The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	640366	654551	4827630	integrase,transposase	Enterobacteria_phage(76.92%)	16	629554:629569	662108:662123
629554:629569	attL	TGCTGGGCGATTTGGA	NA	NA	NA	NA
WP_001572309.1|640366_641623_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.6	2.5e-75
WP_032291790.1|641772_643236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446151.1|643601_644174_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.2	2.7e-93
WP_000638634.1|644247_644748_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_039264336.1|644744_645479_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	1.0e-129
WP_052214776.1|646030_646252_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	1.3e-35
WP_039264337.1|646293_646893_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244670.1|646885_647173_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459310.1|647165_647621_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	8.0e-64
WP_000422741.1|647712_648138_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|648134_648485_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_039264366.1|648515_650129_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	6.8e-182
WP_000856729.1|650296_650617_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_039264340.1|650631_652965_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_087889224.1|653311_653506_+|integrase	integrase	integrase	Q38404	Enterobacteria_phage	96.1	2.2e-23
WP_032214558.1|653723_654551_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.4	1.0e-56
662108:662123	attR	TGCTGGGCGATTTGGA	NA	NA	NA	NA
>prophage 2
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	949508	1006372	4827630	integrase,plate,tRNA,protease	uncultured_Mediterranean_phage(14.29%)	44	940905:940920	1002267:1002282
940905:940920	attL	GCGTCTGGCGGCGCTG	NA	NA	NA	NA
WP_000753945.1|949508_950933_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
WP_000929439.1|951087_952245_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|952333_952720_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186650.1|953034_953859_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_039264358.1|953889_956562_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|956623_957418_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246884.1|957785_958511_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|958768_959620_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|959766_960492_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|960783_961341_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000811923.1|961432_962629_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001295562.1|962817_963576_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_000922446.1|963588_964446_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001402027.1|964457_965810_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|965839_968272_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|968393_968879_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|968882_969908_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|970012_970468_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|970471_971260_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|971259_972408_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_001542635.1|972404_973001_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001542637.1|973037_976520_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	1.7e-209
WP_000055741.1|976532_977492_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_039264359.1|977590_979732_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|979788_980178_+	VOC family protein	NA	NA	NA	NA	NA
WP_001542639.1|980242_981541_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|981589_981850_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|981836_982037_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|982202_982748_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|982744_983167_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239154.1|983180_983891_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260716.1|984922_986641_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094031.1|986751_987459_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|987455_987860_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|987977_988793_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|988832_989486_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|989478_990510_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140186.1|990697_991270_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000279885.1|997140_997707_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	45.2	2.2e-34
WP_000666530.1|999000_999681_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	41.4	2.6e-50
WP_001542642.1|1002164_1002437_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
1002267:1002282	attR	CAGCGCCGCCAGACGC	NA	NA	NA	NA
WP_000450225.1|1002439_1003486_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_039264360.1|1003496_1004492_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371477.1|1004488_1006372_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	1063788	1071836	4827630		Streptococcus_phage(33.33%)	8	NA	NA
WP_001285288.1|1063788_1064892_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|1064903_1066157_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001444700.1|1066675_1067335_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000942525.1|1067313_1068384_-	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_039264365.1|1069667_1069889_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	5.5e-10
WP_032186123.1|1069951_1070428_-	RadC family protein	NA	NA	NA	NA	NA
WP_032186124.1|1070443_1070926_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	3.4e-12
WP_032186126.1|1071017_1071836_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	6.7e-45
>prophage 4
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	1342323	1400223	4827630	portal,lysis,tRNA,protease,integrase,terminase,head,tail,capsid	Enterobacteria_phage(54.39%)	73	1352485:1352531	1400646:1400692
