The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	201573	272279	4352101	transposase,protease,tRNA,coat	Pandoravirus(22.22%)	56	NA	NA
WP_003440504.1|201573_202515_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003440507.1|202943_206048_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	35.3	4.8e-184
WP_003440509.1|206280_207279_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003440511.1|207365_207950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440514.1|208041_208446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440516.1|208721_209651_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003440519.1|209765_210047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440522.1|210396_210582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087946533.1|210918_211065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760344.1|211162_211336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440545.1|213830_215354_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003440548.1|215433_215628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158380935.1|217272_217917_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003440556.1|218625_219384_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003440571.1|219561_223614_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003440573.1|223705_224278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440580.1|226503_227727_+	peptidase T	NA	NA	NA	NA	NA
WP_003440583.1|227731_228094_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003440585.1|228590_230780_+	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	26.6	1.1e-25
WP_003440587.1|230961_231645_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144311755.1|231641_233054_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003440593.1|233296_233860_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	44.9	3.3e-35
WP_034830481.1|233907_234384_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003440599.1|234453_235263_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.6	9.4e-23
WP_003440602.1|235264_236092_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	36.2	1.4e-13
WP_087946534.1|236088_236505_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_003440606.1|236474_237212_-	class B sortase	NA	NA	NA	NA	NA
WP_003440607.1|237484_238750_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_174548957.1|238818_239508_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.8	5.7e-37
WP_003440617.1|239504_240701_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_034830476.1|240723_241698_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	41.3	2.8e-50
WP_003440623.1|241867_242644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440625.1|242873_243782_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003440628.1|243786_245088_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003440630.1|245068_245905_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003440633.1|246496_247876_+	radical SAM protein	NA	NA	NA	NA	NA
WP_003440637.1|248191_249457_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003440640.1|249711_250854_-	glycosyltransferase family 4 protein	NA	A0A1X9SKE5	Sulfolobus_islandicus_rod-shaped_virus	26.8	4.3e-05
WP_003440641.1|251009_252020_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003440642.1|252028_252241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440643.1|252247_253006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440644.1|253148_254177_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_034830471.1|255707_256835_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003440649.1|257018_258023_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003440652.1|258137_259118_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_003440655.1|259363_259600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440657.1|260110_261673_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_003440660.1|261808_262651_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003440664.1|262768_263653_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_003440666.1|264167_264581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440668.1|264731_265847_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_003440673.1|265875_267039_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003440676.1|267335_268709_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_003440679.1|268900_269932_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003440682.1|270126_270543_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_034830312.1|270650_272279_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	30.6	4.3e-51
>prophage 2
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	2061123	2069448	4352101		uncultured_Mediterranean_phage(42.86%)	8	NA	NA
WP_003444245.1|2061123_2062002_+	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	25.8	6.0e-15
WP_003444249.1|2062085_2063252_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003444257.1|2063264_2064080_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.7	1.8e-53
WP_003444259.1|2064162_2064981_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	47.5	3.3e-60
WP_003444261.1|2064999_2066301_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	62.5	5.9e-144
WP_003444263.1|2066480_2067692_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.0	5.7e-32
WP_003444265.1|2068109_2068868_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_034830758.1|2068851_2069448_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.3	1.1e-20
>prophage 3
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	2085265	2135147	4352101	bacteriocin,transposase,protease,coat,integrase,tRNA	Paenibacillus_phage(22.22%)	42	2113377:2113392	2116548:2116563
