The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	201573	272279	4351893	coat,transposase,protease,tRNA	Pandoravirus(22.22%)	56	NA	NA
WP_003440504.1|201573_202515_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003440507.1|202943_206048_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	35.3	4.8e-184
WP_003440509.1|206280_207279_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003440511.1|207365_207950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440514.1|208041_208446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440516.1|208721_209651_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003440519.1|209765_210047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440522.1|210396_210582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087946533.1|210918_211065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760344.1|211162_211336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440545.1|213830_215354_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003440548.1|215433_215628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158380935.1|217272_217917_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003440556.1|218625_219384_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003440571.1|219561_223614_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003440573.1|223705_224278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440580.1|226503_227727_+	peptidase T	NA	NA	NA	NA	NA
WP_003440583.1|227731_228094_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003440585.1|228590_230780_+	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	26.6	1.1e-25
WP_003440587.1|230961_231645_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144311755.1|231641_233054_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003440593.1|233296_233860_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	44.9	3.3e-35
WP_034830481.1|233907_234384_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003440599.1|234453_235263_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.6	9.4e-23
WP_003440602.1|235264_236092_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	36.2	1.4e-13
WP_087946534.1|236088_236505_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_003440606.1|236474_237212_-	class B sortase	NA	NA	NA	NA	NA
WP_003440607.1|237484_238750_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_174548957.1|238818_239508_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.8	5.7e-37
WP_003440617.1|239504_240701_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_034830476.1|240723_241698_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	41.3	2.8e-50
WP_003440623.1|241867_242644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440625.1|242873_243782_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003440628.1|243786_245088_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003440630.1|245068_245905_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003440633.1|246496_247876_+	radical SAM protein	NA	NA	NA	NA	NA
WP_003440637.1|248191_249457_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003440640.1|249711_250854_-	glycosyltransferase family 4 protein	NA	A0A1X9SKE5	Sulfolobus_islandicus_rod-shaped_virus	26.8	4.3e-05
WP_003440641.1|251009_252020_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003440642.1|252028_252241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440643.1|252247_253006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440644.1|253148_254177_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_034830471.1|255707_256835_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003440649.1|257018_258023_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003440652.1|258137_259118_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_003440655.1|259363_259600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440657.1|260110_261673_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_003440660.1|261808_262651_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003440664.1|262768_263653_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_003440666.1|264167_264581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440668.1|264731_265847_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_003440673.1|265875_267039_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003440676.1|267335_268709_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_003440679.1|268900_269932_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003440682.1|270126_270543_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_034830312.1|270650_272279_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	30.6	4.3e-51
>prophage 2
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	2061123	2069448	4351893		uncultured_Mediterranean_phage(42.86%)	8	NA	NA
WP_003444245.1|2061123_2062002_+	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	25.8	6.0e-15
WP_003444249.1|2062085_2063252_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003444257.1|2063264_2064080_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.7	1.8e-53
WP_003444259.1|2064162_2064981_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	47.5	3.3e-60
WP_003444261.1|2064999_2066301_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	62.5	5.9e-144
WP_003444263.1|2066480_2067692_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.0	5.7e-32
WP_003444265.1|2068109_2068868_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_034830758.1|2068851_2069448_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.3	1.1e-20
>prophage 3
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	2085265	2135147	4351893	protease,tRNA,transposase,bacteriocin,coat,integrase	Paenibacillus_phage(22.22%)	42	2113377:2113392	2116548:2116563
