The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	215654	279929	5488700	transposase,tRNA,plate	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_000176537.1|215654_216950_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217002_217263_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217249_217450_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217615_218161_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218157_218568_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218581_219292_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219491_220316_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220368_222087_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222197_222905_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222901_223306_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223423_224239_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224278_224932_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224924_225956_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226143_226719_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232477_233281_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233277_234192_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234432_235233_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235310_236081_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236128_237487_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237558_238314_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238347_239070_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239066_239534_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239598_240330_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|240867_241668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|242145_242595_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|242597_243194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001452678.1|243303_243495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243515_243995_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243960_245370_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|245380_248815_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248951_250364_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250368_251112_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614374.1|251108_253880_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343292.1|253888_254650_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|254654_255986_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|255988_256513_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256509_257790_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257814_258897_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258860_260711_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260714_261128_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261218_262610_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262660_262885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262919_263420_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264116_264635_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|264844_266986_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509129.1|267061_271294_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|271433_272150_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001356573.1|273908_274466_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|275211_276348_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|278312_278576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|278490_278676_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|278756_279929_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	298715	315751	5488700	tail,transposase,integrase	Enterobacteria_phage(33.33%)	19	305323:305336	321113:321126
WP_000749881.1|298715_299771_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|300058_301162_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|301173_302427_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|303496_303742_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|304068_305282_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000708831.1|305307_305691_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
305323:305336	attL	TCCGGGGCGGTTCA	NA	NA	NA	NA
WP_001274756.1|305818_306532_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|306632_306833_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|306951_307245_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|307277_308177_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788819.1|308173_308485_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|308484_309279_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|309278_309872_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_021498324.1|309843_310287_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.4e-81
WP_001115553.1|310307_310718_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|310747_311302_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|311359_312133_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|312956_313700_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_039102349.1|314662_315751_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.6	1.8e-125
321113:321126	attR	TGAACCGCCCCGGA	NA	NA	NA	NA
>prophage 3
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	894442	932541	5488700	protease,lysis,integrase,terminase,tail,holin,portal	Enterobacteria_phage(47.62%)	49	883884:883898	916177:916191
883884:883898	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|894442_895513_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|895490_895709_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|895748_895916_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|896158_896761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|896971_897193_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188870.1|897291_897507_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548536.1|897583_897775_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|897747_897930_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|897926_898607_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|899304_899487_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|899483_899654_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108059.1|899646_900267_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_001028854.1|900263_900929_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|901140_902100_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|902437_902560_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|902574_903264_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|903447_904191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|904276_904435_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|904515_904914_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_001303850.1|905056_905272_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000075107.1|905271_905769_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|905765_906233_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|906220_906373_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|907046_907538_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|907537_909640_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|909636_909849_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|909776_910901_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|911022_911358_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|911302_913330_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|913416_913740_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|913732_914008_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|914019_914598_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|914594_914996_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|915006_915750_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|915810_916197_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
916177:916191	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|916205_916535_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|916506_919572_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|919571_919901_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|919910_920609_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|920614_921358_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|921294_921903_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001233141.1|925446_926046_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|926105_927422_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001024022.1|927423_927693_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|927869_928850_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|928883_929903_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|930399_930561_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|930730_931612_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|931842_932541_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	1149252	1219084	5488700	protease,capsid,head,integrase,tail,holin,transposase,portal	Escherichia_phage(23.81%)	75	1157739:1157754	1179093:1179108
WP_000156526.1|1149252_1151013_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1151198_1151651_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1151725_1152766_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1153122_1153632_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1153850_1154480_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1154442_1156605_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1156614_1157061_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1157183_1159238_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1157739:1157754	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1159269_1159728_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1159823_1160486_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1160658_1161072_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1161116_1161434_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1161491_1162682_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1162776_1163055_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1163051_1163381_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1163471_1164131_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_077766378.1|1164538_1165546_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.1	7.7e-83