WP_003444313.1|2085265_2086318_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003444314.1|2086492_2087365_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155760368.1|2087431_2087578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444315.1|2088036_2089368_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_003444316.1|2089412_2092040_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	27.5	3.2e-56
WP_003444318.1|2092115_2094008_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.5	2.1e-81
WP_034830709.1|2094146_2095085_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_174548953.1|2095185_2095437_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003444325.1|2096181_2097303_+	nitrogenase component 1	NA	NA	NA	NA	NA
WP_003444327.1|2097465_2098743_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003444329.1|2098904_2099516_-	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	39.7	1.9e-12
WP_003444331.1|2099772_2100336_-|protease	tesA-like protease	protease	NA	NA	NA	NA
WP_003444332.1|2100420_2100675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003444335.1|2101111_2101792_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003444338.1|2101846_2102722_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003444339.1|2102997_2104932_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_003444341.1|2105214_2106198_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	E3SJ83	Synechococcus_phage	25.7	1.1e-09
WP_003444343.1|2106199_2107174_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_003444345.1|2107221_2108538_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_003444347.1|2108551_2109943_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.9	1.8e-53
WP_003444349.1|2110204_2110780_+	arylesterase	NA	NA	NA	NA	NA
WP_003444351.1|2111103_2111514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003444353.1|2111631_2112621_-	tyrosine recombinase XerC	NA	A0A2R2ZHE2	Clostridioides_phage	26.3	8.8e-15
2113377:2113392	attL	AAAAAGTCAAATTATT	NA	NA	NA	NA
WP_003448320.1|2113579_2114386_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_034829662.1|2114401_2115661_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155760369.1|2118261_2118411_+	hypothetical protein	NA	NA	NA	NA	NA
2116548:2116563	attR	AATAATTTGACTTTTT	NA	NA	NA	NA
WP_003442373.1|2118851_2120072_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003442371.1|2120085_2121207_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003442369.1|2121451_2122288_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003442366.1|2122300_2123155_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003442365.1|2123192_2123705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442364.1|2123725_2125087_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_034830050.1|2125390_2125696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442362.1|2126017_2127409_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003442361.1|2127520_2129365_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	24.0	4.3e-15
WP_143756567.1|2129445_2129640_-|bacteriocin	CA_C0660 family putative sactipeptide bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003442358.1|2129730_2131092_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.4	1.3e-13
WP_034830048.1|2131101_2132667_-	radical SAM protein	NA	NA	NA	NA	NA
WP_087946539.1|2132984_2133128_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_051035244.1|2133129_2133744_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_076719024.1|2133849_2134137_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143756622.1|2134226_2135147_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	21.6	9.3e-11
>prophage 4
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	2552198	2609099	4352101	portal,tail,transposase,head,terminase,integrase,tRNA,capsid	Bacillus_phage(23.81%)	59	2598426:2598445	2611758:2611777
WP_003441319.1|2552198_2552936_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003441315.1|2553121_2553646_+	rubrerythrin	NA	NA	NA	NA	NA
WP_003441311.1|2553758_2555114_-	nitrogenase	NA	NA	NA	NA	NA
WP_003441308.1|2555150_2556701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441306.1|2557216_2558968_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_034829996.1|2559239_2559383_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_003441304.1|2559801_2560584_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	65.3	6.9e-39
WP_003441302.1|2560729_2562514_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.9	3.8e-16
WP_003441298.1|2562894_2563476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441294.1|2563971_2564808_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003441290.1|2564814_2565729_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	27.3	5.6e-16
WP_003441287.1|2566030_2567152_-	DUF4885 family protein	NA	NA	NA	NA	NA
WP_003441284.1|2567197_2568085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440352.1|2568858_2570154_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003441281.1|2570320_2570908_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003441277.1|2571523_2572690_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003441274.1|2572759_2573125_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003441270.1|2573501_2574020_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003441264.1|2574554_2574875_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003441259.1|2575074_2575344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444845.1|2575359_2576586_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003441250.1|2577289_2578498_-	response regulator	NA	NA	NA	NA	NA
WP_003441247.1|2578511_2578958_-	response regulator	NA	NA	NA	NA	NA