WP_003444313.1|2085265_2086318_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003444314.1|2086492_2087365_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155760368.1|2087431_2087578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444315.1|2088036_2089368_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_003444316.1|2089412_2092040_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	27.5	3.2e-56
WP_003444318.1|2092115_2094008_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.5	2.1e-81
WP_034830709.1|2094146_2095085_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_174548953.1|2095185_2095437_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003444325.1|2096181_2097303_+	nitrogenase component 1	NA	NA	NA	NA	NA
WP_003444327.1|2097465_2098743_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003444329.1|2098904_2099516_-	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	39.7	1.9e-12
WP_003444331.1|2099772_2100336_-|protease	tesA-like protease	protease	NA	NA	NA	NA
WP_003444332.1|2100420_2100675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003444335.1|2101111_2101792_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003444338.1|2101846_2102722_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003444339.1|2102997_2104932_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_003444341.1|2105214_2106198_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	E3SJ83	Synechococcus_phage	25.7	1.1e-09
WP_003444343.1|2106199_2107174_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_003444345.1|2107221_2108538_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_003444347.1|2108551_2109943_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.9	1.8e-53
WP_003444349.1|2110204_2110780_+	arylesterase	NA	NA	NA	NA	NA
WP_003444351.1|2111103_2111514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003444353.1|2111631_2112621_-	tyrosine recombinase XerC	NA	A0A2R2ZHE2	Clostridioides_phage	26.3	8.8e-15
2113377:2113392	attL	AAAAAGTCAAATTATT	NA	NA	NA	NA
WP_003448320.1|2113579_2114386_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_034829662.1|2114401_2115661_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155760369.1|2118261_2118411_+	hypothetical protein	NA	NA	NA	NA	NA
2116548:2116563	attR	AATAATTTGACTTTTT	NA	NA	NA	NA
WP_003442373.1|2118851_2120072_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003442371.1|2120085_2121207_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003442369.1|2121451_2122288_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003442366.1|2122300_2123155_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003442365.1|2123192_2123705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442364.1|2123725_2125087_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_034830050.1|2125390_2125696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442362.1|2126017_2127409_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003442361.1|2127520_2129365_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	24.0	4.3e-15
WP_143756567.1|2129445_2129640_-|bacteriocin	CA_C0660 family putative sactipeptide bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003442358.1|2129730_2131092_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.4	1.3e-13
WP_034830048.1|2131101_2132667_-	radical SAM protein	NA	NA	NA	NA	NA
WP_087946539.1|2132984_2133128_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_051035244.1|2133129_2133744_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_076719024.1|2133849_2134137_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143756622.1|2134226_2135147_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	21.6	9.3e-11
>prophage 4
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	2551990	2608891	4351893	head,capsid,tRNA,transposase,portal,tail,integrase,terminase	Bacillus_phage(23.81%)	59	2598218:2598237	2611550:2611569
WP_003441319.1|2551990_2552728_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003441315.1|2552913_2553438_+	rubrerythrin	NA	NA	NA	NA	NA
WP_003441311.1|2553550_2554906_-	nitrogenase	NA	NA	NA	NA	NA
WP_003441308.1|2554942_2556493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441306.1|2557008_2558760_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_034829996.1|2559031_2559175_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_003441304.1|2559593_2560376_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	65.3	6.9e-39
WP_003441302.1|2560521_2562306_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.9	3.8e-16
WP_003441298.1|2562686_2563268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441294.1|2563763_2564600_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003441290.1|2564606_2565521_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	27.3	5.6e-16
WP_003441287.1|2565822_2566944_-	DUF4885 family protein	NA	NA	NA	NA	NA
WP_003441284.1|2566989_2567877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440352.1|2568650_2569946_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003441281.1|2570112_2570700_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003441277.1|2571315_2572482_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003441274.1|2572551_2572917_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003441270.1|2573293_2573812_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003441264.1|2574346_2574667_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003441259.1|2574866_2575136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444845.1|2575151_2576378_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003441250.1|2577081_2578290_-	response regulator	NA	NA	NA	NA	NA
WP_003441247.1|2578303_2578750_-	response regulator	NA	NA	NA	NA	NA
