
WP_044596229.1|3540437_3541421_-	replication protein	NA	H6WRX7	Salmonella_phage	78.0	1.7e-127
WP_044596228.1|3541757_3542300_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	53.9	2.0e-45
WP_044596227.1|3542302_3542536_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	61.0	4.7e-20
WP_044596226.1|3542639_3543035_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	71.8	5.9e-47
WP_044596287.1|3543154_3544231_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	60.5	6.2e-123
WP_044596286.1|3544271_3544481_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	89.9	1.8e-26
WP_032619247.1|3544766_3544952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044596225.1|3545071_3545257_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032654607.1|3545266_3545425_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	76.9	4.8e-16
WP_032665953.1|3545510_3545798_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	67.4	4.2e-34
WP_044596224.1|3545920_3548989_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7PJT5	Enterobacteria_phage	68.7	0.0e+00
WP_032682260.1|3549000_3550113_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	78.0	6.3e-163
WP_032682190.1|3550147_3550387_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.5	5.5e-24
WP_022651668.1|3550433_3550718_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	83.0	4.3e-39
WP_044596223.1|3550695_3551925_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.0	6.4e-241
WP_003860716.1|3552356_3552833_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_003860717.1|3552829_3553783_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_032609863.1|3553782_3554433_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3554464_3555040_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_003860722.1|3555466_3557086_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_032609866.1|3557070_3557808_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003860725.1|3557940_3559269_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
3559159:3559173	attR	GAGAAAGAAAAAGAG	NA	NA	NA	NA
WP_003860727.1|3559321_3559705_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
3559159:3559173	attR	GAGAAAGAAAAAGAG	NA	NA	NA	NA
WP_003860729.1|3560020_3560710_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_023314680.1|3560749_3561835_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860733.1|3562039_3562459_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_003860734.1|3562529_3563228_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_022651672.1|3563263_3565927_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_032609868.1|3566036_3567392_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|3567437_3567761_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_003860741.1|3567757_3569065_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_006811623.1|3569216_3569669_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
WP_044596222.1|3575319_3577893_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.8	3.1e-128
WP_003863167.1|3578022_3578754_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_003863165.1|3578750_3579731_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863164.1|3579862_3580600_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|3580867_3581209_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|3581314_3581362_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_023314685.1|3581469_3582630_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_032609874.1|3582626_3583499_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_174721864.1|3583677_3584091_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	43.5	6.0e-26
WP_023323577.1|3584136_3584358_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	4.9e-27
WP_032609875.1|3584434_3585604_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.8	7.9e-172
WP_032609877.1|3585600_3586065_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	7.2e-60
WP_032609878.1|3586075_3588526_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.9	9.3e-300
WP_017382998.1|3588515_3588638_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_032609880.1|3588670_3588994_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	64.0	4.4e-24
WP_023295232.1|3589051_3589570_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_032609883.1|3589582_3590776_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	4.1e-184
WP_032609885.1|3591150_3591582_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	55.1	5.3e-17
WP_032609887.1|3591583_3593932_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	47.0	8.8e-114
WP_032609889.1|3593943_3594474_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	1.4e-91
WP_023323586.1|3594466_3595375_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	83.8	8.3e-137
WP_023323587.1|3595380_3595731_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	72.4	8.1e-40
WP_032609890.1|3595727_3596369_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	81.7	5.6e-95
WP_032609891.1|3596575_3597088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609892.1|3597166_3598540_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_032609893.1|3598514_3599072_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_032609894.1|3599323_3599776_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.6	5.7e-46
WP_023295244.1|3599768_3600236_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	69.0	8.0e-59
WP_072163360.1|3600198_3600444_-|holin	holin	holin	S4TNY4	Salmonella_phage	75.3	1.1e-27
WP_032609895.1|3600331_3600748_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	3.5e-42
WP_032609896.1|3600747_3601179_-	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	77.6	1.8e-57
WP_032609897.1|3601175_3601688_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	88.8	2.3e-83
WP_014170137.1|3601671_3601893_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	72.6	2.1e-25
WP_017382979.1|3601883_3602087_-|tail	tail protein X	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_032609900.1|3602086_3602593_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_032609901.1|3602692_3603448_-|terminase	terminase endonuclease subunit	terminase	A0A0M4QWM0	Salmonella_phage	69.3	2.2e-74