WP_000912345.1|1342323_1343709_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1343744_1344266_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1344373_1344586_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|1344587_1345454_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001315309.1|1345934_1346477_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|1346696_1347389_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_039264379.1|1347419_1350029_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|1350041_1351049_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250424.1|1351059_1351575_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|1351577_1352210_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1352485:1352531	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|1352544_1353708_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|1353906_1354185_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|1354232_1354451_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|1354549_1354831_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|1354841_1355033_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1355005_1355188_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1355184_1355865_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|1355861_1356647_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995453.1|1356652_1356949_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.8e-48
WP_023148105.1|1357024_1357315_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000858975.1|1357826_1358516_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1358620_1358851_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182893.1|1358920_1359460_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	66.5	2.2e-60
WP_000147899.1|1359456_1360476_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	1.4e-111
WP_000788786.1|1360472_1361174_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.3e-129
WP_021580089.1|1361170_1361491_+	phage exclusion protein Ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.2e-42
WP_001070442.1|1361541_1361874_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|1361965_1362073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|1362130_1363657_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001567061.1|1363768_1364086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|1364290_1365220_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|1365318_1365420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|1365416_1365872_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|1365871_1366042_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|1366034_1366325_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099700.1|1366321_1366684_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000971068.1|1366680_1366821_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|1366906_1367290_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|1367479_1368577_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|1369165_1369381_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|1369380_1369878_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1370094_1370277_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1370367_1370661_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|1371020_1371215_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453587.1|1371603_1372149_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027283.1|1372123_1374049_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1374045_1374252_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|1374248_1375850_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123273.1|1375830_1377150_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369910.1|1377159_1377492_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063218.1|1377547_1378573_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|1378614_1379010_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|1379021_1379375_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|1379386_1379965_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|1379961_1380357_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|1380364_1381105_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|1381120_1381543_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|1381524_1381959_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840258.1|1381951_1384513_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|1384509_1384839_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|1384838_1385537_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|1385542_1386286_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071532093.1|1386222_1386855_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_000515725.1|1386915_1390329_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001233071.1|1390399_1390999_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|1391063_1394024_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|1394023_1394599_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|1394696_1395287_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|1395603_1395837_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1395905_1396019_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|1396384_1397053_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226378.1|1397598_1399083_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1399269_1400223_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
1400646:1400692	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 5
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	1825706	1908909	4827630	protease,integrase,terminase,head,tail,holin,capsid	Escherichia_phage(40.0%)	97	1840802:1840861	1904175:1904236
WP_000156526.1|1825706_1827467_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|1827652_1828105_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|1828179_1829232_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1829588_1830098_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1830316_1830946_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875019.1|1830908_1833071_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1833080_1833527_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420536.1|1833649_1835704_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424181.1|1835735_1836194_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1836289_1836952_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001396445.1|1837124_1837538_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1837582_1837900_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1837957_1839148_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048221.1|1839242_1839521_+	acylphosphatase	NA	NA	NA	NA	NA