WP_000273151.1|1165523_1165766_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1165833_1168305_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1168398_1168590_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1168586_1168775_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1169348_1169534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1169720_1170110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1170251_1170407_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1170684_1170972_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1170971_1171163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1171190_1171592_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1171700_1171973_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1171956_1172382_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1172588_1173044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1173122_1174214_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788745.1|1174220_1174967_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|1174988_1175759_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1175774_1176188_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1176539_1177313_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_179226815.1|1177917_1178073_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_001341388.1|1178240_1178519_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1178520_1179570_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1179093:1179108	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1179582_1179954_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1179943_1180315_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1180466_1181285_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1181905_1182619_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038430876.1|1183386_1185237_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_162829202.1|1185412_1186625_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1186830_1187145_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1187672_1187858_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1188079_1188193_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1188413_1188947_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1189106_1189379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1189634_1189841_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1190591_1190867_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1190942_1191323_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1191319_1191667_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|1191716_1193255_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000259002.1|1195431_1195638_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1195634_1197227_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1197216_1198722_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1198758_1199106_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1199163_1199430_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000479117.1|1200164_1200596_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1200622_1201036_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082463.1|1201016_1203596_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847274.1|1203592_1203922_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1203921_1204620_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1204630_1205374_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_050546863.1|1205319_1205952_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1206142_1206670_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_039102381.1|1206803_1210277_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.4	0.0e+00
WP_001230444.1|1210344_1210944_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|1211007_1212321_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|1212322_1212592_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1214865_1215984_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1215980_1217774_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1217792_1218500_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1218496_1219084_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	1481218	1600253	5488700	protease,lysis,capsid,head,integrase,terminase,tail,holin,transposase,tRNA,portal	Enterobacteria_phage(35.64%)	146	1533021:1533035	1559273:1559287
WP_000952736.1|1481218_1482040_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1482195_1483242_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1483238_1484033_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1484199_1485318_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1485286_1485556_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1485617_1486007_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1486139_1486655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1486769_1486922_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1487237_1487714_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1487838_1488162_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|1488145_1488571_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1488639_1489677_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1489588_1490131_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1490164_1490881_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1490913_1491195_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1491191_1491494_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1491483_1491801_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1491754_1492072_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1492058_1492496_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1492497_1492689_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_032167855.1|1492691_1493279_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	46.3	2.8e-37
WP_001278450.1|1493394_1493499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1493687_1493900_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1494067_1494346_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|1494347_1495397_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001213059.1|1497087_1497270_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1497307_1497577_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1497652_1497868_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1497872_1498217_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1498267_1498801_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1499071_1499641_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1499640_1499787_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1500014_1500221_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1500285_1500510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1500866_1501007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|1501136_1501322_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|1501363_1501729_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|1502018_1502582_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301438.1|1502578_1504240_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1504303_1506241_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301962.1|1506453_1508955_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.8	0.0e+00
WP_000126019.1|1509034_1509361_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1509370_1509721_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1509717_1510164_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1510160_1510505_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1510570_1511287_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1511301_1511676_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|1511771_1511981_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|1512032_1515275_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807950.1|1515267_1515609_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001152182.1|1515608_1516307_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1516323_1516578_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1516687_1516798_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1517100_1517979_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1518032_1518770_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1518715_1518952_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1518964_1519054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1519073_1521422_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1522012_1525414_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1527722_1527998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1528058_1529420_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1529783_1530647_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1530630_1531767_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1532016_1533243_+	peptidase T	NA	NA	NA	NA	NA
1533021:1533035	attL	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_001301987.1|1533291_1534413_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|1534661_1535891_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|1536255_1536444_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1537248_1537446_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1537438_1537651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1537640_1538105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1538097_1538331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1538336_1538636_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833628.1|1538632_1540033_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
WP_000192401.1|1540233_1540485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1540481_1540892_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1540902_1541175_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1541301_1541526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1541777_1541984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1541983_1543039_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1543051_1543387_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224603.1|1543399_1543813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1544018_1544561_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1544816_1545098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1545698_1547159_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1547158_1547830_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1547998_1549369_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1549372_1550014_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1550049_1551156_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1551209_1551671_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1551680_1552334_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1552505_1553756_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1553869_1555012_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|1555001_1555238_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1556162_1556864_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1556860_1557163_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1557230_1557563_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1557627_1557750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053040.1|1559831_1560287_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