WP_023295252.1|3603451_3604519_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.6	9.7e-169
WP_032609903.1|3604574_3605429_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	74.6	7.6e-116
WP_032609904.1|3605594_3607364_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.1	6.1e-301
WP_032609906.1|3607365_3608391_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	2.7e-168
WP_032610267.1|3608783_3609122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048859478.1|3609222_3609759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609909.1|3610165_3610630_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	54.9	4.4e-41
WP_044596221.1|3610635_3612921_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	75.3	0.0e+00
WP_023323606.1|3612910_3613186_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	59.3	2.2e-24
WP_044596220.1|3613202_3613418_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_023323608.1|3613482_3613983_-	hypothetical protein	NA	M1SV55	Escherichia_phage	89.2	8.5e-83
WP_180255712.1|3613973_3614180_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	65.2	2.0e-14
WP_023295263.1|3614155_3614428_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	3.4e-38
WP_023295264.1|3614587_3614881_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	71.1	7.7e-36
WP_044596219.1|3614950_3615931_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	81.0	4.0e-153
WP_022649060.1|3616119_3617241_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_006811632.1|3617251_3618322_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
>prophage 8
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	3623649	3667132	4930963	tail,terminase,holin,integrase,tRNA	Enterobacteria_phage(29.41%)	52	3615720:3615736	3670527:3670543
3615720:3615736	attL	TTAAACCCGATATTCCT	NA	NA	NA	NA
WP_003863138.1|3623649_3624417_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_032609925.1|3624448_3624988_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3625003_3625252_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3625368_3626730_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003863130.1|3626896_3627688_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032609927.1|3627707_3628994_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863126.1|3629046_3629640_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003863124.1|3629762_3630641_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_023314691.1|3630726_3632388_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_032609930.1|3632526_3632865_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003863119.1|3632926_3633214_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3633203_3633680_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3633797_3634280_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_013096351.1|3635003_3635243_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.9	2.2e-33
WP_123906383.1|3635329_3635755_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	2.4e-25
WP_071886176.1|3636515_3636869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077870385.1|3637122_3638250_-|tail	tail fiber domain-containing protein	tail	A0A2I6PID3	Escherichia_phage	37.3	2.1e-52
WP_032610594.1|3638307_3638541_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	75.3	2.5e-29
WP_032610595.1|3638648_3639320_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.9	1.1e-85
WP_032610596.1|3639320_3639635_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	71.6	6.4e-36
WP_032610597.1|3639678_3643476_-|tail	phage tail protein	tail	K7PHL5	Enterobacterial_phage	83.5	0.0e+00
WP_032610598.1|3643530_3644121_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	85.2	3.8e-90
WP_032610599.1|3644147_3644495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610600.1|3644523_3645234_-	C40 family peptidase	NA	K7PJV6	Enterobacteria_phage	96.2	1.5e-141
WP_032610602.1|3645235_3645991_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	92.4	1.0e-135
WP_032610603.1|3645987_3646326_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	77.7	9.2e-49
WP_052686367.1|3646328_3647285_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	55.2	1.5e-88
WP_032610605.1|3648119_3648593_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	95.5	7.2e-84
WP_032610606.1|3648750_3649101_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	2.7e-51
WP_071886177.1|3649100_3649691_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	76.0	1.2e-88
WP_032610607.1|3649672_3651130_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	92.6	4.0e-274
WP_032610608.1|3651218_3651917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886186.1|3652166_3652436_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.0	2.0e-30
WP_032610613.1|3652443_3653073_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	2.7e-102
WP_017384386.1|3653072_3653351_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.7e-37
WP_017384387.1|3653340_3653730_-|holin	phage holin family protein	holin	G8C7V8	Escherichia_phage	92.2	1.1e-58
WP_032610617.1|3654726_3655509_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	3.1e-108
WP_032610619.1|3655536_3656916_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	67.9	6.4e-173
WP_032610621.1|3656912_3657794_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	62.4	1.8e-80
WP_087920840.1|3657809_3658619_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	64.1	1.6e-83
WP_048859479.1|3658697_3658913_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
WP_023296237.1|3659066_3659759_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
WP_032610623.1|3659930_3660224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610624.1|3660305_3660695_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	58.8	4.0e-32
WP_032610625.1|3660801_3661023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296234.1|3661015_3661423_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.1e-47
WP_032610626.1|3661612_3662026_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	64.2	2.0e-45