WP_001542786.1|1839517_1839847_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1839937_1840597_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1840802:1840861	attL	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGAC	NA	NA	NA	NA
WP_001367167.1|1841004_1842024_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
WP_000273163.1|1841992_1842244_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_039264392.1|1842310_1844713_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.1	3.7e-176
WP_000092782.1|1844805_1844994_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1844990_1845179_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_077632757.1|1846033_1846249_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	5.3e-10
WP_000380319.1|1846404_1846557_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000948456.1|1846868_1847345_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000712070.1|1847469_1847793_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.4e-09
WP_000693925.1|1847776_1848202_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_039264394.1|1848270_1849302_+	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	70.4	6.9e-87
WP_072130322.1|1849213_1849756_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_039264395.1|1849789_1850515_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.7	3.3e-80
WP_001151139.1|1850530_1850938_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	59.4	2.2e-33
WP_029374881.1|1850934_1851234_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.9	4.8e-49
WP_001373171.1|1851262_1851418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991478.1|1851414_1851726_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	79.6	6.5e-49
WP_000829416.1|1851855_1852074_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	70.3	1.2e-06
WP_000651125.1|1852063_1852459_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	1.6e-36
WP_024173669.1|1852692_1852905_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	64.3	1.6e-14
WP_001341173.1|1853071_1853344_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_039264396.1|1853345_1854395_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	4.5e-110
WP_000904149.1|1854407_1854767_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	3.3e-36
WP_001367730.1|1854775_1855306_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.4	6.0e-71
WP_000917741.1|1855548_1855746_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_039264397.1|1855897_1856956_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.6	5.6e-193
WP_000649753.1|1857338_1858298_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738072.1|1858309_1858579_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_039264398.1|1859080_1861045_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.0	5.0e-296
WP_000284510.1|1861539_1861755_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001457151.1|1861758_1862244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106425492.1|1862245_1862620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264399.1|1862754_1863288_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	5.3e-99
WP_062896309.1|1863444_1863627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148307808.1|1863995_1864202_+	hypothetical protein	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	3.3e-09
WP_000881332.1|1864354_1864969_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	1.1e-63
WP_000828070.1|1865305_1865632_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1865763_1865964_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_033883566.1|1866005_1866371_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	2.1e-62
WP_000958387.1|1866660_1867224_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_039264401.1|1867220_1868882_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.8	0.0e+00
WP_000172990.1|1868945_1870883_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1870927_1871149_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|1873513_1873840_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001029274.1|1873849_1874200_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573391.1|1874196_1874643_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133383.1|1874639_1874984_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_039264404.1|1875050_1875767_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	98.7	8.9e-126
WP_000710936.1|1875781_1876156_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_122993267.1|1876251_1876461_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_039264405.1|1876508_1879751_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.7	0.0e+00
WP_000343411.1|1879743_1880085_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_001499019.1|1880084_1880783_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_039264406.1|1880793_1881537_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	3.8e-148
WP_122993618.1|1881482_1882115_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_039264407.1|1882354_1886041_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_000078853.1|1886239_1886380_+	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_039264408.1|1888242_1888455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264582.1|1888466_1889141_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	4.3e-114
WP_022581964.1|1889304_1889634_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001367167.1|1889975_1890995_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
WP_000273163.1|1890963_1891215_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_187292989.1|1891281_1891512_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	64.8	1.8e-19
WP_187292990.1|1891508_1891973_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	46.6	4.2e-20
WP_077784630.1|1891908_1892970_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	84.1	4.4e-137
WP_000450222.1|1893962_1894151_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_077632757.1|1895003_1895219_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	5.3e-10