1559273:1559287	attR	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_000224907.1|1560286_1560457_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1560449_1560740_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1560736_1561099_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1561095_1561236_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1561232_1561922_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1562243_1562549_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1562535_1563012_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1563228_1563411_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1563501_1563795_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1564086_1564497_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1564782_1564989_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1565153_1565348_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1565736_1566282_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1566256_1568182_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1568178_1568385_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_039102446.1|1568381_1569983_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	6.7e-307
WP_000123254.1|1569963_1571283_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1571292_1571625_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1571680_1572706_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1572747_1573146_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1573157_1573511_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1573522_1574101_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1574097_1574493_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1574500_1575241_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1575256_1575679_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1575660_1576095_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1576087_1578637_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1578633_1578963_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1578962_1579661_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1579666_1580410_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1580346_1580979_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1581039_1584438_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1584504_1585104_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1585168_1588084_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1588083_1588665_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1588784_1589675_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1589693_1590200_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1590236_1590737_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1590815_1590998_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1591495_1592164_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1592220_1592469_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171540.1|1592544_1592925_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1592921_1593269_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|1593318_1594857_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|1595159_1596644_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1596830_1597784_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|1598282_1598867_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|1599040_1600253_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 6
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	1678025	1759268	5488700	protease,lysis,capsid,head,integrase,terminase,tail,holin,portal	Enterobacteria_phage(38.1%)	89	1677862:1677889	1743740:1743767
1677862:1677889	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|1678025_1679156_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1679133_1679382_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|1679446_1681918_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1682010_1682202_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1682198_1682387_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1682945_1683179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1683156_1683564_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171924.1|1683586_1683805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|1683876_1684176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1684439_1684847_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1684923_1685151_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1685134_1685686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1685657_1686698_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1686609_1687152_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1687338_1687920_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1687916_1688081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1688779_1689538_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1689816_1690029_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1690249_1690507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1690576_1690855_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1690856_1691903_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1691915_1692275_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1692283_1692814_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1693055_1693253_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1693403_1694462_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_001415558.1|1695201_1695360_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
WP_000284517.1|1696226_1696442_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1696446_1696791_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_001056806.1|1697644_1698214_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1698213_1698360_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|1698367_1698835_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|1699298_1699613_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|1699694_1699919_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|1700305_1700851_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027185.1|1700825_1702751_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000198153.1|1702747_1702954_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1702950_1704552_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1704532_1705852_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1705861_1706194_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|1706249_1707275_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|1707316_1707715_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|1707726_1708080_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|1708094_1708628_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|1708624_1709020_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|1709027_1709780_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1709793_1710216_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1710242_1710551_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918257.1|1710594_1713240_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.6	0.0e+00
WP_000847298.1|1713236_1713566_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1713565_1714264_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_122989782.1|1714963_1715593_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_000514948.1|1715833_1718689_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_001228334.1|1718756_1719356_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_039102459.1|1719507_1720812_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.7	1.3e-79
WP_001023474.1|1720813_1721083_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1722109_1723435_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000950979.1|1725260_1726172_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|1726237_1726807_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000682716.1|1728153_1728552_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1728559_1729312_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_039102461.1|1729325_1729748_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	99.3	1.1e-72
WP_000438877.1|1729774_1730083_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_039102462.1|1730126_1732772_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.1	0.0e+00
WP_000847298.1|1732768_1733098_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_039102464.1|1733097_1733796_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.7	1.4e-131
WP_039102466.1|1733806_1734550_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.2	9.2e-150
WP_137531697.1|1734495_1735125_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.6	1.2e-102
WP_039102469.1|1735364_1738841_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_039102470.1|1738908_1739508_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	7.5e-110
WP_039102471.1|1739572_1740886_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023420.1|1740887_1741157_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000692020.1|1742289_1742880_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|1743257_1743428_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079499.1|1743917_1744424_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1743740:1743767	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1744469_1744970_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1745055_1745235_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|1745615_1746422_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|1746421_1747615_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|1747626_1748988_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|1748988_1750584_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|1750583_1752146_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1752237_1752282_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|1752419_1753301_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1753297_1753918_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|1753945_1755529_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|1755741_1756614_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|1756653_1757244_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|1757240_1757999_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|1758218_1759268_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	2030847	2114547	5488700	capsid,head,terminase,tail,holin,transposase,portal	Stx2-converting_phage(42.7%)	96	NA	NA
WP_000214712.1|2030847_2031051_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2031086_2032547_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_001120551.1|2034050_2034293_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2034454_2035096_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001303500.1|2035177_2035807_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2035879_2036455_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2036569_2036839_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_039102510.1|2036840_2038154_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	8.8e-79
