The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009685	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4636831	835923	843062	4636831		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|835923_836562_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|836653_837820_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|837816_838725_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|838920_839688_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|839738_840395_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|840500_843062_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP009685	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4636831	1223641	1234851	4636831	tail,integrase	Enterobacteria_phage(53.33%)	16	1219951:1219967	1236861:1236877
1219951:1219967	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_001163428.1|1223641_1223842_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000206809.1|1223973_1224279_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001242717.1|1224278_1224641_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008183.1|1224631_1225168_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000081278.1|1225295_1226120_-	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000135673.1|1226185_1226548_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_001393497.1|1227270_1227765_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000066913.1|1227764_1228040_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_011443597.1|1228089_1228608_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_001106835.1|1228634_1229075_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_047792215.1|1229373_1229655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030215.1|1229689_1231021_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_000703651.1|1231017_1231938_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_000915541.1|1231934_1232297_-	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000958671.1|1232449_1233607_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000368140.1|1233918_1234851_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
1236861:1236877	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP009685	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4636831	1584254	1592925	4636831		Enterobacteria_phage(28.57%)	8	NA	NA
WP_001116026.1|1584254_1585649_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
WP_000183060.1|1585823_1586717_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699460.1|1587089_1588175_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_001023610.1|1588174_1589074_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000783975.1|1589131_1590013_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001100981.1|1590012_1590570_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_001393538.1|1590566_1591814_+	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000272486.1|1591821_1592925_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
>prophage 4
NZ_CP009685	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4636831	2046617	2065828	4636831	tail,lysis	Enterobacteria_phage(40.91%)	34	NA	NA
WP_000379575.1|2046617_2046773_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2046939_2047347_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2047430_2047661_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_011443592.1|2047957_2048107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2048543_2048876_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2049078_2049384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2049408_2049648_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2049647_2049935_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2050006_2050162_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2050378_2050630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2050696_2050975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001393597.1|2050976_2052026_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	5.7e-113
WP_001047135.1|2052039_2052792_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2053069_2053159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|2053213_2053426_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2053726_2053942_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2054695_2054911_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2054915_2055227_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2055223_2055757_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2055753_2056251_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2056613_2056826_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2056836_2057025_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2057027_2057093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2057171_2057327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2057498_2057672_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2057823_2058234_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2058291_2058525_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453612.1|2058913_2059483_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001027733.1|2059433_2060396_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000885611.1|2060395_2060971_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2061068_2061659_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2061975_2062209_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2062277_2062391_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527743.1|2064367_2065828_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
>prophage 5
NZ_CP009685	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4636831	2190414	2288717	4636831	tail,tRNA,transposase,integrase,lysis	Escherichia_phage(41.67%)	85	2267665:2267683	2298040:2298058
WP_000826416.1|2190414_2191623_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2192154_2192823_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2193124_2193718_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|2193714_2194707_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234042.1|2194830_2195811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140873.1|2195802_2196342_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2196404_2196629_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375961.1|2196768_2198424_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|2198648_2199992_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|2200208_2201132_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|2201169_2202810_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2203208_2203358_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2203429_2203603_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2203847_2204378_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|2205608_2207048_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2207244_2208045_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139543.1|2208316_2212219_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048950.1|2212419_2213025_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627368.1|2213078_2214395_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431845.1|2214384_2216142_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890941.1|2216157_2217054_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177515.1|2217053_2217659_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000910026.1|2217829_2220136_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2220198_2221059_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_032313496.1|2221266_2223678_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001254932.1|2224770_2225922_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_088895425.1|2226130_2227358_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_010723099.1|2230049_2230115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2230218_2230809_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2230790_2231741_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2231841_2233155_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2233181_2234387_-	bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2234386_2234809_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2234798_2236226_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2236227_2237016_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2237015_2237783_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2237779_2238850_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2238857_2239355_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2239369_2240116_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2240124_2240412_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2240423_2241353_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2241637_2243683_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2243930_2246204_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2246261_2247761_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067514.1|2247996_2248902_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2249073_2249400_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2249407_2249593_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2249589_2252229_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2252436_2253426_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2253536_2253959_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2253955_2254222_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628244.1|2254495_2258020_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2258386_2259520_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2259660_2260095_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_120795384.1|2260873_2260987_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|2261055_2261289_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000086527.1|2261605_2262196_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2262293_2262869_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000279097.1|2262868_2266231_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000019448.1|2266553_2267534_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