WP_000380319.1|1895374_1895527_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_187292991.1|1896932_1897130_+	hypothetical protein	NA	S5MW25	Escherichia_phage	92.3	5.4e-25
WP_187292992.1|1897185_1897584_+	hypothetical protein	NA	S5MW25	Escherichia_phage	99.2	3.5e-63
WP_187292993.1|1897757_1898324_+	hypothetical protein	NA	S5MW25	Escherichia_phage	85.3	3.4e-80
WP_187292994.1|1898280_1898733_+	hypothetical protein	NA	S5MW25	Escherichia_phage	94.2	2.0e-70
WP_000078853.1|1900637_1900778_+	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_039264410.1|1900922_1902635_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	51.0	1.2e-67
WP_039264408.1|1902644_1902857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264582.1|1902868_1903543_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	4.3e-114
WP_022581964.1|1903706_1904036_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001058323.1|1904690_1905809_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1904175:1904236	attR	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_039264411.1|1905805_1907599_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|1907617_1908325_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1908321_1908909_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	2159305	2227954	4827630	portal,protease,integrase,terminase,head,tail,holin,capsid	Escherichia_phage(28.85%)	77	2159142:2159166	2214149:2214173
2159142:2159166	attL	CAGTGTGGTACATGGATATCGATAC	NA	NA	NA	NA
WP_028985500.1|2159305_2160436_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	1.2e-103
WP_000113186.1|2160413_2160662_-	excisionase	NA	NA	NA	NA	NA
WP_028985499.1|2160726_2163198_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
WP_000092839.1|2163293_2163482_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2163478_2163667_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|2164451_2164820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|2164831_2164984_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|2165173_2165581_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|2165658_2165886_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|2165869_2166391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|2166371_2167337_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790459.1|2167343_2168084_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450858.1|2168113_2168875_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|2168934_2169129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|2169470_2170022_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|2170236_2170449_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|2170551_2170869_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|2171457_2171685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|2171738_2172008_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_033817200.1|2172009_2173059_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.9e-109
WP_000904136.1|2173071_2173434_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_021293385.1|2173426_2174092_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.6	4.6e-60
WP_000342737.1|2174345_2175059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|2175232_2175430_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_032308170.1|2175581_2176640_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000271631.1|2177119_2177548_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382065.1|2178244_2178970_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039264423.1|2180832_2182797_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.4	2.0e-297
WP_000142780.1|2182931_2183111_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|2183151_2183397_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284490.1|2183474_2183690_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_039264424.1|2183693_2184485_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|2184996_2185530_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_062896309.1|2185686_2185869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|2186237_2186444_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|2186508_2186733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828070.1|2187077_2187404_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|2187535_2187736_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|2187777_2188143_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958387.1|2188431_2188995_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001373204.1|2188991_2190653_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000172990.1|2190716_2192654_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|2192698_2192920_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_039264426.1|2192865_2195451_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.2	0.0e+00
WP_000126028.1|2195447_2195774_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
WP_001007902.1|2195784_2196135_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_000573397.1|2196131_2196578_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|2196574_2196919_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275414.1|2196985_2197702_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000710936.1|2197716_2198091_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_122993267.1|2198186_2198396_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_039264427.1|2198444_2201687_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
WP_000343408.1|2201679_2202021_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	7.6e-51
WP_000738904.1|2202219_2203383_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_001365876.1|2203593_2204292_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_039264428.1|2204302_2205046_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	3.8e-148
WP_137573430.1|2204991_2205624_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_039264430.1|2206533_2210220_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_000078853.1|2210418_2210559_+	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_000290874.1|2210703_2211972_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049904.1|2212040_2212712_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.4	9.6e-106