WP_001230508.1|2038218_2038818_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_050439450.1|2043305_2043938_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2043883_2044627_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179510.1|2044637_2045336_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000807954.1|2045335_2045677_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_039102512.1|2045669_2048912_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	96.7	0.0e+00
WP_001453698.1|2048963_2049173_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2049268_2049643_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2049648_2050365_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2050423_2050768_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2050764_2051211_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2051207_2051558_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126026.1|2051567_2051894_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
WP_032257997.1|2053933_2054155_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	1.7e-35
WP_000731239.1|2054698_2055106_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
WP_024180155.1|2055110_2055326_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2055764_2057615_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001477269.1|2058092_2058524_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	95.8	6.2e-66
WP_000301797.1|2058974_2059688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2059823_2060021_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2060245_2060800_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2060862_2061168_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2061180_2062230_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2062231_2062504_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2062625_2062970_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2063089_2063302_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2063535_2064093_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2064094_2064313_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2064440_2064752_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2064744_2064972_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2064968_2065250_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2065282_2065999_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2066032_2066494_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2066486_2067530_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2067598_2068024_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2068007_2068250_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2068641_2068980_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2069272_2069425_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2069436_2070075_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2070075_2070285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2070849_2071038_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2071034_2071223_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2071315_2072560_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2073270_2073513_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171540.1|2074475_2074856_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2074852_2075200_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2075249_2076788_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2077370_2078021_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2078731_2079307_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2079420_2079690_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_039102524.1|2079691_2080915_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	92.4	2.5e-80
WP_001230508.1|2080979_2081579_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001179509.1|2085312_2085750_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|2085749_2086091_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_039102527.1|2086083_2089326_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.5	0.0e+00
WP_001453746.1|2089373_2089583_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2089678_2090053_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2090067_2090784_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2090849_2091194_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2091190_2091637_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2091633_2091984_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2091993_2092320_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|2092322_2094902_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|2094847_2095069_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2095113_2097051_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_000958416.1|2098771_2099335_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2099626_2099992_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2100033_2100261_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2100685_2100871_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2101098_2101245_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2101244_2101814_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2102084_2102618_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2102668_2103013_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2103017_2103233_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_039102530.1|2103672_2105523_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2106001_2106430_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2107067_2107757_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2107753_2108113_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2108125_2109175_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_077787473.1|2109176_2109455_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2109622_2109835_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2110023_2110128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2110243_2110828_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2110884_2111280_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2112090_2112831_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2112837_2113800_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2113822_2114248_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2114244_2114547_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 8
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	2429427	2481650	5488700	tail,transposase,tRNA,integrase	Enterobacteria_phage(60.0%)	59	2422651:2422666	2481940:2481955
2422651:2422666	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2429427_2431161_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2431337_2431826_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2431945_2432338_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2432337_2434416_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2434408_2435557_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2435758_2436403_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2436413_2436803_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2436817_2437867_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2437869_2438730_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2438748_2440350_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2440395_2442057_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2442199_2442703_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2442723_2444688_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2444692_2445619_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2445615_2446503_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2446629_2447208_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2447210_2447561_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2448340_2448769_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|2448775_2450200_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2450174_2450975_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2451141_2452128_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2452142_2453657_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2453726_2454716_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179461.1|2455512_2456016_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2456095_2456347_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2456461_2456548_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2456809_2457133_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2457303_2457801_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2457837_2458077_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2458268_2459480_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2459541_2460207_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|2460563_2461565_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|2461570_2461918_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2461947_2462598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2462613_2463018_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2463107_2463245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2463316_2463520_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2463541_2463892_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_039102574.1|2463902_2464181_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514287.1|2464192_2464435_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2464431_2464545_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2464637_2465054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2465077_2465281_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2465277_2465544_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_039102575.1|2465540_2465840_+	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.9	7.4e-42
WP_001310314.1|2465851_2466469_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2466465_2466831_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_039102576.1|2466837_2469660_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.4	0.0e+00
WP_039102577.1|2469736_2470696_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	2.3e-177
WP_000211280.1|2470700_2471015_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2472105_2472636_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2472679_2473252_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_039102578.1|2473408_2473897_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	1.5e-84
WP_000333495.1|2476699_2476855_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_039102579.1|2476863_2477229_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	4.9e-56
WP_039102580.1|2477283_2477796_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	1.0e-91