WP_003441244.1|2578724_2582210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441241.1|2582261_2582432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441238.1|2582503_2584069_-	recombinase family protein	NA	NA	NA	NA	NA
WP_155760376.1|2584151_2584292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441235.1|2584422_2585838_-	hypothetical protein	NA	Q0H227	Geobacillus_phage	27.5	6.9e-21
WP_003441232.1|2585854_2587483_-|tail	phage tail protein	tail	A0A0A7RUI9	Clostridium_phage	38.7	2.1e-50
WP_003441229.1|2587482_2588184_-|tail	phage tail family protein	tail	A0A0A7RWN1	Clostridium_phage	39.3	6.2e-39
WP_003441227.1|2588183_2590043_-	hypothetical protein	NA	M4QNS0	Tetraselmis_viridis_virus	24.6	7.2e-18
WP_158380941.1|2590042_2590315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441221.1|2590380_2590716_-	hypothetical protein	NA	A0A0U4KKN8	Bacillus_phage	33.3	1.2e-05
WP_003441218.1|2590842_2591412_-	hypothetical protein	NA	A0A0U4IS63	Bacillus_phage	40.6	8.8e-36
WP_003441216.1|2591429_2591804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441214.1|2591805_2592144_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_003441209.1|2592133_2592436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441207.1|2592440_2592737_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003441204.1|2592746_2592932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441203.1|2593017_2594067_-|capsid	major capsid protein	capsid	S5MNB6	Brevibacillus_phage	72.2	2.1e-144
WP_003441202.1|2594088_2594472_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	62.2	3.5e-36
WP_003441201.1|2594488_2595046_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_034829991.1|2595328_2595784_-	hypothetical protein	NA	A6N234	Microbacterium_phage	48.6	1.7e-18
WP_003441199.1|2595866_2596283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441198.1|2596609_2596912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441190.1|2596913_2597813_-|capsid	minor capsid protein	capsid	S5M601	Brevibacillus_phage	30.0	8.2e-20
WP_003441188.1|2597799_2599077_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	35.3	5.6e-62
2598218:2598237	attL	TTTTCAATATTATTTAGTTC	NA	NA	NA	NA
WP_003441184.1|2599138_2599558_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003441180.1|2599554_2600022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441177.1|2600027_2600447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034829988.1|2600519_2602070_-|terminase	phage terminase large subunit	terminase	A0A0N7AEF1	Bacillus_phage	35.6	9.7e-77
WP_003441172.1|2602239_2603289_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	30.6	1.6e-27
WP_003441170.1|2603318_2604164_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	28.9	3.5e-20
WP_003441168.1|2604348_2605053_-	hypothetical protein	NA	A0A2H4JAE2	uncultured_Caudovirales_phage	47.9	1.9e-24
WP_003441166.1|2605105_2605768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441163.1|2605890_2606313_-	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	35.6	4.0e-17
WP_003441161.1|2606383_2607292_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	45.5	6.9e-67
WP_003441158.1|2607380_2607650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441156.1|2607646_2608891_-	DNA modification methylase	NA	E4ZFL4	Streptococcus_phage	50.7	1.8e-121
2611550:2611569	attR	TTTTCAATATTATTTAGTTC	NA	NA	NA	NA
>prophage 5
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	2646527	2660900	4351893		Synechococcus_phage(33.33%)	10	NA	NA
WP_003447551.1|2646527_2648030_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.8	2.5e-61
WP_003447550.1|2648418_2649036_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	1.5e-20
WP_003447549.1|2649023_2650019_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	45.1	2.1e-64
WP_003447548.1|2650039_2651449_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.8	2.0e-57
WP_003447546.1|2651474_2652185_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	43.7	5.3e-46
WP_003447544.1|2652184_2652664_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	1.9e-31
WP_003447542.1|2653263_2657025_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.1	1.3e-34
WP_003447540.1|2657237_2657762_+	tryptophan transporter	NA	NA	NA	NA	NA
WP_003447538.1|2658068_2658440_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	32.7	1.7e-11
WP_003447537.1|2658614_2660900_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.6	7.5e-110
>prophage 6
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	2843646	2901659	4351893	transposase,protease,tRNA	Bacillus_phage(21.43%)	49	NA	NA
WP_003442595.1|2843646_2844294_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_071167516.1|2844566_2845247_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003442599.1|2845414_2846440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442602.1|2846450_2847479_-	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	26.9	1.2e-09
WP_003442605.1|2847621_2848662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442608.1|2848679_2849762_-	phosphodiester glycosidase family protein	NA	A0A291LB83	Escherichia_phage	37.2	4.5e-12
WP_003442611.1|2850083_2851460_-	PhoH family protein	NA	A0A141HS37	Bacillus_phage	48.0	9.7e-121
WP_003442614.1|2851933_2852362_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003442617.1|2852476_2853427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003441259.1|2853594_2853864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444845.1|2853879_2855106_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003442620.1|2855429_2856014_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003442623.1|2855994_2858337_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.6	9.9e-174