WP_000211405.1|2213119_2213680_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
WP_001079504.1|2214326_2214833_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2214149:2214173	attR	CAGTGTGGTACATGGATATCGATAC	NA	NA	NA	NA
WP_001056491.1|2214878_2215379_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2215464_2215644_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|2216024_2216831_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2216830_2218024_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|2218035_2219397_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|2219397_2220993_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|2220992_2222555_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2222646_2222691_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285673.1|2222828_2223710_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2223706_2224327_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|2224427_2225300_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|2225339_2225930_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|2225926_2226685_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|2226904_2227954_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	2878799	2960723	4827630	transposase,portal,integrase,terminase,holin,head,tail,plate,capsid	Escherichia_phage(20.93%)	101	2914247:2914306	2960793:2960869
WP_062868572.1|2878799_2880008_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	94.0	5.8e-210
WP_073520221.1|2880030_2880690_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	9.6e-42
WP_000879833.1|2881419_2882217_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|2882226_2882778_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2882946_2883279_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274295.1|2883612_2883927_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_032141871.1|2884141_2885800_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2885792_2886788_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282706.1|2886780_2887467_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213318.1|2887466_2888840_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2888858_2889302_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620097.1|2889298_2890426_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2890530_2890995_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2890999_2892004_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2892000_2892414_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001299290.1|2892416_2892782_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253441.1|2892781_2893519_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2893528_2893798_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983977.1|2893806_2894592_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|2894881_2895505_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2895548_2895737_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2895899_2896127_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_039264461.1|2896424_2897240_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001542934.1|2897236_2898931_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2899101_2899284_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2899362_2900280_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|2900452_2901373_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2901361_2901832_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157239.1|2901812_2903231_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_039264462.1|2903297_2903993_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	2.5e-08
WP_001313057.1|2904032_2904398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824362.1|2904964_2906038_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_000218214.1|2906630_2907482_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826768.1|2907588_2908947_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|2908946_2909618_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000920127.1|2909750_2910164_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740094.1|2910272_2911277_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001542937.1|2911277_2911913_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007749.1|2912169_2912820_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2913162_2913693_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
2914247:2914306	attL	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTA	NA	NA	NA	NA
WP_000974855.1|2914671_2915682_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	NA	NA	NA	NA
WP_001287093.1|2915687_2916731_-	phage late control protein	NA	R9TNM7	Vibrio_phage	28.7	9.9e-33
WP_000634204.1|2916734_2916947_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_000418460.1|2916963_2917206_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	46.9	1.8e-06
WP_024184912.1|2917184_2917574_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	39.5	1.5e-15
WP_012138675.1|2917609_2919250_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	27.9	8.3e-18
WP_000444666.1|2919358_2919640_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_039264464.1|2919652_2920165_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_039264465.1|2920182_2921676_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	34.1	3.8e-70
WP_001559300.1|2921681_2921915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264466.1|2922866_2923493_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.5	3.1e-26
WP_039264467.1|2923495_2924416_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.4	7.0e-67
WP_039264468.1|2924412_2924754_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	50.5	5.3e-20
WP_039264469.1|2924756_2925659_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_039264470.1|2925639_2926176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264472.1|2926172_2926853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264473.1|2926884_2927265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264474.1|2927261_2927669_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_039264475.1|2927699_2928734_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	57.4	9.2e-108