WP_039102581.1|2477795_2478980_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.2	2.1e-220
WP_000132765.1|2479137_2479461_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_162829241.1|2480437_2481650_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
2481940:2481955	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 9
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	2539438	2580788	5488700	capsid,head,integrase,terminase,tail,holin,transposase,portal	Escherichia_phage(37.21%)	53	2574160:2574174	2586443:2586457
WP_001023407.1|2539438_2539708_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268981.1|2539709_2541023_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001230514.1|2541087_2541687_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000514965.1|2541754_2545234_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_097454001.1|2545474_2546104_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_000194801.1|2546049_2546793_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2546803_2547502_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847274.1|2547501_2547831_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000082463.1|2547827_2550407_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|2550387_2550801_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2550827_2551259_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2551272_2552013_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2551994_2552261_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2552318_2552666_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2552702_2554208_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2554197_2555790_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2555786_2555993_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001450892.1|2555976_2557824_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.1	1.8e-255
WP_000235436.1|2557875_2558385_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2558779_2559004_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2559085_2559400_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2559926_2560112_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2560339_2560471_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2560483_2560666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2560821_2561355_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2561405_2561750_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2561754_2561970_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|2562279_2563492_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_039102593.1|2563574_2565425_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_001303558.1|2565902_2566331_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|2566964_2567654_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2567650_2568010_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2568022_2569072_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2569073_2569352_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2569519_2569732_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2569918_2570023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2570132_2570696_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2570822_2571134_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2571130_2571283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2571315_2571672_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2571668_2571893_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2571914_2572613_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2572647_2573190_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2573101_2574139_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
2574160:2574174	attL	AACTTTACCCTCGAA	NA	NA	NA	NA
WP_000693816.1|2574207_2574633_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2574629_2574857_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2574954_2575599_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2575873_2576026_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2576506_2576695_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2576691_2576880_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2576975_2579447_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2579505_2579709_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533601.1|2579708_2580788_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.2e-99
2586443:2586457	attR	AACTTTACCCTCGAA	NA	NA	NA	NA
>prophage 10
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	2605128	2681053	5488700	protease,lysis,capsid,head,integrase,terminase,tail,holin,transposase,portal	Stx2-converting_phage(47.56%)	96	2636364:2636379	2684116:2684131
WP_000998042.1|2605128_2606667_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_162829202.1|2607484_2608698_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000966626.1|2609427_2611575_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_061069249.1|2611856_2612711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039102600.1|2612707_2613613_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102660.1|2613609_2614680_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|2614815_2615499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|2615514_2615925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|2616145_2616967_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860080.1|2617048_2617528_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	5.2e-13
WP_001186192.1|2617542_2618019_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2618081_2618303_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|2618376_2618745_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2619203_2619398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2619410_2619524_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|2620012_2620195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2620295_2620625_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|2620796_2621855_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|2622053_2622527_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|2622645_2623812_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2625135_2625786_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000458686.1|2626009_2626885_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	3.2e-162
WP_039102605.1|2627025_2627295_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	5.4e-44
WP_039102606.1|2627296_2628610_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	3.2e-81
WP_001230514.1|2628674_2629274_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_039102607.1|2629341_2632821_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_122994717.1|2633059_2633692_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_000967278.1|2633637_2634375_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_001414206.1|2634429_2635353_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_001154345.1|2635423_2635597_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2635704_2636025_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
2636364:2636379	attL	TTTTTTTATTCTTTTT	NA	NA	NA	NA
WP_000807954.1|2636768_2637110_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_039102609.1|2637102_2640345_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|2640396_2640606_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2640701_2641076_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2641081_2641798_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2641856_2642201_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2642197_2642644_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007901.1|2642640_2642991_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2643000_2643327_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001301679.1|2643406_2645908_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.2	0.0e+00
WP_001063099.1|2645853_2646075_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2646119_2648057_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_000958416.1|2649777_2650341_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279796.1|2650631_2650997_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2651038_2651266_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|2651728_2651986_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2651982_2652480_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2652682_2653120_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2653116_2653614_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2653613_2653829_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2653905_2654178_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2654218_2654398_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143110.1|2654534_2656472_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.4	0.0e+00
WP_001303568.1|2656715_2657039_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2657335_2657605_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2657616_2658576_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2659225_2659714_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2659704_2660376_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2660372_2660978_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2660977_2661700_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000849633.1|2661774_2662455_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|2662710_2663469_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|2663743_2663926_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2663922_2664450_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2664446_2664893_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2664849_2665086_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2665096_2665312_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|2665444_2665723_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|2665793_2667170_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|2667166_2667988_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|2667974_2668136_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|2668168_2668465_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2668606_2668822_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2668897_2669593_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2670094_2670616_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2671184_2671367_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2671344_2671617_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|2671675_2671927_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065374.1|2672109_2672478_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|2672550_2672715_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2672683_2672827_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2672901_2673198_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001301718.1|2673203_2673989_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_162829202.1|2674283_2675497_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682306.1|2675975_2676158_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548544.1|2676130_2676322_+	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000188870.1|2676398_2676614_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2676712_2676934_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2676930_2677878_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_001356547.1|2677879_2678056_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2678389_2678746_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610373.1|2678742_2679093_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2679280_2679625_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2679702_2679894_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|2679874_2681053_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