WP_032610627.1|3662129_3662414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050710.1|3662403_3662613_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	97.1	4.4e-33
WP_032610629.1|3662567_3663740_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.3	5.0e-211
WP_032609931.1|3664063_3665293_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	85.6	1.1e-205
WP_032609933.1|3665575_3667132_+	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	31.0	1.4e-19
3670527:3670543	attR	AGGAATATCGGGTTTAA	NA	NA	NA	NA
>prophage 9
NZ_CP012165	Enterobacter hormaechei subsp. xiangfangensis strain 34978 chromosome, complete genome	4930963	4193285	4233577	4930963	lysis,tail,terminase,head,integrase,portal,tRNA,capsid,plate	Salmonella_phage(80.49%)	49	4187564:4187594	4238566:4238596
4187564:4187594	attL	GCCGGGTGGCGCTGCGCTTACCCGGCCTACA	NA	NA	NA	NA
WP_032607934.1|4193285_4194299_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	6.3e-109
WP_001144069.1|4194535_4194751_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003862574.1|4194866_4196612_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_006812010.1|4196764_4198609_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_032607936.1|4198709_4199216_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_015386379.1|4199552_4199771_-	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.6e-25
WP_032610578.1|4199840_4200941_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.6	5.5e-183
WP_032610580.1|4200937_4201423_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.1	3.0e-69
WP_032610582.1|4201422_4204866_-|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.4	0.0e+00
WP_007848878.1|4204858_4204978_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_007848877.1|4204992_4205295_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_007848874.1|4205349_4205865_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_032610584.1|4205874_4207047_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	1.6e-209
WP_032610585.1|4207179_4207578_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.0	2.4e-19
WP_032610586.1|4207577_4209314_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.5	3.3e-142
WP_032610588.1|4209310_4209916_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	5.2e-111
WP_032610589.1|4209908_4210817_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	8.0e-148
WP_039264785.1|4210803_4211163_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	89.0	1.5e-52
WP_014884896.1|4211159_4211738_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	8.2e-106
WP_014884897.1|4211806_4212253_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	2.4e-60
WP_014884898.1|4212245_4212677_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
WP_032610557.1|4212772_4213201_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.7	1.4e-57
WP_032610558.1|4213197_4213713_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	3.1e-72
WP_014884902.1|4213693_4213909_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_000868184.1|4213912_4214116_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884903.1|4214115_4214583_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_006777754.1|4214681_4215335_-|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_014884904.1|4215338_4216487_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	1.2e-132
WP_032610559.1|4216502_4217330_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	64.3	1.3e-72
WP_032610561.1|4217479_4219243_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.5	6.5e-312
WP_032610563.1|4219242_4220292_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.5	2.4e-156
WP_057979947.1|4220379_4220586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|4220763_4220997_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_032610566.1|4221009_4221198_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	91.9	5.7e-24
WP_032610567.1|4221359_4223753_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.4	0.0e+00
WP_032610569.1|4223749_4224601_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	72.3	2.8e-118
WP_032610570.1|4224597_4224825_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.5e-34
WP_032610571.1|4224824_4225058_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	79.2	2.1e-23
WP_032610572.1|4225125_4225467_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	4.5e-51
WP_015386352.1|4225430_4225631_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_015386351.1|4225638_4226148_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_015386350.1|4226182_4226419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610574.1|4226520_4227135_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.4	1.2e-38
WP_032610575.1|4227146_4228046_+	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_032610576.1|4228055_4229069_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_003862593.1|4229446_4230616_+	DNA repair ATPase	NA	NA	NA	NA	NA
WP_032607938.1|4230616_4231381_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_003862595.1|4231526_4232021_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032607942.1|4232017_4233577_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	7.4e-08
4238566:4238596	attR	GCCGGGTGGCGCTGCGCTTACCCGGCCTACA	NA	NA	NA	NA
>prophage 1
NZ_CP010363	Enterobacter hormaechei subsp. xiangfangensis strain 34978 plasmid p34978-139.941kb, complete sequence	139941	15525	58048	139941	transposase	Escherichia_phage(16.67%)	45	NA	NA
WP_022644915.1|15525_16479_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.4	1.4e-62
WP_022644914.1|16586_17174_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	36.5	2.6e-22
WP_022644913.1|17713_18232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644912.1|18561_19209_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	9.7e-39
WP_032072061.1|19199_19475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644911.1|19675_19876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644910.1|19977_21249_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	7.3e-147
WP_044596206.1|21260_21710_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	5.2e-31
WP_022644908.1|21706_21952_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.5e-08