WP_003442626.1|2858460_2860137_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	33.1	1.0e-15
WP_003442629.1|2860283_2861588_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.4e-140
WP_003442632.1|2861607_2862192_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.2	4.8e-53
WP_003442635.1|2862315_2863611_-	trigger factor	NA	NA	NA	NA	NA
WP_003442639.1|2863834_2864617_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003442642.1|2864640_2865432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442644.1|2865834_2869023_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_003442647.1|2869132_2870218_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.0	1.5e-55
WP_003442650.1|2870563_2872081_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_003442654.1|2872292_2872874_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	31.0	6.3e-05
WP_003442657.1|2873019_2873919_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003442660.1|2873911_2874652_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_003442668.1|2874836_2875700_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003442670.1|2875711_2876899_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003442673.1|2877114_2877537_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_003442675.1|2877537_2878461_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.7	1.7e-52
WP_003442677.1|2878933_2879539_+	DedA family protein	NA	NA	NA	NA	NA
WP_003442679.1|2879716_2880289_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003442680.1|2880331_2882071_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.1	3.4e-62
WP_003442685.1|2882342_2882546_+	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_003442692.1|2884576_2885860_-	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	23.2	1.9e-09
WP_003442695.1|2885988_2886906_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_003442699.1|2887585_2887798_-	DUF3006 domain-containing protein	NA	NA	NA	NA	NA
WP_003442702.1|2887822_2888581_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003442705.1|2888748_2889756_-	3-dehydro-L-gulonate 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003442708.1|2889927_2890398_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_003442710.1|2890552_2891887_-	MFS transporter	NA	NA	NA	NA	NA
WP_003442711.1|2892222_2893080_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003442722.1|2893168_2894215_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_003442724.1|2894265_2895279_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003442725.1|2895300_2896305_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003442726.1|2896319_2896790_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_003442727.1|2897320_2898310_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003442728.1|2898306_2898606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442729.1|2899098_2901357_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	39.8	3.4e-155
WP_003442730.1|2901359_2901659_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.1	9.4e-13
>prophage 7
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	3682763	3785093	4351893	protease,head,capsid,tRNA,transposase,portal,tail,integrase,terminase	Clostridium_phage(47.37%)	102	3731582:3731641	3768246:3768321
WP_003444845.1|3682763_3683990_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_051035266.1|3684108_3684876_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	37.1	3.2e-20
WP_003446396.1|3685021_3686092_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_003446394.1|3686286_3686979_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_003446392.1|3686980_3687952_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_003446391.1|3687955_3688537_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	44.0	7.1e-49
WP_003446387.1|3688717_3691387_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	28.2	1.6e-82
WP_003446386.1|3691699_3694084_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	39.0	1.1e-143
WP_003446383.1|3694373_3694595_-	NifU family protein	NA	NA	NA	NA	NA
WP_003446380.1|3694780_3695197_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446377.1|3695474_3696110_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_003446375.1|3696354_3696696_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003446373.1|3696836_3697004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003446371.1|3697167_3698676_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_003446369.1|3698700_3699549_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003446368.1|3699551_3700493_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003446367.1|3700728_3702045_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003446366.1|3702159_3703137_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003446365.1|3703435_3704407_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003446364.1|3704510_3705365_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446363.1|3705798_3706626_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_003446362.1|3706722_3706917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003446005.1|3712785_3713262_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_003446003.1|3713387_3714143_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003446001.1|3714139_3714886_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003446000.1|3714912_3715434_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_087946548.1|3715436_3717314_-	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_162838520.1|3717369_3719226_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003445997.1|3719588_3720221_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003445996.1|3720589_3720763_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003445995.1|3721098_3721875_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003445993.1|3722639_3722930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445991.1|3723275_3723707_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003445989.1|3723713_3724112_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003445982.1|3724108_3724522_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003445981.1|3725914_3726460_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_034829853.1|3726978_3727335_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_003445979.1|3728070_3729102_-	Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase	NA	NA	NA	NA	NA