WP_003441244.1|2578932_2582418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441241.1|2582469_2582640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441238.1|2582711_2584277_-	recombinase family protein	NA	NA	NA	NA	NA
WP_155760376.1|2584359_2584500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441235.1|2584630_2586046_-	hypothetical protein	NA	Q0H227	Geobacillus_phage	27.5	6.9e-21
WP_003441232.1|2586062_2587691_-|tail	phage tail protein	tail	A0A0A7RUI9	Clostridium_phage	38.7	2.1e-50
WP_003441229.1|2587690_2588392_-|tail	phage tail family protein	tail	A0A0A7RWN1	Clostridium_phage	39.3	6.2e-39
WP_003441227.1|2588391_2590251_-	hypothetical protein	NA	M4QNS0	Tetraselmis_viridis_virus	24.6	7.2e-18
WP_158380941.1|2590250_2590523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441221.1|2590588_2590924_-	hypothetical protein	NA	A0A0U4KKN8	Bacillus_phage	33.3	1.2e-05
WP_003441218.1|2591050_2591620_-	hypothetical protein	NA	A0A0U4IS63	Bacillus_phage	40.6	8.8e-36
WP_003441216.1|2591637_2592012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441214.1|2592013_2592352_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_003441209.1|2592341_2592644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441207.1|2592648_2592945_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003441204.1|2592954_2593140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441203.1|2593225_2594275_-|capsid	major capsid protein	capsid	S5MNB6	Brevibacillus_phage	72.2	2.1e-144
WP_003441202.1|2594296_2594680_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	62.2	3.5e-36
WP_003441201.1|2594696_2595254_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_034829991.1|2595536_2595992_-	hypothetical protein	NA	A6N234	Microbacterium_phage	48.6	1.7e-18
WP_003441199.1|2596074_2596491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760556.1|2596817_2597159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441190.1|2597121_2598021_-|capsid	minor capsid protein	capsid	S5M601	Brevibacillus_phage	30.0	8.2e-20
WP_003441188.1|2598007_2599285_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	35.3	5.6e-62
2598426:2598445	attL	TTTTCAATATTATTTAGTTC	NA	NA	NA	NA
WP_003441184.1|2599346_2599766_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003441180.1|2599762_2600230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441177.1|2600235_2600655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034829988.1|2600727_2602278_-|terminase	phage terminase large subunit	terminase	A0A0N7AEF1	Bacillus_phage	35.6	9.7e-77
WP_003441172.1|2602447_2603497_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	30.6	1.6e-27
WP_003441170.1|2603526_2604372_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	28.9	3.5e-20
WP_003441168.1|2604556_2605261_-	hypothetical protein	NA	A0A2H4JAE2	uncultured_Caudovirales_phage	47.9	1.9e-24
WP_003441166.1|2605313_2605976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441163.1|2606098_2606521_-	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	35.6	4.0e-17
WP_003441161.1|2606591_2607500_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	45.5	6.9e-67
WP_003441158.1|2607588_2607858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441156.1|2607854_2609099_-	DNA modification methylase	NA	E4ZFL4	Streptococcus_phage	50.7	1.8e-121
2611758:2611777	attR	TTTTCAATATTATTTAGTTC	NA	NA	NA	NA
>prophage 5
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	2646735	2661108	4352101		Synechococcus_phage(33.33%)	10	NA	NA
WP_003447551.1|2646735_2648238_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.8	2.5e-61
WP_003447550.1|2648626_2649244_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	1.5e-20
WP_003447549.1|2649231_2650227_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	45.1	2.1e-64
WP_003447548.1|2650247_2651657_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.8	2.0e-57
WP_003447546.1|2651682_2652393_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	43.7	5.3e-46
WP_003447544.1|2652392_2652872_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	1.9e-31
WP_003447542.1|2653471_2657233_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.1	1.3e-34
WP_003447540.1|2657445_2657970_+	tryptophan transporter	NA	NA	NA	NA	NA
WP_003447538.1|2658276_2658648_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	32.7	1.7e-11
WP_003447537.1|2658822_2661108_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.6	7.5e-110
>prophage 6
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	2843854	2901867	4352101	transposase,tRNA,protease	Bacillus_phage(21.43%)	49	NA	NA
WP_003442595.1|2843854_2844502_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_071167516.1|2844774_2845455_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003442599.1|2845622_2846648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442602.1|2846658_2847687_-	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	26.9	1.2e-09
WP_003442605.1|2847829_2848870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442608.1|2848887_2849970_-	phosphodiester glycosidase family protein	NA	A0A291LB83	Escherichia_phage	37.2	4.5e-12
WP_003442611.1|2850291_2851668_-	PhoH family protein	NA	A0A141HS37	Bacillus_phage	48.0	9.7e-121
WP_003442614.1|2852141_2852570_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003442617.1|2852684_2853635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003441259.1|2853802_2854072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444845.1|2854087_2855314_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003442620.1|2855637_2856222_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003442623.1|2856202_2858545_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.6	9.9e-174
