The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021080	Streptomyces pluripotens strain MUSC 135 chromosome, complete genome	7346075	739292	879245	7346075	protease,transposase,integrase	Tupanvirus(27.27%)	107	809464:809523	827698:828679
WP_159025268.1|739292_739805_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_043432648.1|740037_741357_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_159025269.1|741487_742318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167747924.1|742915_743152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043435893.1|744552_745881_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_086083043.1|746068_748066_+	N-acetylmuramoyl-L-alanine amidase	NA	B1ABI9	Lactococcus_phage	36.5	2.9e-09
WP_039654137.1|748439_748889_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_043435850.1|748885_749683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039654140.1|750387_750999_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039654141.1|751085_751511_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_043435852.1|751507_752356_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_043435853.1|752343_753546_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_052319113.1|753798_754026_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_159025270.1|754168_754339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043435855.1|754516_754750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043435858.1|755298_756129_-	mycofactocin-coupled SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	3.2e-10
WP_043435860.1|756125_756854_-	thioesterase	NA	NA	NA	NA	NA
WP_043435862.1|756905_758051_-	cytochrome P450	NA	NA	NA	NA	NA
WP_043435864.1|758047_759358_-	MFS transporter	NA	NA	NA	NA	NA
WP_043435866.1|759373_760432_-	asparagine ligase	NA	NA	NA	NA	NA
WP_043435901.1|760458_761751_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	30.0	6.7e-31
WP_159025271.1|761840_769331_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	24.6	1.9e-117
WP_043435869.1|769373_770621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052319115.1|770624_773270_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	28.7	2.0e-45
WP_043435871.1|773266_774286_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_159025272.1|774410_774623_-	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_078859139.1|776107_778063_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	2.2e-57
WP_043435873.1|778218_778821_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_039654145.1|779182_779689_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_039654199.1|779695_780340_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_039654146.1|780492_780963_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_039654147.1|780996_781899_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174673801.1|781973_782936_+	EamA family transporter	NA	NA	NA	NA	NA
WP_071659340.1|782932_784264_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_039654150.1|784329_785025_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_043435876.1|785035_785980_-	EamA family transporter	NA	NA	NA	NA	NA
WP_078859136.1|786170_787163_-	EamA family transporter	NA	NA	NA	NA	NA
WP_167747934.1|787244_787826_-	peptidase	NA	NA	NA	NA	NA
WP_039654154.1|788189_788618_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_078859137.1|788845_789463_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_043435878.1|789831_790266_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_043435881.1|791331_792351_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_039657640.1|792847_794269_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	31.0	4.6e-17
WP_039657631.1|794265_795033_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.4	5.2e-55
WP_039657632.1|795111_795606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043435887.1|797401_798184_-|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_159025273.1|798349_798511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043435917.1|798500_799220_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_078859138.1|799240_801322_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_174673976.1|801387_802383_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_086082975.1|805095_806532_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_043432102.1|806944_807472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086083060.1|807799_809386_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
809464:809523	attL	TCAGAAGCCGTTGTCTTTCCGGATGTGGTCGTGGGGTTTCCGCTGATCAGGCATGGTGTC	NA	NA	NA	NA
WP_078859107.1|809515_810145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039658189.1|810071_810893_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_052270307.1|811293_812631_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_043435442.1|812723_813476_+|transposase	TnsA-like heteromeric transposase endonuclease subunit	transposase	NA	NA	NA	NA
WP_043435445.1|813463_815584_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_078859087.1|815580_816156_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_052319063.1|816234_817437_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_043435455.1|817436_820070_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_043435457.1|820066_820657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043435461.1|820772_821540_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_089516722.1|821958_822855_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_086083062.1|822811_823348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043404360.1|825331_825715_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167747958.1|825723_826740_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_078859107.1|827075_827705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159025274.1|827711_828047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043435625.1|829029_830058_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