WP_003445978.1|3729257_3730742_-	Lsa family ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	26.6	1.1e-24
3731582:3731641	attL	TTTTGGCAGGGGCAGTAGGATTTGAACCCACAACCAATGGTTTTGGAGACCACTACTCTA	NA	NA	NA	NA
WP_003445977.1|3732283_3732493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838519.1|3732508_3732655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081387060.1|3732666_3733086_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_003445973.1|3733503_3733728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076719123.1|3733750_3735625_-|tail	phage tail protein	tail	H7BV46	unidentified_phage	28.3	3.0e-24
WP_003445971.1|3735807_3736185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445969.1|3736163_3736580_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_003445967.1|3736912_3737209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445965.1|3737226_3739068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445964.1|3739126_3739837_-|tail	phage tail family protein	tail	A0A286QN36	Streptococcus_phage	29.1	1.9e-19
WP_003445963.1|3739837_3742402_-|tail	phage tail tape measure protein	tail	A0A1L2BYA6	Clostridium_phage	45.4	3.8e-70
WP_034830073.1|3742623_3742923_-	hypothetical protein	NA	A0A1L2BYA4	Clostridium_phage	40.2	4.7e-12
WP_003445960.1|3742976_3743552_-|tail	phi13 family phage major tail protein	tail	A0A1L2BYA0	Clostridium_phage	58.9	2.2e-58
WP_003445958.1|3743572_3743905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445955.1|3743907_3744291_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	38.8	1.1e-16
WP_003445954.1|3744290_3744650_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_003445953.1|3744650_3744941_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003445952.1|3744987_3746082_-|capsid	phage major capsid protein	capsid	I2E8V4	Clostridium_phage	53.6	2.3e-96
WP_003445951.1|3746140_3746740_-|head,protease	HK97 family phage prohead protease	head,protease	D7PQ42	Enterococcus_phage	40.9	4.9e-29
WP_003445950.1|3746744_3747962_-|portal	phage portal protein	portal	I2E8V3	Clostridium_phage	41.5	9.6e-80
WP_003445949.1|3747962_3748166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445948.1|3748182_3749868_-|terminase	terminase large subunit	terminase	A0A0A7RUM0	Clostridium_phage	52.0	8.4e-167
WP_003445945.1|3749867_3750326_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7RUQ4	Clostridium_phage	62.7	4.3e-41
WP_003445944.1|3750515_3750950_-	hypothetical protein	NA	Q0SPJ9	Clostridium_phage	36.6	4.7e-13
WP_155760388.1|3750952_3751117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445943.1|3751222_3751492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034830069.1|3751503_3751842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445941.1|3752119_3752341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445940.1|3752420_3752735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034830067.1|3752736_3753189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445937.1|3753188_3753449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445933.1|3753583_3754096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445931.1|3754189_3754939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445929.1|3755464_3757624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760390.1|3757649_3757817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445927.1|3757903_3761191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445925.1|3761696_3761897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445923.1|3761916_3762639_-	hypothetical protein	NA	A0A0K2FM38	Brevibacillus_phage	28.0	1.6e-10
WP_003445921.1|3762712_3763054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445919.1|3763204_3763432_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003445915.1|3763505_3764381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445914.1|3764384_3765518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445912.1|3765611_3765848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445910.1|3766490_3766742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445908.1|3766757_3767072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445907.1|3767074_3768088_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.0	8.1e-32
WP_003445904.1|3768563_3768986_-	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
3768246:3768321	attR	TTTTGGCAGGGGCAGTAGGATTTGAACCCACAACCAATGGTTTTGGAGACCACTACTCTACCGTTGAGCCATACCC	NA	NA	NA	NA