2684116:2684131	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 11
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	2764277	2802344	5488700	lysis,plate,capsid,head,integrase,terminase,tail,holin,tRNA,portal	Escherichia_phage(62.22%)	50	2768577:2768604	2800537:2800564
WP_000675144.1|2764277_2765681_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2765677_2766400_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2766590_2766923_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2767070_2768432_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2768577:2768604	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2768705_2768924_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882933.1|2769005_2770169_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000978913.1|2770168_2770648_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000069957.1|2770662_2773110_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_001496926.1|2773102_2773222_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_001031303.1|2773254_2773530_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2773586_2774105_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286706.1|2774117_2775308_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_000905094.1|2775367_2775961_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_000983068.1|2775988_2776522_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_039102647.1|2776521_2777124_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.5	8.6e-98
WP_001008232.1|2777095_2777539_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	6.3e-82
WP_000217043.1|2777559_2778759_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.5	2.0e-215
WP_001285352.1|2778755_2779367_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121479.1|2779359_2780268_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_000127154.1|2780272_2780620_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001093728.1|2780616_2781252_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_001001810.1|2781318_2781771_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_000917144.1|2781763_2782231_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001300730.1|2782193_2782367_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040644.1|2782338_2782764_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_000736555.1|2782751_2783177_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_001144101.1|2783191_2783689_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2783688_2783970_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846406.1|2783973_2784177_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000988633.1|2784176_2784686_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203418.1|2784785_2785529_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_001248594.1|2785532_2786606_-|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_001085952.1|2786664_2787519_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_000156848.1|2787692_2789465_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|2789464_2790499_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000844437.1|2790816_2792784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|2792783_2793236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063136.1|2793282_2794506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268574.1|2794595_2796878_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000027664.1|2796867_2797143_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113265.1|2797139_2797364_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_001277898.1|2797366_2797666_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557698.1|2797665_2797890_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_000217670.1|2797953_2798454_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|2798450_2798621_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2798631_2798907_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2799028_2799328_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2799443_2800457_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001303579.1|2800721_2801039_-	hypothetical protein	NA	NA	NA	NA	NA
2800537:2800564	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2801444_2802344_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 12
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	2827975	2902911	5488700	protease,terminase,tail,holin,transposase,tRNA,portal	Enterobacteria_phage(55.22%)	80	NA	NA
WP_001301615.1|2827975_2830009_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|2836966_2840596_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|2840657_2840975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|2842215_2843304_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|2843314_2844844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528952.1|2844862_2845594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301655.1|2845586_2846723_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|2846719_2848723_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|2848847_2849309_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2849350_2849821_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2849867_2850587_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|2850583_2852269_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261937.1|2852783_2853032_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|2853399_2853669_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268872.1|2853670_2854984_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	2.2e-77
WP_001228302.1|2855048_2855648_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_039102665.1|2855715_2859189_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_072147834.1|2859429_2860059_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|2860004_2860748_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|2860758_2861457_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|2861456_2861786_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|2861782_2864428_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000438877.1|2864471_2864780_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|2864806_2865229_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2865242_2865995_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2866002_2866401_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2866413_2867037_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2867039_2867321_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2867313_2867640_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2867727_2869752_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2869696_2871199_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2871198_2871411_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_052210425.1|2871407_2872859_-|terminase	phage terminase large subunit family protein	terminase	Q8VNN7	Enterobacteria_phage	99.4	3.6e-283
WP_001281350.1|2873201_2873483_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2873475_2873802_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001015158.1|2875455_2876013_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_000284510.1|2876017_2876233_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2876310_2876556_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2876596_2876776_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001356551.1|2879659_2879812_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|2880063_2880498_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|2880583_2880724_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|2880720_2881083_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|2881079_2881370_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|2881362_2881533_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|2881532_2881988_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|2881984_2882086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|2882202_2883000_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|2883009_2883561_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|2884025_2885552_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|2885609_2885717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|2885808_2886141_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2886208_2886511_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_162829202.1|2886999_2888212_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000147876.1|2888518_2889538_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_001182899.1|2889534_2890074_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|2890143_2890374_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|2890478_2891168_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|2891248_2892310_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|2892287_2892665_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|2893145_2893352_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|2893427_2893724_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2893729_2894515_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2894511_2895189_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2895188_2895371_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2895343_2895535_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|2895611_2895827_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2895925_2896147_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|2896143_2897091_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|2897092_2897269_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|2897602_2897959_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|2897955_2898318_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|2898405_2898648_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|2898651_2898786_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|2898804_2899059_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|2899092_2900379_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|2900399_2901101_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|2901160_2901268_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2901248_2901980_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|2901984_2902911_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	3117897	3216710	5488700	protease,lysis,capsid,integrase,terminase,tail,holin,transposase,tRNA,portal	Escherichia_phage(44.68%)	121	3139477:3139493	3213699:3213715