WP_003442626.1|2858668_2860345_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	33.1	1.0e-15
WP_003442629.1|2860491_2861796_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.4e-140
WP_003442632.1|2861815_2862400_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.2	4.8e-53
WP_003442635.1|2862523_2863819_-	trigger factor	NA	NA	NA	NA	NA
WP_003442639.1|2864042_2864825_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003442642.1|2864848_2865640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442644.1|2866042_2869231_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_003442647.1|2869340_2870426_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.0	1.5e-55
WP_003442650.1|2870771_2872289_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_003442654.1|2872500_2873082_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	31.0	6.3e-05
WP_003442657.1|2873227_2874127_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003442660.1|2874119_2874860_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_003442668.1|2875044_2875908_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003442670.1|2875919_2877107_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003442673.1|2877322_2877745_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_003442675.1|2877745_2878669_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.7	1.7e-52
WP_003442677.1|2879141_2879747_+	DedA family protein	NA	NA	NA	NA	NA
WP_003442679.1|2879924_2880497_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003442680.1|2880539_2882279_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.1	3.4e-62
WP_003442685.1|2882550_2882754_+	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_003442692.1|2884784_2886068_-	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	23.2	1.9e-09
WP_003442695.1|2886196_2887114_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003442699.1|2887793_2888006_-	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
WP_003442702.1|2888030_2888789_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003442705.1|2888956_2889964_-	3-dehydro-L-gulonate 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003442708.1|2890135_2890606_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_003442710.1|2890760_2892095_-	MFS transporter	NA	NA	NA	NA	NA
WP_003442711.1|2892430_2893288_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003442722.1|2893376_2894423_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003442724.1|2894473_2895487_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003442725.1|2895508_2896513_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003442726.1|2896527_2896998_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_003442727.1|2897528_2898518_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003442728.1|2898514_2898814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442729.1|2899306_2901565_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	39.8	3.4e-155
WP_003442730.1|2901567_2901867_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.1	9.4e-13
>prophage 7
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	3682971	3785301	4352101	portal,tail,transposase,protease,head,terminase,integrase,tRNA,capsid	Clostridium_phage(47.37%)	102	3731790:3731849	3768454:3768529
WP_003444845.1|3682971_3684198_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_051035266.1|3684316_3685084_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	37.1	3.2e-20
WP_003446396.1|3685229_3686300_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_003446394.1|3686494_3687187_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_003446392.1|3687188_3688160_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003446391.1|3688163_3688745_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	44.0	7.1e-49
WP_003446387.1|3688925_3691595_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	28.2	1.6e-82
WP_003446386.1|3691907_3694292_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	39.0	1.1e-143
WP_003446383.1|3694581_3694803_-	NifU family protein	NA	NA	NA	NA	NA
WP_003446380.1|3694988_3695405_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446377.1|3695682_3696318_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_003446375.1|3696562_3696904_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003446373.1|3697044_3697212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003446371.1|3697375_3698884_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_003446369.1|3698908_3699757_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003446368.1|3699759_3700701_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003446367.1|3700936_3702253_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003446366.1|3702367_3703345_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003446365.1|3703643_3704615_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003446364.1|3704718_3705573_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446363.1|3706006_3706834_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_003446362.1|3706930_3707125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003446005.1|3712993_3713470_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_003446003.1|3713595_3714351_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003446001.1|3714347_3715094_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003446000.1|3715120_3715642_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_087946548.1|3715644_3717522_-	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_162838520.1|3717577_3719434_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003445997.1|3719796_3720429_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003445996.1|3720797_3720971_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003445995.1|3721306_3722083_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003445993.1|3722847_3723138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445991.1|3723483_3723915_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003445989.1|3723921_3724320_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003445982.1|3724316_3724730_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003445981.1|3726122_3726668_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_034829853.1|3727186_3727543_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_003445979.1|3728278_3729310_-	Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase	NA	NA	NA	NA	NA