827698:828679	attR	GACACCATGCCTGATCAGCGGAAACCCCACGACCACATCCGGAAAGACAACGGCTTCTGAATGCGGCACCCCCATACAACCAGGCCGCCGAAGAATCCGCTGGAACTGCTCGAACGCCTGCGCAGCCCGCGGCCGCCGCCGCAAGAAACAGGCAGCCGACCCACCCACGCCGATCCCGCCCTGATCACCGATCCAACTTCGGTGGCAATCGGCCCAGATGAGACGTCAGTGAGGACAGCGAGCGTGTGAAACAGTTCAGTACGAACGGTGAGGCGATCGCCAAGCTCCCCTTCCAGGTCCGGCCGATCGCTGGTGAAGGCTGCTATCCGTTCATTGCCCGCCTCGCCCATGCCAACTGCCTCCCGCCCACCTACCTGCGGCGTTTCCTCGCGGGACCGCCTGGGTACCGCGGCAGCCCGTCCTGGGAACGGCTCTCGGCCGTCACCGGCCGTGACGTCGGACAGTTGCGAAAGACTCTCGACACCGCGAAGTGCAAGGAGTGCGGCTCGGTATTCCTGCTCGACCGCACGTTCGGTAACCTGCCCCGTTACTGCTCGGCCCGATGCCGAGCCCGCCCATCCCTCAAACGCGAGGTCACAGAGCCCTGCCGAATCTGCCGGCAACCCATGAAGGTCCAGTTCGGCCAACGTTACCGGCTCTGTTCCACCGCCTGCCGCAGAGTGGCCTACATCGAACGCCAACATCGCAACAACGACACCGTCGAGCAGCACGAACCCCGCACATGCACCGCCTGTGAGCACCCCCTGCCACCGGACACCCCGGCCTTCGAGCACACCTGCTCAGAAAAATGCACCCGACAGGTCTCCCGCTGGGACTGGATGATCGAGCAGCACGGACTTCCCCTGCCTTCACGGACATGCGCGTTCTGCGGAACCCCGATAGAGGTCACATTCCCGTCCGATCCCCATCGCCGGTGGTGCAGCCGCCGATGCCGCACACGGGCATCCCGCGGCCATGACCC	NA	NA	NA	NA
WP_043435628.1|830156_830699_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_043435621.1|831142_831958_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_039654157.1|832174_832609_+	VOC family protein	NA	NA	NA	NA	NA
WP_043435618.1|832927_834535_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_043435616.1|834692_835505_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_039654159.1|835563_836364_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_039654160.1|836622_838140_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_039654161.1|838709_839294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039654162.1|839683_839890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039654163.1|840312_840843_+	universal stress protein	NA	NA	NA	NA	NA
WP_039654201.1|841148_841544_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174673977.1|841909_842719_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039654165.1|842715_843576_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_052319086.1|843599_844709_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	9.5e-18
WP_039654166.1|844737_845175_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_043406761.1|845295_848181_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	2.8e-263
WP_039654168.1|848569_848941_+	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_039654169.1|848862_850308_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_078859106.1|850377_851061_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026253112.1|851331_851805_-	bifunctional nuclease family protein	NA	NA	NA	NA	NA
WP_039654171.1|851890_852628_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071659244.1|852671_853610_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_039654203.1|853692_854556_-	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_039654173.1|854707_855040_-	small basic family protein	NA	NA	NA	NA	NA
WP_086083065.1|855036_855963_-	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_039654175.1|856127_858623_-	mannose-1-phosphate guanyltransferase	NA	I7I009	Enterobacteria_phage	29.3	6.9e-16
WP_039654176.1|858737_859346_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_043435251.1|865233_865683_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_043435254.1|865781_867452_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_043404792.1|867556_868450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039656955.1|868842_870810_-	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_174673802.1|871024_873385_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_039656953.1|873425_873962_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_039656952.1|874197_874629_+	benzoylsuccinyl-CoA thiolase	NA	NA	NA	NA	NA
WP_039656950.1|874633_875824_+	lipid-transfer protein	NA	NA	NA	NA	NA
WP_039656949.1|875951_877604_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_039658118.1|878030_879245_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP021080	Streptomyces pluripotens strain MUSC 135 chromosome, complete genome	7346075	2157468	2237611	7346075	protease,tRNA,transposase,integrase,holin	Streptococcus_phage(18.18%)	59	2187574:2187593	2222351:2222370
WP_039654610.1|2157468_2160351_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.0	1.9e-211
WP_174673841.1|2160754_2162095_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_043432586.1|2162091_2163702_+	ferredoxin	NA	NA	NA	NA	NA
WP_039654607.1|2164401_2164635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039654606.1|2165448_2166117_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_039654605.1|2166116_2166560_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_043432589.1|2166661_2168404_-	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_052270083.1|2168420_2169092_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_039654602.1|2169163_2169328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039654601.1|2169532_2169697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039654600.1|2169800_2170901_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_039649511.1|2171160_2172231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043404883.1|2172346_2172952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039649515.1|2173042_2174329_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.9	2.2e-103
WP_043432591.1|2174862_2176935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043432594.1|2176979_2177405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052318854.1|2177564_2178713_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.6	2.2e-54
WP_078858737.1|2179303_2179732_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078886429.1|2179750_2180821_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_039649173.1|2185129_2185600_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_052269734.1|2185602_2186322_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039649377.1|2186595_2186847_+	hypothetical protein	NA	I7A9K0	Streptomyces_phage	49.3	8.4e-07