WP_003445901.1|3769057_3769882_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445899.1|3770127_3770511_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003445897.1|3770524_3771427_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003445895.1|3771616_3772879_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003445893.1|3773099_3773558_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003445892.1|3773554_3774268_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003445890.1|3774260_3774710_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003445888.1|3774803_3775427_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003445886.1|3775723_3777880_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_003445883.1|3778153_3778480_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003445881.1|3778644_3779199_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_143756631.1|3779227_3780175_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_003445878.1|3780229_3781537_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003445876.1|3781560_3783048_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003445875.1|3783049_3783952_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003445871.1|3784016_3785093_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	4024460	4081750	4351893	coat,transposase,tRNA,holin	Streptococcus_phage(18.75%)	56	NA	NA
WP_158380946.1|4024460_4024607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_034830606.1|4024717_4026271_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_003447816.1|4026354_4026543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034830604.1|4026628_4027399_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.1	4.9e-37
WP_003447612.1|4029014_4029692_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_003447614.1|4029723_4030101_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003447615.1|4030130_4031318_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003447617.1|4031314_4032001_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	2.0e-34
WP_003447619.1|4031978_4033031_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155760402.1|4033155_4033320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447621.1|4033309_4033984_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.4	1.9e-13
WP_003447623.1|4034000_4034501_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003447630.1|4036412_4036733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447632.1|4037349_4038702_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003447635.1|4038895_4039417_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003447637.1|4039473_4040127_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003447638.1|4040319_4040760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003447640.1|4040806_4042363_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	7.8e-50
WP_003447643.1|4042483_4043194_-	2-phosphosulfolactate phosphatase family protein	NA	NA	NA	NA	NA
WP_003447646.1|4043318_4044269_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003447648.1|4044280_4045390_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	31.8	1.4e-21
WP_143756599.1|4045484_4046414_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	43.9	1.7e-31
WP_003447653.1|4046510_4047668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447655.1|4047924_4048971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003447656.1|4049056_4049956_+	radical SAM protein	NA	NA	NA	NA	NA
WP_003447659.1|4050097_4051897_-	heme NO-binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	1.0e-05
WP_003447661.1|4051916_4052591_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003447663.1|4052596_4052983_-	DUF3783 domain-containing protein	NA	NA	NA	NA	NA
WP_003447665.1|4053038_4053554_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	43.9	3.5e-23
WP_003447666.1|4053706_4054486_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003447667.1|4054909_4056997_+	glutamine synthetase III	NA	NA	NA	NA	NA
WP_003447668.1|4057090_4057897_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.6	1.0e-37
WP_003447669.1|4058067_4058868_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	47.8	4.2e-60
WP_003447670.1|4058896_4060153_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.3	5.0e-108
WP_034830663.1|4060229_4060484_+	DUF4491 family protein	NA	NA	NA	NA	NA
WP_003447672.1|4060569_4061961_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.0	1.3e-83
WP_003447673.1|4062338_4064180_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	25.5	2.9e-27
WP_003447684.1|4064232_4064397_-	rubredoxin	NA	NA	NA	NA	NA
WP_003447686.1|4064609_4065146_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003447688.1|4065200_4065428_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003447690.1|4065429_4066356_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	40.7	2.6e-61
WP_003447691.1|4066708_4067005_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_003447692.1|4067025_4067298_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_003447694.1|4067328_4067901_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_003447696.1|4068104_4068644_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_143756635.1|4068648_4069215_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_158380947.1|4069325_4069487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760404.1|4069644_4069809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447703.1|4069958_4071347_-	Fe-only nitrogenase subunit beta	NA	NA	NA	NA	NA
WP_003447705.1|4071362_4071713_-	Fe-only nitrogenase subunit delta	NA	NA	NA	NA	NA
WP_003447707.1|4071728_4073306_-	nitrogenase iron-iron protein, alpha chain	NA	NA	NA	NA	NA
WP_003440352.1|4073714_4075010_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003447709.1|4075195_4076023_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_003447711.1|4077112_4078870_-	ATP-dependent RNA helicase	NA	A0A248SJQ0	Salicola_phage	31.7	2.5e-60
WP_003447713.1|4079045_4080620_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_143756600.1|4080619_4081750_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	44.2	2.6e-18
>prophage 9
NZ_CP009267	Clostridium pasteurianum DSM 525 = ATCC 6013 chromosome, complete genome	4351893	4268613	4324958	4351893	protease,holin,transposase,terminase,integrase	Clostridium_phage(81.08%)	59	4287841:4287858	4334273:4334290