WP_003445978.1|3729465_3730950_-	Lsa family ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	26.6	1.1e-24
3731790:3731849	attL	TTTTGGCAGGGGCAGTAGGATTTGAACCCACAACCAATGGTTTTGGAGACCACTACTCTA	NA	NA	NA	NA
WP_003445977.1|3732491_3732701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838519.1|3732716_3732863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081387060.1|3732874_3733294_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_003445973.1|3733711_3733936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076719123.1|3733958_3735833_-|tail	phage tail protein	tail	H7BV46	unidentified_phage	28.3	3.0e-24
WP_003445971.1|3736015_3736393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445969.1|3736371_3736788_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_003445967.1|3737120_3737417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445965.1|3737434_3739276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445964.1|3739334_3740045_-|tail	phage tail family protein	tail	A0A286QN36	Streptococcus_phage	29.1	1.9e-19
WP_003445963.1|3740045_3742610_-|tail	phage tail tape measure protein	tail	A0A1L2BYA6	Clostridium_phage	45.4	3.8e-70
WP_034830073.1|3742831_3743131_-	hypothetical protein	NA	A0A1L2BYA4	Clostridium_phage	40.2	4.7e-12
WP_003445960.1|3743184_3743760_-|tail	phi13 family phage major tail protein	tail	A0A1L2BYA0	Clostridium_phage	58.9	2.2e-58
WP_003445958.1|3743780_3744113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445955.1|3744115_3744499_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	38.8	1.1e-16
WP_003445954.1|3744498_3744858_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_003445953.1|3744858_3745149_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003445952.1|3745195_3746290_-|capsid	phage major capsid protein	capsid	I2E8V4	Clostridium_phage	53.6	2.3e-96
WP_003445951.1|3746348_3746948_-|head,protease	HK97 family phage prohead protease	head,protease	D7PQ42	Enterococcus_phage	40.9	4.9e-29
WP_003445950.1|3746952_3748170_-|portal	phage portal protein	portal	I2E8V3	Clostridium_phage	41.5	9.6e-80
WP_003445949.1|3748170_3748374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445948.1|3748390_3750076_-|terminase	terminase large subunit	terminase	A0A0A7RUM0	Clostridium_phage	52.0	8.4e-167
WP_003445945.1|3750075_3750534_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7RUQ4	Clostridium_phage	62.7	4.3e-41
WP_003445944.1|3750723_3751158_-	hypothetical protein	NA	Q0SPJ9	Clostridium_phage	36.6	4.7e-13
WP_155760388.1|3751160_3751325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445943.1|3751430_3751700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034830069.1|3751711_3752050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445941.1|3752327_3752549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445940.1|3752628_3752943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034830067.1|3752944_3753397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445937.1|3753396_3753657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445933.1|3753791_3754304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445931.1|3754397_3755147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445929.1|3755672_3757832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760390.1|3757857_3758025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445927.1|3758111_3761399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445925.1|3761904_3762105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445923.1|3762124_3762847_-	hypothetical protein	NA	A0A0K2FM38	Brevibacillus_phage	28.0	1.6e-10
WP_003445921.1|3762920_3763262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445919.1|3763412_3763640_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003445915.1|3763713_3764589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445914.1|3764592_3765726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445912.1|3765819_3766056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445910.1|3766698_3766950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445908.1|3766965_3767280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445907.1|3767282_3768296_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.0	8.1e-32
WP_003445904.1|3768771_3769194_-	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
3768454:3768529	attR	TTTTGGCAGGGGCAGTAGGATTTGAACCCACAACCAATGGTTTTGGAGACCACTACTCTACCGTTGAGCCATACCC	NA	NA	NA	NA