2267665:2267683	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000091628.1|2269299_2269659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001350510.1|2269639_2269903_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_001097895.1|2270040_2271498_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2271694_2271880_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_000450663.1|2271967_2272528_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_000788970.1|2272550_2273297_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899748.1|2273303_2274161_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2274173_2274596_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2274618_2274915_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2275038_2275515_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_001169151.1|2275968_2276124_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2276120_2276609_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2277050_2277272_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2277271_2277442_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2277516_2277792_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105143.1|2277893_2280494_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000166319.1|2280486_2281296_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2281352_2281547_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2281539_2281749_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2281827_2282043_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2282044_2283280_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2283331_2284267_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2284395_2285769_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2286246_2287230_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2287484_2288717_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2298040:2298058	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP009685	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4636831	2481219	2495600	4636831	tail,integrase,plate,portal	Escherichia_phage(26.32%)	26	2478595:2478608	2496626:2496639
2478595:2478608	attL	AAAATAAGATGAAT	NA	NA	NA	NA
WP_000332303.1|2481219_2481951_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2482171_2482576_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032082692.1|2482628_2482739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|2482974_2483019_+	protein YmgK	NA	NA	NA	NA	NA
WP_001295666.1|2483275_2483599_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000943927.1|2483701_2483866_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_000557907.1|2484099_2484933_-	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000905001.1|2485039_2485594_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_024184299.1|2485665_2486160_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000548498.1|2486159_2486762_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|2486733_2487147_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000554703.1|2487148_2487778_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_000383574.1|2487781_2488366_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_001350503.1|2488356_2489148_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_001350502.1|2489074_2489548_-|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_000605606.1|2489547_2489730_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000104929.1|2489741_2491109_-	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_001250269.1|2491098_2491278_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515837.1|2491453_2492011_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_000649480.1|2492054_2492255_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000848748.1|2492345_2493020_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001005353.1|2493194_2493503_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_010723095.1|2493440_2493782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011443584.1|2493898_2494210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000939945.1|2494246_2494492_+	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_000741310.1|2494472_2495600_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	61.5	7.2e-122
2496626:2496639	attR	AAAATAAGATGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP009685	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4636831	3086281	3130644	4636831	integrase,lysis,protease,transposase	Enterobacteria_phage(54.17%)	47	3109356:3109402	3130658:3130704
WP_001300563.1|3086281_3087394_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|3087470_3087623_-	type I toxin-antitoxin system toxin HokE	NA	NA	NA	NA	NA
WP_001130654.1|3088075_3089194_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682509.1|3089259_3089508_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|3089572_3089941_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000351487.1|3090034_3090688_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|3090795_3092043_+	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000786319.1|3092123_3093500_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573945.1|3093601_3096745_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000717157.1|3096756_3097980_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709870.1|3097995_3098328_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|3098485_3099859_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3100015_3100699_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253839.1|3100688_3102131_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000383932.1|3102280_3104518_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662357.1|3104504_3107477_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224604.1|3107477_3108368_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177471.1|3108550_3109312_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3109356:3109402	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|3109825_3110779_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|3111028_3111778_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_026089880.1|3112680_3113307_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000453566.1|3114079_3114625_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001421937.1|3115013_3115208_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|3115372_3115579_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|3115864_3116275_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|3116565_3116859_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|3116949_3117132_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|3117348_3117846_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000839596.1|3117845_3118061_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737282.1|3118633_3119701_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_010723085.1|3119705_3120722_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001204791.1|3121119_3121503_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971055.1|3121588_3121729_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3121725_3122088_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774486.1|3122084_3122375_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_000224915.1|3122367_3122538_-	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001054340.1|3122537_3122993_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_001303586.1|3122989_3123091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3123207_3124005_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|3124014_3124566_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3125030_3126557_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001372443.1|3126614_3126764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070439.1|3126811_3127144_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_085947771.1|3127454_3128617_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000145909.1|3128679_3128775_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000672150.1|3129097_3129361_+	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_001350488.1|3129480_3130644_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
3130658:3130704	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 8
NZ_CP009685	Escherichia coli str. K-12 substr. MG1655 strain K-12 chromosome, complete genome	4636831	3363962	3421358	4636831	integrase,holin,transposase	Acinetobacter_phage(25.0%)	49	3355390:3355406	3417718:3417734
3355390:3355406	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000131044.1|3363962_3365996_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3366124_3366712_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3366725_3368198_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3368211_3369882_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3370094_3370763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3371005_3371701_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3371693_3373121_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3373131_3373851_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3374377_3375232_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046307.1|3375457_3376783_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3376891_3377128_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3377139_3377733_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_085947771.1|3379005_3380168_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000662258.1|3382216_3382318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3382681_3382945_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3382944_3383085_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3383119_3383347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3384170_3384713_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3384787_3385375_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3385432_3386101_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3386126_3388652_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001310578.1|3388641_3390285_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3390253_3390964_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3391276_3391606_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3391853_3392468_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3392885_3393575_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3393571_3394528_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|3394524_3396723_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3396732_3397689_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111342.1|3397667_3398078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|3398362_3399763_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_000224818.1|3399879_3400320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|3400316_3400541_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072039.1|3400659_3401514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214248.1|3401540_3402239_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000860996.1|3402510_3403137_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000388269.1|3403227_3403959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281825.1|3405153_3406158_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001121657.1|3406296_3407055_+	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_000406871.1|3407059_3408670_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_000192863.1|3408681_3410064_-	MFS transporter	NA	NA	NA	NA	NA
WP_000151261.1|3410290_3412258_-	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_001136613.1|3412272_3413181_-	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_010723086.1|3413475_3414630_+|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001030800.1|3414723_3415074_+	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_000192349.1|3416656_3417703_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000081352.1|3417811_3418744_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
3417718:3417734	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_001393629.1|3418730_3420134_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_010723085.1|3420341_3421358_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