WP_000206291.1|2928796_2929126_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	39.5	2.6e-08
WP_001145891.1|2929125_2930436_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	51.7	5.8e-99
WP_028985357.1|2930435_2932007_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.5	6.6e-190
WP_012565126.1|2932003_2932237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148194.1|2932233_2934099_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	4.1e-191
WP_000168116.1|2934085_2934652_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	43.5	7.7e-32
WP_001559319.1|2935024_2935270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264476.1|2935586_2935880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071791986.1|2935876_2936155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131874.1|2936495_2936975_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	69.4	1.6e-62
WP_039264477.1|2936961_2937246_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	1.0e-08
WP_001294589.1|2937245_2937629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264478.1|2937741_2938413_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	32.4	7.8e-15
WP_000717782.1|2938412_2938706_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
WP_039264479.1|2938702_2939299_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.6	1.4e-71
WP_001025459.1|2939375_2939555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264586.1|2939706_2940348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001559328.1|2940466_2940745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2941312_2941801_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_039264480.1|2941810_2942416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052214780.1|2942525_2942930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264481.1|2943250_2943916_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_021560858.1|2944120_2944318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264482.1|2944944_2945868_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_039264483.1|2946045_2946840_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	74.6	2.8e-48
WP_039264484.1|2947521_2947746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192614.1|2947975_2948377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264485.1|2949727_2951341_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.2	4.4e-181
WP_000624722.1|2951371_2951722_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2951718_2952144_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_039264486.1|2952158_2952347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264487.1|2952343_2953408_-	hypothetical protein	NA	C8CGZ1	Staphylococcus_phage	53.9	7.7e-33
WP_000943913.1|2953410_2953635_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	56.8	1.1e-18
WP_039264488.1|2953674_2954151_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	5.5e-23
WP_028985347.1|2954209_2954440_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	61.8	4.2e-21
WP_001296165.1|2954538_2954952_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_028985346.1|2955948_2956269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028985345.1|2956299_2958522_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.4	1.1e-92
WP_001559346.1|2958518_2959088_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	50.3	3.6e-37
WP_000916333.1|2959087_2959270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264489.1|2959479_2959695_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	66.2	3.9e-21
WP_028985344.1|2959694_2960723_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.4	5.6e-97
2960793:2960869	attR	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACC	NA	NA	NA	NA
>prophage 8
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	3080439	3090553	4827630	integrase,tail,lysis	Enterobacteria_phage(66.67%)	10	3072875:3072888	3092590:3092603
3072875:3072888	attL	TGACGGCGAGCGTC	NA	NA	NA	NA
WP_071885001.1|3080439_3083790_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_039264501.1|3084932_3085115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264502.1|3085213_3085588_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	81.5	4.6e-49
WP_039264503.1|3085626_3086070_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	96.6	2.4e-73
WP_024239663.1|3087228_3087543_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_024215524.1|3087559_3087841_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_039264504.1|3087837_3088005_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	92.7	1.8e-21
WP_039264505.1|3088135_3088834_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	83.2	3.9e-102
WP_039264506.1|3089283_3089502_+	excisionase	NA	Q77WA4	Escherichia_phage	98.6	2.4e-34
WP_039264507.1|3089479_3090553_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.6	3.9e-194
3092590:3092603	attR	GACGCTCGCCGTCA	NA	NA	NA	NA
>prophage 9
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	3145733	3154042	4827630		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001371026.1|3145733_3147734_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_001295429.1|3147858_3148320_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3148360_3148831_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3148877_3149597_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3149593_3151279_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3151500_3152232_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|3152291_3152399_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3152379_3153111_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|3153115_3154042_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 10
NZ_CP009104	Escherichia coli strain RM9387 chromosome, complete genome	4827630	3767821	3774961	4827630		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|3767821_3770383_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141330.1|3770488_3771145_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3771195_3771963_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3772158_3773067_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3773063_3774326_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3774322_3774961_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP009105	Escherichia coli strain RM9387 plasmid pO104_H7, complete sequence	168318	31739	82559	168318	integrase,bacteriocin,transposase	Stx2-converting_phage(39.13%)	44	31655:31714	70527:73058