WP_003445901.1|3769265_3770090_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445899.1|3770335_3770719_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003445897.1|3770732_3771635_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003445895.1|3771824_3773087_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003445893.1|3773307_3773766_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003445892.1|3773762_3774476_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003445890.1|3774468_3774918_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003445888.1|3775011_3775635_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003445886.1|3775931_3778088_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_003445883.1|3778361_3778688_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003445881.1|3778852_3779407_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_143756631.1|3779435_3780383_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003445878.1|3780437_3781745_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003445876.1|3781768_3783256_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003445875.1|3783257_3784160_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003445871.1|3784224_3785301_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	4024668	4081958	4352101	holin,tRNA,transposase,coat	Streptococcus_phage(18.75%)	56	NA	NA
WP_158380946.1|4024668_4024815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_034830606.1|4024925_4026479_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_003447816.1|4026562_4026751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034830604.1|4026836_4027607_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.1	4.9e-37
WP_003447612.1|4029222_4029900_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_003447614.1|4029931_4030309_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003447615.1|4030338_4031526_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003447617.1|4031522_4032209_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	2.0e-34
WP_003447619.1|4032186_4033239_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155760402.1|4033363_4033528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447621.1|4033517_4034192_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.4	1.9e-13
WP_003447623.1|4034208_4034709_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003447630.1|4036620_4036941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447632.1|4037557_4038910_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003447635.1|4039103_4039625_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003447637.1|4039681_4040335_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003447638.1|4040527_4040968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003447640.1|4041014_4042571_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	7.8e-50
WP_003447643.1|4042691_4043402_-	2-phosphosulfolactate phosphatase family protein	NA	NA	NA	NA	NA
WP_003447646.1|4043526_4044477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003447648.1|4044488_4045598_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	31.8	1.4e-21
WP_143756599.1|4045692_4046622_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	43.9	1.7e-31
WP_003447653.1|4046718_4047876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447655.1|4048132_4049179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003447656.1|4049264_4050164_+	radical SAM protein	NA	NA	NA	NA	NA
WP_003447659.1|4050305_4052105_-	heme NO-binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	1.0e-05
WP_003447661.1|4052124_4052799_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003447663.1|4052804_4053191_-	DUF3783 domain-containing protein	NA	NA	NA	NA	NA
WP_003447665.1|4053246_4053762_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	43.9	3.5e-23
WP_003447666.1|4053914_4054694_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003447667.1|4055117_4057205_+	glutamine synthetase III	NA	NA	NA	NA	NA
WP_003447668.1|4057298_4058105_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.6	1.0e-37
WP_003447669.1|4058275_4059076_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	47.8	4.2e-60
WP_003447670.1|4059104_4060361_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.3	5.0e-108
WP_034830663.1|4060437_4060692_+	DUF4491 family protein	NA	NA	NA	NA	NA
WP_003447672.1|4060777_4062169_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.0	1.3e-83
WP_003447673.1|4062546_4064388_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	25.5	2.9e-27
WP_003447684.1|4064440_4064605_-	rubredoxin	NA	NA	NA	NA	NA
WP_003447686.1|4064817_4065354_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003447688.1|4065408_4065636_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003447690.1|4065637_4066564_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	40.7	2.6e-61
WP_003447691.1|4066916_4067213_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_003447692.1|4067233_4067506_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_003447694.1|4067536_4068109_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_003447696.1|4068312_4068852_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_143756635.1|4068856_4069423_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_158380947.1|4069533_4069695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760404.1|4069852_4070017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447703.1|4070166_4071555_-	Fe-only nitrogenase subunit beta	NA	NA	NA	NA	NA
WP_003447705.1|4071570_4071921_-	Fe-only nitrogenase subunit delta	NA	NA	NA	NA	NA
WP_003447707.1|4071936_4073514_-	nitrogenase iron-iron protein, alpha chain	NA	NA	NA	NA	NA
WP_003440352.1|4073922_4075218_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003447709.1|4075403_4076231_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_003447711.1|4077320_4079078_-	ATP-dependent RNA helicase	NA	A0A248SJQ0	Salicola_phage	31.7	2.5e-60
WP_003447713.1|4079253_4080828_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_143756600.1|4080827_4081958_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	44.2	2.6e-18
>prophage 9
NZ_CP009268	Clostridium pasteurianum DSM 525 = ATCC 6013 strain DSM 525 chromosome, complete genome	4352101	4268821	4325166	4352101	holin,transposase,protease,terminase,integrase	Clostridium_phage(81.08%)	59	4288049:4288066	4334481:4334498