WP_001283590.1|3117897_3118710_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289184.1|3118709_3119723_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699109.1|3119788_3120925_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	3.1e-24
WP_000615802.1|3121023_3122019_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127753.1|3122015_3123194_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3123468_3124689_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683769.1|3124847_3126854_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3126974_3127253_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089225.1|3127286_3127835_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3127834_3128644_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043834.1|3128643_3129468_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|3129471_3130557_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001302029.1|3130591_3131524_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730817.1|3131689_3132241_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001301548.1|3132411_3133254_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000794741.1|3133255_3133777_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001301662.1|3134009_3134183_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000822672.1|3134179_3134650_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000675435.1|3134646_3135147_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000182852.1|3135157_3135916_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112844.1|3135938_3138578_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000033336.1|3138659_3139223_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
3139477:3139493	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_001195817.1|3139868_3140354_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426146.1|3140556_3142701_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531969.1|3142700_3144011_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|3144190_3144475_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001301981.1|3144846_3146187_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000952959.1|3146551_3147583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|3147977_3148733_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|3149026_3149959_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000012445.1|3158624_3159890_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
WP_000540400.1|3159900_3160194_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_000455652.1|3160203_3160650_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000509483.1|3160652_3161309_-	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
WP_000035557.1|3161403_3161805_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000078907.1|3161861_3162002_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|3162232_3162967_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_001301884.1|3163057_3163675_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455635.1|3163680_3163959_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|3163973_3165242_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146323.1|3165238_3166864_-	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
WP_001303606.1|3167158_3167347_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3167485_3167755_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001301432.1|3167756_3169694_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
WP_000207923.1|3169690_3170341_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|3170340_3170904_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3170887_3171349_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3171398_3171788_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3171843_3173058_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000994870.1|3173081_3173498_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
WP_162829202.1|3173628_3174841_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000787025.1|3175559_3177704_-|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
WP_000143988.1|3177703_3179410_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3179390_3180197_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3180252_3180456_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3180605_3180899_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|3180930_3181395_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|3181402_3181552_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|3181551_3182121_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|3182394_3182928_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|3182932_3183148_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3183224_3183497_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_039102695.1|3183537_3183717_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	8.3e-25
WP_039102697.1|3183851_3185789_-	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.8	0.0e+00
WP_000738068.1|3186275_3186545_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3186556_3187516_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3188297_3188732_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3188724_3188919_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|3188915_3189521_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001292288.1|3189520_3190243_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
WP_001563210.1|3190235_3190445_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924600.1|3190404_3190806_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_000201603.1|3190880_3191555_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_001254258.1|3191811_3192006_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153301.1|3192002_3192530_-	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
WP_000573864.1|3192526_3193129_-	HNH endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|3193121_3193538_-	recombination protein NinB	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|3193711_3193927_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001000130.1|3194059_3194338_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|3194408_3194699_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788871.1|3194695_3195397_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000185456.1|3195393_3196332_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438489.1|3196364_3196661_-	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_001180318.1|3196799_3197027_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3197105_3197813_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885202.1|3197873_3198215_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221210.1|3198282_3198744_+	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
WP_000957426.1|3198737_3199784_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745484.1|3199786_3199951_+	hypothetical protein	NA	A0A0P0ZCU5	Stx2-converting_phage	100.0	3.0e-21
WP_000198444.1|3200439_3200823_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3200881_3201352_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_024251244.1|3201502_3201871_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	99.2	1.7e-64
WP_001198861.1|3201943_3202108_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372940.1|3202076_3202241_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
WP_000995464.1|3202295_3202592_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000100845.1|3202597_3203383_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|3203379_3204060_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|3204056_3204239_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|3204211_3204403_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000188870.1|3204479_3204695_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000774248.1|3204793_3205015_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289942.1|3205011_3205959_+	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
WP_001301469.1|3205960_3206467_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|3206426_3206642_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|3206643_3206862_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3206863_3207151_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206751.1|3207154_3207772_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000376712.1|3207771_3208056_+	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
WP_000203836.1|3208411_3209035_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000669287.1|3209077_3209245_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000268107.1|3209244_3209475_+	hypothetical protein	NA	Q08J65	Stx2-converting_phage	100.0	1.9e-37
WP_000163444.1|3209471_3210098_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291844.1|3210057_3210270_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994803.1|3210305_3210683_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_000453637.1|3210761_3210944_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3210927_3212097_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958700.1|3212528_3213686_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3213860_3214997_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3213699:3213715	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3215006_3215687_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3215673_3216141_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3216140_3216710_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 14
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	3494285	3509034	5488700	tail,holin,transposase	Enterobacteria_phage(35.71%)	18	NA	NA
WP_000162574.1|3494285_3494768_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3495613_3495862_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3496363_3496954_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3497136_3497787_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3497865_3498924_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3499053_3499476_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3499636_3499906_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_162829202.1|3500123_3501336_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|3501836_3502184_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3502180_3502561_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000731241.1|3502917_3503262_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3503266_3503482_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_039102742.1|3503630_3505484_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|3505891_3506059_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3506144_3506888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3507140_3507764_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3507760_3508426_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3508422_3509034_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 15