WP_022644907.1|22155_22386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644906.1|22821_23754_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_004194746.1|23788_24022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644905.1|24018_24354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|24739_25441_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_022644904.1|25440_25662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644903.1|25671_26091_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_032072058.1|26144_26912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644901.1|27592_28021_+	antirestriction protein	NA	NA	NA	NA	NA
WP_022644900.1|28065_28572_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_022644899.1|28614_28806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404029.1|28999_29254_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	2.6e-11
WP_022644897.1|29289_29610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644896.1|30284_30827_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.7e-49
WP_022644895.1|30875_31124_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_022644894.1|31192_33193_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.2e-24
WP_015632482.1|33237_33669_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_022644893.1|33665_34394_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_015632484.1|34390_34717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087439983.1|34905_36280_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_022644891.1|36450_37491_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_162859354.1|37696_39979_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_015065592.1|40412_41945_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_004196353.1|42033_43374_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|43629_44052_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|44213_45344_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|45356_45626_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|45731_47030_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196325.1|47263_48022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|48075_48996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|49058_49430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|50341_51661_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|51910_52792_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|53110_53890_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|53886_54912_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|55018_58048_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010363	Enterobacter hormaechei subsp. xiangfangensis strain 34978 plasmid p34978-139.941kb, complete sequence	139941	69558	105274	139941	integrase,transposase	Escherichia_phage(22.73%)	43	68075:68090	105072:105087
68075:68090	attL	TCTTTCAGCGCCGCCA	NA	NA	NA	NA
WP_000427619.1|69558_70563_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|72459_73164_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_025404032.1|73199_73505_+	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|73540_73852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|74060_74549_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|74553_74760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|75171_76575_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|76608_77823_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|78083_78848_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|78990_79257_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|79477_79951_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|80926_81631_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001348075.1|81677_81914_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|81987_82404_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|82400_82631_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032072060.1|83175_83496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644887.1|83544_84183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644886.1|84185_84971_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.9e-52
WP_032408936.1|85028_85286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072094.1|85414_85528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012539983.1|86158_86914_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_022644883.1|87001_88540_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_000612626.1|88588_88936_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_007372134.1|88932_89337_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_015632469.1|90118_91324_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_022644882.1|91323_92298_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_022644881.1|92379_93651_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_020805749.1|93650_94082_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_001568038.1|94314_95286_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_022644880.1|95288_95960_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|96021_96252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|96688_97390_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|97389_97611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264790.1|97620_98040_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_022644878.1|98093_98861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644877.1|99541_99970_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.2e-10
WP_013214014.1|100012_100519_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568047.1|100561_100753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644876.1|100940_101204_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.4e-12
WP_022644875.1|101228_101549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020314935.1|102349_102907_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	72.4	1.8e-49
WP_020314938.1|102956_103205_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020314932.1|103273_105274_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.4	3.3e-21
105072:105087	attR	TGGCGGCGCTGAAAGA	NA	NA	NA	NA