WP_051035257.1|4268821_4269277_+|integrase	site-specific integrase	integrase	A0A0A8WF01	Clostridium_phage	32.0	1.5e-09
WP_158380949.1|4269333_4269495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003445019.1|4269814_4271131_-	High affinity gluconate/L-idonate permease	NA	NA	NA	NA	NA
WP_003445018.1|4271541_4273260_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003445017.1|4273522_4274839_-	High affinity gluconate/L-idonate permease	NA	NA	NA	NA	NA
WP_003445015.1|4275258_4275936_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445014.1|4275961_4276981_-	sugar kinase	NA	NA	NA	NA	NA
WP_003445013.1|4276999_4277644_-	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003445012.1|4277886_4278651_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445011.1|4279028_4279469_+	Hsp20/alpha crystallin family protein	NA	A0A218MMV3	uncultured_virus	31.1	1.6e-05
WP_003445010.1|4280101_4280599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445009.1|4280653_4281637_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RUJ1	Clostridium_phage	42.2	2.0e-35
WP_003445002.1|4281655_4282045_-|holin	phage holin family protein	holin	A0A0A7S099	Clostridium_phage	56.7	9.6e-34
WP_003445000.1|4282087_4288990_-	carbohydrate binding domain-containing protein	NA	M9Q2I5	Clostridium_phage	39.7	1.2e-62
4288049:4288066	attL	ATAATTAATACTGTTGGA	NA	NA	NA	NA
WP_003444998.1|4289016_4289394_-	hypothetical protein	NA	M9Q2L1	Clostridium_phage	47.2	1.7e-22
WP_034830556.1|4289459_4289729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444994.1|4289908_4290256_-	hypothetical protein	NA	M9Q2F8	Clostridium_phage	58.3	6.8e-31
WP_003444992.1|4290266_4294394_-	transglycosylase SLT domain-containing protein	NA	M9Q251	Clostridium_phage	46.7	7.5e-100
WP_003444989.1|4294434_4294854_-	hypothetical protein	NA	M9Q2L2	Clostridium_phage	60.9	5.9e-21
WP_034830554.1|4294914_4295223_-	bacteriophage Gp15 protein	NA	M9Q2I4	Clostridium_phage	73.3	8.7e-38
WP_003444987.1|4295237_4295567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444986.1|4295588_4296044_-	hypothetical protein	NA	M9Q1I1	Clostridium_phage	59.7	1.1e-47
WP_003444985.1|4296054_4296441_-	hypothetical protein	NA	M9Q2F6	Clostridium_phage	68.0	2.6e-47
WP_003444984.1|4296440_4296824_-	hypothetical protein	NA	M9Q249	Clostridium_phage	64.6	8.3e-38
WP_003444983.1|4296823_4297150_-	hypothetical protein	NA	M9Q2I3	Clostridium_phage	54.3	4.1e-30
WP_003444966.1|4297158_4297518_-	hypothetical protein	NA	M9Q2K9	Clostridium_phage	56.7	3.7e-32
WP_003444957.1|4297520_4297808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444955.1|4297818_4298784_-	hypothetical protein	NA	A0A1J0MCK3	Streptomyces_phage	55.2	4.4e-88
WP_003444953.1|4298799_4299399_-	phage scaffolding protein	NA	S5MUG0	Brevibacillus_phage	42.6	2.9e-29
WP_003444951.1|4299537_4299702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143756604.1|4299684_4299885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444947.1|4299895_4300138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444945.1|4300205_4300529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444943.1|4302164_4303670_-	hypothetical protein	NA	M9Q246	Clostridium_phage	63.0	1.3e-182
WP_034830630.1|4303672_4305064_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	72.9	2.0e-198
WP_034830628.1|4305056_4305578_-|transposase	transposase	transposase	A0A0A7RTH0	Clostridium_phage	73.3	2.0e-58
WP_003444940.1|4305794_4306343_-	hypothetical protein	NA	I2E8Y5	Clostridium_phage	30.2	8.6e-12
WP_003444939.1|4306355_4307720_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	62.1	1.7e-162
WP_003444938.1|4307716_4307995_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	52.2	3.1e-18
WP_003444935.1|4308266_4310693_-	putative virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	79.2	0.0e+00
WP_155760405.1|4310727_4310874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444933.1|4311153_4312179_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	33.1	2.1e-43
WP_003444932.1|4312193_4314152_-	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	78.2	0.0e+00
WP_003444931.1|4314156_4314717_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	84.9	4.4e-88
WP_003444930.1|4314838_4316002_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	66.8	6.2e-145
WP_003444929.1|4316003_4316453_-	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	32.3	1.6e-08
WP_003444928.1|4316488_4316749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444927.1|4316762_4317224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444925.1|4317544_4318156_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003444924.1|4318142_4318409_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	49.3	8.4e-13
WP_003444922.1|4318539_4318782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444920.1|4318815_4318956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444918.1|4319121_4319289_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	64.2	8.9e-13
WP_003444916.1|4319305_4319554_-	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	59.7	4.4e-16
WP_003444915.1|4319740_4320181_+	helix-turn-helix transcriptional regulator	NA	Q8SBN0	Clostridium_phage	57.8	7.3e-22
WP_003444914.1|4320214_4320676_+	hypothetical protein	NA	A0A0A7RVV2	Clostridium_phage	57.9	2.6e-46
WP_003444913.1|4320767_4321817_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	63.8	1.1e-127
WP_003444912.1|4321888_4323220_-	replicative DNA helicase	NA	O80281	Escherichia_phage	47.7	4.2e-105
WP_174548956.1|4323243_4325166_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	23.2	1.0e-22
4334481:4334498	attR	TCCAACAGTATTAATTAT	NA	NA	NA	NA