WP_039649178.1|2186834_2187080_+	hypothetical protein	NA	A0A2P1JTV3	Streptomyces_phage	61.3	2.8e-23
2187574:2187593	attL	CGGCGGTCACCGGCCGCCGG	NA	NA	NA	NA
WP_052269735.1|2187703_2187928_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086083252.1|2187927_2189193_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	35.3	1.6e-40
WP_043432618.1|2190792_2191023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043432616.1|2191019_2191217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043432614.1|2191373_2192096_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043432613.1|2192166_2193042_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043432610.1|2193263_2193599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052318856.1|2193598_2194927_+	hypothetical protein	NA	S5VNE3	Mycobacterium_phage	29.2	3.2e-20
WP_043432608.1|2195065_2196421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043432604.1|2196413_2196599_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043432601.1|2196595_2197864_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.7	4.4e-43
WP_052318855.1|2197970_2198300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043432620.1|2198313_2198580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052318999.1|2205653_2206718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089516724.1|2206781_2207528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043434583.1|2207546_2208992_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_039649526.1|2209124_2209379_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_030653874.1|2209393_2209714_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_043434580.1|2209900_2210962_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_039655443.1|2210949_2211702_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_043433650.1|2211901_2216167_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_039649529.1|2216428_2217199_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_039649530.1|2217748_2218957_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_043404893.1|2219458_2221420_-	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_039649534.1|2221490_2222987_-	CYTH and CHAD domain-containing protein	NA	NA	NA	NA	NA
2222351:2222370	attR	CGGCGGTCACCGGCCGCCGG	NA	NA	NA	NA
WP_039649536.1|2223094_2224291_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_043433648.1|2224287_2226549_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_039649539.1|2226663_2227341_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_039649541.1|2227354_2228290_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_014672705.1|2228454_2229474_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_039649545.1|2229746_2230160_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	50.0	7.6e-29
WP_039649547.1|2230263_2230623_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_039649550.1|2230630_2232145_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_039649552.1|2232236_2234861_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	2.7e-143
WP_043433647.1|2235153_2236245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039649557.1|2236324_2237611_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.4	2.4e-145
>prophage 3
NZ_CP021080	Streptomyces pluripotens strain MUSC 135 chromosome, complete genome	7346075	3161776	3196316	7346075	protease,transposase,holin	Mycobacterium_phage(50.0%)	29	NA	NA
WP_039651240.1|3161776_3162265_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_039651242.1|3162261_3163197_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_039651278.1|3163656_3164856_-|protease	MarP family serine protease	protease	NA	NA	NA	NA
WP_078858900.1|3164869_3165574_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_089516753.1|3165694_3166495_-	endonuclease III	NA	NA	NA	NA	NA
WP_030734182.1|3167186_3167861_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_043433796.1|3168076_3168901_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_039651249.1|3169076_3169907_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_039651251.1|3169903_3170788_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_039651252.1|3170857_3171322_-	RidA family protein	NA	NA	NA	NA	NA
WP_071659064.1|3171318_3171480_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_039651255.1|3171712_3172690_+	ArsA family ATPase	NA	NA	NA	NA	NA
WP_039651257.1|3172686_3174090_+	ArsA family ATPase	NA	NA	NA	NA	NA
WP_174673986.1|3174497_3174836_-	transcriptional regulator WblA	NA	A0A2P1CGA4	Mycobacterium_phage	50.7	6.2e-13
WP_174673873.1|3175444_3177775_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_039651261.1|3177953_3178421_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	36.1	1.2e-11
WP_043433798.1|3178515_3179442_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_039651264.1|3179678_3180437_+	Pr6Pr family membrane protein	NA	NA	NA	NA	NA
WP_043435394.1|3183122_3184313_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_052319059.1|3184736_3185186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078859084.1|3185195_3189458_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_039651266.1|3189486_3189852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043435391.1|3191367_3191904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089516727.1|3191860_3192757_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_039657656.1|3193047_3193941_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_043404357.1|3194005_3194284_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_039657652.1|3194280_3194706_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_043404360.1|3194907_3195291_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167747960.1|3195299_3196316_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP021080	Streptomyces pluripotens strain MUSC 135 chromosome, complete genome	7346075	3942355	3982962	7346075	tRNA,transposase,integrase	Catovirus(20.0%)	34	3967888:3967931	3978584:3978627