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	5095959	5110624	5488700	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5097240:5097255	5114769:5114784
WP_000956557.1|5095959_5096493_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5096689_5096863_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5096910_5097192_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5097240:5097255	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5097536_5097734_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5098069_5098354_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5098350_5098701_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5098691_5099228_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5100549_5101149_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5101213_5102527_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5102528_5102798_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5102909_5103482_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5103554_5104184_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5104265_5104907_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5105067_5105316_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5105377_5106475_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543818.1|5106563_5107601_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5107734_5107977_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5108142_5109126_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|5109208_5110624_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5114769:5114784	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 16
NZ_CP010304	Escherichia coli O157:H7 str. SS52 chromosome, complete genome	5488700	5247504	5306515	5488700	transposase,protease	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|5247504_5248764_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5248766_5249771_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5249852_5250050_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5250153_5251452_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177633.1|5251656_5252082_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5252120_5254562_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5254742_5255474_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5255600_5256002_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5256020_5256719_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5256769_5257429_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5257446_5257845_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5257854_5258493_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5258495_5259659_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5259742_5261368_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5261484_5261760_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254630.1|5261908_5262238_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5262419_5263169_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5263165_5263921_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|5264028_5265093_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|5265447_5266845_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5266860_5267166_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5267175_5267640_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5267653_5268304_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|5268313_5269168_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5269167_5269854_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5269982_5270258_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5270584_5270980_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5270986_5271301_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5271305_5271533_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5271574_5272024_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5272094_5272889_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5273511_5273943_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5273950_5275159_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5275293_5275932_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5276149_5276770_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5277078_5278491_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5278535_5279198_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5279305_5280271_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5280378_5281239_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|5281327_5281708_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|5281825_5283769_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5283958_5284699_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|5284910_5285849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|5285911_5286466_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5286790_5286997_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_039102977.1|5287075_5288419_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001692298.1|5288741_5289380_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5289585_5291319_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5291315_5295095_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5295097_5295439_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5295650_5295902_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5295895_5296246_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5296325_5296856_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5297165_5298122_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|5299777_5300800_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5300786_5301782_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5301814_5302813_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5302988_5304362_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5304517_5305069_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5305162_5306515_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NZ_CP010305	Escherichia coli O157:H7 str. SS52 plasmid p0157, complete sequence	94730	8416	77880	94730	transposase,protease,integrase	Macacine_betaherpesvirus(26.32%)	60	626:640	23311:23325
626:640	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001066920.1|8416_9157_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|9441_10419_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|10826_11027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|11023_11644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|11640_12324_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|12782_13001_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_162829348.1|13054_14268_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_027868286.1|14321_14621_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|14621_15428_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_187440424.1|16150_17364_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.4e-168
WP_000852148.1|17439_18195_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|18782_19949_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|19948_20920_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|21614_22517_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|22520_22826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|22902_23586_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
23311:23325	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001104869.1|23586_23808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|23701_24256_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001005037.1|24301_25078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010891293.1|25618_25921_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|25967_26390_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|26386_26578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032245379.1|26547_27057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|27573_27804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|27855_29217_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|29263_29827_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001496595.1|29912_30380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|30449_30656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|30681_31134_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|31190_31424_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|31489_33448_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|33502_33937_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|33933_34695_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|34926_35085_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|37307_37739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581721.1|39532_49042_+	toxin B	NA	NA	NA	NA	NA
WP_000205762.1|51300_52047_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|52105_52966_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|53068_53629_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|53761_53974_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233856.1|54218_54680_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	9.4e-20
WP_001302200.1|54725_54935_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|54972_55311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|55550_55805_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|56040_56115_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|56107_56965_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|57877_58162_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|58161_58437_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|58531_58738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|60078_60264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|60440_62651_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|62694_63084_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|64309_68212_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001302199.1|70389_71211_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|71210_72317_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|72406_74128_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|74201_75200_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001171540.1|75567_75948_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|75944_76292_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|76341_77880_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