WP_051035257.1|4268613_4269069_+|integrase	site-specific integrase	integrase	A0A0A8WF01	Clostridium_phage	32.0	1.5e-09
WP_158380949.1|4269125_4269287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003445019.1|4269606_4270923_-	High affinity gluconate/L-idonate permease	NA	NA	NA	NA	NA
WP_003445018.1|4271333_4273052_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003445017.1|4273314_4274631_-	High affinity gluconate/L-idonate permease	NA	NA	NA	NA	NA
WP_003445015.1|4275050_4275728_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445014.1|4275753_4276773_-	sugar kinase	NA	NA	NA	NA	NA
WP_003445013.1|4276791_4277436_-	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003445012.1|4277678_4278443_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445011.1|4278820_4279261_+	Hsp20/alpha crystallin family protein	NA	A0A218MMV3	uncultured_virus	31.1	1.6e-05
WP_003445010.1|4279893_4280391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445009.1|4280445_4281429_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RUJ1	Clostridium_phage	42.2	2.0e-35
WP_003445002.1|4281447_4281837_-|holin	phage holin family protein	holin	A0A0A7S099	Clostridium_phage	56.7	9.6e-34
WP_003445000.1|4281879_4288782_-	carbohydrate binding domain-containing protein	NA	M9Q2I5	Clostridium_phage	39.7	1.2e-62
4287841:4287858	attL	ATAATTAATACTGTTGGA	NA	NA	NA	NA
WP_003444998.1|4288808_4289186_-	hypothetical protein	NA	M9Q2L1	Clostridium_phage	47.2	1.7e-22
WP_034830556.1|4289251_4289521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444994.1|4289700_4290048_-	hypothetical protein	NA	M9Q2F8	Clostridium_phage	58.3	6.8e-31
WP_003444992.1|4290058_4294186_-	transglycosylase SLT domain-containing protein	NA	M9Q251	Clostridium_phage	46.7	7.5e-100
WP_003444989.1|4294226_4294646_-	hypothetical protein	NA	M9Q2L2	Clostridium_phage	60.9	5.9e-21
WP_034830554.1|4294706_4295015_-	bacteriophage Gp15 protein	NA	M9Q2I4	Clostridium_phage	73.3	8.7e-38
WP_003444987.1|4295029_4295359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444986.1|4295380_4295836_-	hypothetical protein	NA	M9Q1I1	Clostridium_phage	59.7	1.1e-47
WP_003444985.1|4295846_4296233_-	hypothetical protein	NA	M9Q2F6	Clostridium_phage	68.0	2.6e-47
WP_003444984.1|4296232_4296616_-	hypothetical protein	NA	M9Q249	Clostridium_phage	64.6	8.3e-38
WP_003444983.1|4296615_4296942_-	hypothetical protein	NA	M9Q2I3	Clostridium_phage	54.3	4.1e-30
WP_003444966.1|4296950_4297310_-	hypothetical protein	NA	M9Q2K9	Clostridium_phage	56.7	3.7e-32
WP_003444957.1|4297312_4297600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444955.1|4297610_4298576_-	hypothetical protein	NA	A0A1J0MCK3	Streptomyces_phage	55.2	4.4e-88
WP_003444953.1|4298591_4299191_-	phage scaffolding protein	NA	S5MUG0	Brevibacillus_phage	42.6	2.9e-29
WP_003444951.1|4299329_4299494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143756604.1|4299476_4299677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444947.1|4299687_4299930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444945.1|4299997_4300321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444943.1|4301956_4303462_-	hypothetical protein	NA	M9Q246	Clostridium_phage	63.0	1.3e-182
WP_034830630.1|4303464_4304856_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	72.9	2.0e-198
WP_034830628.1|4304848_4305370_-|transposase	transposase	transposase	A0A0A7RTH0	Clostridium_phage	73.3	2.0e-58
WP_003444940.1|4305586_4306135_-	hypothetical protein	NA	I2E8Y5	Clostridium_phage	30.2	8.6e-12
WP_003444939.1|4306147_4307512_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	62.1	1.7e-162
WP_003444938.1|4307508_4307787_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	52.2	3.1e-18
WP_003444935.1|4308058_4310485_-	putative virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	79.2	0.0e+00
WP_155760405.1|4310519_4310666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444933.1|4310945_4311971_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	33.1	2.1e-43
WP_003444932.1|4311985_4313944_-	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	78.2	0.0e+00
WP_003444931.1|4313948_4314509_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	84.9	4.4e-88
WP_003444930.1|4314630_4315794_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	66.8	6.2e-145
WP_003444929.1|4315795_4316245_-	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	32.3	1.6e-08
WP_003444928.1|4316280_4316541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444927.1|4316554_4317016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444925.1|4317336_4317948_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003444924.1|4317934_4318201_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	49.3	8.4e-13
WP_003444922.1|4318331_4318574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444920.1|4318607_4318748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444918.1|4318913_4319081_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	64.2	8.9e-13
WP_003444916.1|4319097_4319346_-	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	59.7	4.4e-16
WP_003444915.1|4319532_4319973_+	helix-turn-helix transcriptional regulator	NA	Q8SBN0	Clostridium_phage	57.8	7.3e-22
WP_003444914.1|4320006_4320468_+	hypothetical protein	NA	A0A0A7RVV2	Clostridium_phage	57.9	2.6e-46
WP_003444913.1|4320559_4321609_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	63.8	1.1e-127
WP_003444912.1|4321680_4323012_-	replicative DNA helicase	NA	O80281	Escherichia_phage	47.7	4.2e-105
WP_174548956.1|4323035_4324958_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	23.2	1.0e-22
4334273:4334290	attR	TCCAACAGTATTAATTAT	NA	NA	NA	NA