WP_039654742.1|3942355_3943756_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	28.9	2.9e-40
WP_039654743.1|3943857_3944799_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_174673890.1|3944927_3946592_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_039654744.1|3946684_3947416_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_039654745.1|3947516_3947993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043405016.1|3948195_3949329_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	36.3	1.8e-19
WP_043433930.1|3949704_3950856_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	28.0	3.7e-33
WP_043433928.1|3950855_3951038_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043433925.1|3951030_3952314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039654750.1|3952471_3952717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043433922.1|3952742_3952937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039654752.1|3952953_3953145_-	Mobile element transfer	NA	NA	NA	NA	NA
WP_043433919.1|3953157_3953778_-	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_039654754.1|3953811_3955188_-	conjugal transfer protein TraS	NA	NA	NA	NA	NA
WP_043433916.1|3955187_3955544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039654823.1|3955788_3956088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039654755.1|3956110_3956899_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039654756.1|3957006_3957414_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_039654757.1|3957460_3957889_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_043433912.1|3957882_3958254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043433910.1|3958784_3959465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043433909.1|3959506_3960601_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.2	1.6e-30
WP_078886429.1|3961580_3962651_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_043404360.1|3962934_3963318_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167747960.1|3963326_3964343_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159025310.1|3964922_3965699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043432903.1|3965925_3966159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043432906.1|3966405_3966888_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_052270101.1|3967426_3967708_-	hypothetical protein	NA	NA	NA	NA	NA
3967888:3967931	attL	ACTTGTAAAGCGAAGGTCGTCGGTTCGAATCCGACAGGGGGCTC	NA	NA	NA	NA
WP_078858771.1|3967975_3968770_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	33.7	2.3e-18
WP_043405000.1|3969964_3970495_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174673891.1|3971260_3973348_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_052318994.1|3973344_3977337_+	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_078886429.1|3981891_3982962_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
3978584:3978627	attR	ACTTGTAAAGCGAAGGTCGTCGGTTCGAATCCGACAGGGGGCTC	NA	NA	NA	NA
>prophage 5
NZ_CP021080	Streptomyces pluripotens strain MUSC 135 chromosome, complete genome	7346075	5053415	5108828	7346075	protease,transposase	uncultured_virus(50.0%)	47	NA	NA
WP_052319101.1|5053415_5054156_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_159025324.1|5054358_5055093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159025103.1|5055248_5055392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052269857.1|5055613_5055916_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_043435727.1|5055912_5057850_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_052319099.1|5057861_5058425_+	NifU family protein	NA	NA	NA	NA	NA
WP_052319098.1|5059642_5062456_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	3.5e-77
WP_043408575.1|5062700_5063210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039651495.1|5063271_5063769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043408572.1|5063798_5065145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052269861.1|5065190_5065424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043408569.1|5066035_5067565_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_039651498.1|5067829_5068243_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_039651499.1|5068239_5068503_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_078859117.1|5069221_5069698_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_086082975.1|5069927_5071364_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_052319056.1|5073195_5074353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043435309.1|5074342_5075857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159025326.1|5075873_5077442_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_052319055.1|5077441_5079247_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_043435308.1|5079243_5079816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043435306.1|5079877_5080378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052319054.1|5080374_5081415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043435304.1|5081442_5081670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078886429.1|5081662_5082733_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_043431985.1|5082901_5083252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086082975.1|5085081_5086518_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_043432069.1|5086732_5087176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043404360.1|5087368_5087752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167747963.1|5087760_5088777_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159025327.1|5088843_5091633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078859114.1|5091896_5092460_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_043435649.1|5092477_5094760_+	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_174673920.1|5095274_5095793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174674001.1|5095785_5097522_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_043435647.1|5097518_5099075_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_043435645.1|5099074_5100604_-	PrgI family protein	NA	NA	NA	NA	NA