31655:31714	attL	GTAAGCGTAAACTGACCGCCGTATGTAGCCATCAGACGAGAATTGGTAACTTAGACGCCC	NA	NA	NA	NA
WP_000422741.1|31739_32165_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|32161_32512_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_039264366.1|32542_34156_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	6.8e-182
WP_052214797.1|34232_34673_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	61.6	5.6e-46
WP_085947598.1|34685_35848_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_040116944.1|36257_37640_+	autoagglutinating adhesin Saa	NA	A0A2C9CZB7	Yersinia_phage	34.9	1.8e-05
WP_040116947.1|40301_42389_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	6.8e-09
WP_001212725.1|42649_43072_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_001373081.1|44122_44548_-	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	45.2	2.1e-26
WP_000912970.1|44564_45608_-	subtilase AB5 cytotoxin subunit A	NA	A0A1B0T6A2	Bacillus_phage	28.3	3.5e-06
WP_000435654.1|47001_47427_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_071531845.1|47731_47917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169124752.1|51344_51530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_180355324.1|51522_51675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421260.1|53818_54109_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178089.1|54108_54393_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001027503.1|55016_55208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159454916.1|55259_55454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040116951.1|56535_56913_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.2	6.1e-25
WP_040116952.1|58187_58604_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000688510.1|58596_59577_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_000030199.1|59983_60292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|60378_61023_-	ParA family protein	NA	NA	NA	NA	NA
WP_040116953.1|61204_62011_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.1e-55
WP_001159871.1|62011_62317_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_038355956.1|62318_62537_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000343085.1|63131_63389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194574.1|63388_63979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762580.1|64460_64808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283354.1|64825_66706_-	colicin	NA	NA	NA	NA	NA
WP_000448923.1|66984_67650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024199761.1|68378_70352_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000422741.1|70611_71037_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|71033_71384_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_039264366.1|71414_73028_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	6.8e-182
WP_039264366.1|74030_75644_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	6.8e-182
70527:73058	attR	GTAAGCGTAAACTGACCGCCGTATGTAGCCATCAGACGAGAATTGGTAACTTAGACGCCCATCTGATATAGACGGACATCTAAGTATGGAATTACAGGACTGGCGAAAAGAACCTCGTAAAAACTATTCGAATGAATTCAAACTTCGTATGGTGGAACTGGCATCACAACCTGGAGCTTGTGTTGCACAGATTGCACGTGAAAATGGCGTCAATGATAATGTTATTTTCAAATGGCTCAGGCTCTGGCAGAACGAAGGGCGTGTTTCGCGGCGTCTTCCGGTAACGACCTCTTCTGACACTGGCGTTGAATTATTACCTGTAGAAATAACGCCGGATGAGCAGAAAGAACCTGTGGCGGCCATTGCGCCGTCTTTATCCACTTCCACTCAGACCAGAGTCAGTGCCAGTTCCTGCAAGGTGGAATTCCGTCACGGTAACATGACGCTGGAAAATCCATCGCCAGAGCTGCTCACAGTGTTGATCCGTGAACTGACCGGGAGGGGAAGATGATCTCACTCCCATCAGGTACCCGTATCTGGCTCGTTGCCGGCGTTACCGATATGCGTAAATCCTTCAACGGACTGGGAGAACAGGTACAACATGTGCTGAATGATAATCCCTTCTCCGGTCACCTGTTTATCTTCCGTGGCCGACGGGGTGACACCGTCAAAATTCTTTGGGCTGATGCTGATGGTCTGTGCCTGTTCACCAAACGCCTGGAGGAAGGCCAGTTTATCTGGCCTGCGGTACGTGACGGCAAGGTATCCATTACCCGCTCGCAACTGGCAATGCTCCTCGATAAGCTGGACTGGCGTCAGCCAAAAACATCCAGCCGTAACTCACTGACAATGTTGTAAAAAACTCCTGACCGCATTATAAAAACGGTCATGAGTCAGAAATACCTCATTCGCATCGCAGAGCTGGAAAGGTTGCTCTCTGAGCAGGCTGAAGCCCTCCGTCAGAAAGACCAGCAACTGAGTCTGGTTGAAGAGACGGAAGCCTTCCTGCGCTCTGCACTGACACGTGCCGAAGAAAAGATCGAAGAAGATGAACGGGAAATAGAACATCTGCGGGCTCAGATAGAAAAACTGCGCCGGATGCTGTTCGGTACCCGTTCTGAAAAACTGCGTCGTGAAGTTGAACTGGCTGAGGCTCTGCTGAAACAACGTGAACAGGACAGCGATCGTTACAGTGGGCGGGAAGACGATCCTCAGGTTCCCCGCCAGTTGCGACAGTCGCGCCATCGTCGTCCGTTACCGGCACACCTTCCCCGTGAAATACACCGCCTGGAGCCAGAAGAAAGCTGTTGCCCGGAGTGTGGCGGTGAGCTGGATTATCTGGGGGAAGTCAGCGCTGAACAGCTGGAACTGGTGAGCAGTGCCCTGAAAGTGATCCGCACAGAACGGGTAAAAAAAGCCTGTACAAAATGTGACTGTATTGTTGAAGCACCGGCGCCGTCCCGCCCGATAGAGCGTGGTATCGCGGGCCCCGGATTACTTGCCCGCGTGTTAACGGGAAAATACTGCGAACATCTGCCACTGTATCGTCAGAGTGAAATCTTTGCCCGCCAGGGTGTCGAACTGACCCGGGCCTTACTCTCCAACTGGGTTGACGCGTGCTGCCAGTTAATGACACCGGTGAATGATGCCCTGTACCGTTATGTAATGAACACCCGCAAGGTTCACACTGATGACACACCGGTAAAGGTACTGGCACCGGGTCAGAAAAAGGCGAAAACAGGGCGTATCTGGACGTATGTCCGGGATGATCGCAATGTGGGTTCGTCATCTCCTCCAGCGGTCTGGTTCGCGTACTCGCCGAACCGGCAGGGGAAACACCCGGAGCAACACCTCCGCCCCTTCCGGGGTATCCTGCAGGCGGATGCGTTCACAGGTTACGACAGGTTGTTCAGTGCAGAACGTGAAGGTGGTACACTGACAGAAGTTGCGTGCTGGGCCCATGCCCGGCGAAAAATCCACGATGTATACATCAGCAGCAAAAGTGCGACGGCAGAAGAAGCCCTGAAGCGAATCAGTGAACTGTACGCCATCGAGGATGAAATACGGGGATTACCGGAGTCAGAGCGTCTTGCCGTCAGGCAGCAGCGAAGCAAAGTGTTACTGACGTCGCTGCATGAATGGATGGTGGAGAAGAATGGTACGCTGTCGAAAAAATCCAGACTGGGCGAAGCGTTCAGCTATGTACTGAATCAGTGGGATGCCCTCTGTTATTACAGTGATGACGGTCTGGCGGAGGCGGATAATAATGCTGCGGAAAGAGCGCTTCGTGCAGTCTGTCTCGGAAAGAAAAACTTTATGTTCTTTGGCAGCGATCACGGCGGCGAGCGTGGAGCACTGTTGTACGGGCTGATCGGCACCTGCCGTCTGAACGGTATCGATCCGGAAGCGTATCTGCGCCATATCCTGAGCGTACTGCCGGAATGGCCTTCCAACCGAGTTGACGAACTCCTGCCATGGAACGTAGTACTCACCAATAAATAAGCGTCAATACGGTGCTCCGTTGACGCTTAC	NA	NA	NA	NA
WP_000624722.1|75674_76025_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|76021_76447_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_040116954.1|76681_77332_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	43.6	8.0e-17
WP_000624622.1|77331_77679_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_040116955.1|77698_79270_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.9e-168
WP_040116956.1|79487_79724_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_032144652.1|79940_80258_+|bacteriocin	colicin V family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_123129447.1|80444_82559_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.7	2.1e-34