WP_086083468.1|5100607_5102521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039655237.1|5102510_5102984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043435643.1|5103285_5103615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052319093.1|5103628_5104537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052319092.1|5104771_5105869_+	C40 family peptidase	NA	A0A0F7INF9	Delftia_phage	42.0	8.8e-08
WP_052319091.1|5105898_5106450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159025328.1|5106552_5106831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052319090.1|5106858_5107320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167747958.1|5107419_5108436_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_043404360.1|5108444_5108828_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP021080	Streptomyces pluripotens strain MUSC 135 chromosome, complete genome	7346075	7220451	7295824	7346075	integrase,transposase,bacteriocin	Mycobacterium_phage(22.22%)	56	7281008:7281024	7299526:7299542
WP_107067952.1|7220451_7220652_-|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_078858840.1|7220854_7222498_+	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_078858843.1|7222421_7223144_-	ABC transporter	NA	NA	NA	NA	NA
WP_052269786.1|7223260_7224169_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	4.0e-22
WP_078858841.1|7224252_7225302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039649867.1|7225309_7226827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039649869.1|7226841_7228800_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_159025357.1|7228789_7230583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043433515.1|7230579_7233147_-	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_052269778.1|7233143_7234295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052269779.1|7234914_7235463_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_063891038.1|7235462_7237070_+	putative Ig domain-containing protein	NA	NA	NA	NA	NA
WP_078858844.1|7237170_7237491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089516745.1|7237564_7238461_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_086083062.1|7238417_7238954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086083613.1|7239013_7239448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039649873.1|7240458_7241001_-	adenylate kinase	NA	NA	NA	NA	NA
WP_039649875.1|7241104_7241494_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_039649877.1|7241490_7242393_-	ribokinase	NA	NA	NA	NA	NA
WP_039649879.1|7244448_7245975_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.3	6.7e-14
WP_039649881.1|7245971_7246988_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_167747954.1|7247349_7247517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052319112.1|7248091_7250869_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_086083817.1|7251275_7251842_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_159025086.1|7253095_7253857_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_043435827.1|7253853_7255113_+	diaminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_159025087.1|7255971_7256121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039649891.1|7256124_7256805_+	7-cyano-7-deazaguanine synthase	NA	A0A2L0HKG0	Mycobacterium_phage	37.9	1.6e-23
WP_039649893.1|7256857_7257571_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1B2IHN4	Mycobacterium_phage	39.5	1.9e-35
WP_039649896.1|7257609_7257972_+	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_039649899.1|7258055_7258649_+	GTP cyclohydrolase I	NA	A0A1W7AF02	Streptococcus_virus	45.2	5.4e-28
WP_078859132.1|7258777_7260250_+	XRE family transcriptional regulator	NA	K4I2Q1	Streptomyces_phage	43.7	5.5e-05
WP_039649903.1|7260277_7261144_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_063891061.1|7261306_7262590_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_078859130.1|7262685_7263720_-	hypothetical protein	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.7	1.2e-30
WP_052269782.1|7264077_7264728_-	cyclase family protein	NA	NA	NA	NA	NA
WP_043435821.1|7264802_7265666_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_078859129.1|7265816_7267736_-	methylaspartate mutase subunit E	NA	NA	NA	NA	NA
WP_052269787.1|7268157_7269063_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_043435819.1|7269458_7270721_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_052319109.1|7270717_7271959_+	MFS transporter	NA	NA	NA	NA	NA
WP_039649910.1|7271955_7273164_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_043435815.1|7273220_7273475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039649914.1|7273490_7273793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043435813.1|7273820_7274942_-	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	28.0	2.4e-16
WP_039649917.1|7274938_7275730_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_086083829.1|7277198_7278269_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159025358.1|7278762_7278912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086083615.1|7278989_7280327_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_043410451.1|7280470_7280971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159025359.1|7280982_7281153_+	hypothetical protein	NA	NA	NA	NA	NA
7281008:7281024	attL	AGGCGATCCGGCTGCTC	NA	NA	NA	NA
WP_043434205.1|7281228_7281819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159025360.1|7282499_7286576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159025361.1|7287065_7294037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159025362.1|7294040_7294457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043409968.1|7294561_7295824_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	33.4	9.7e-43
7299526:7299542	attR	AGGCGATCCGGCTGCTC	NA	NA	NA	NA
