The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009789	Escherichia coli K-12 strain K-12 ER3413 chromosome, complete genome	4558660	271162	320645	4558660	integrase,transposase	Acinetobacter_phage(28.57%)	41	273755:273769	300919:300933
WP_001254938.1|271162_272314_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
273755:273769	attL	ATGGCGATGGAGCCG	NA	NA	NA	NA
WP_010723085.1|274660_275677_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|275884_277288_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|277274_278207_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|278315_279362_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_001030800.1|280944_281295_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|281388_282543_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|282837_283746_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|283760_285728_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|285954_287337_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|287348_288959_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|288963_289722_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|289860_290865_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|292059_292791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|292881_293508_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|293779_294478_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|294504_295359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|295477_295702_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|295698_296139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|296255_297656_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|297940_298351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|298329_299286_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|299295_301494_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
300919:300933	attR	CGGCTCCATCGCCAT	NA	NA	NA	NA
WP_000643333.1|301490_302447_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|302443_303133_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|303550_304165_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|304412_304742_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|305054_305765_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_038432483.1|305733_307377_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|307366_309892_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716398.1|309917_310586_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|310643_311231_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|311305_311848_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|312671_312899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|312933_313074_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|313073_313337_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|313700_313802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|315850_317012_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001299021.1|318285_318879_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|318890_319127_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_006250222.1|319436_320645_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	3.0e-235
>prophage 2
NZ_CP009789	Escherichia coli K-12 strain K-12 ER3413 chromosome, complete genome	4558660	564268	576501	4558660	integrase,transposase	Enterobacteria_phage(53.33%)	20	564209:564255	582890:582936
564209:564255	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|564268_565432_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|565551_565815_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|566137_566233_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|566295_567457_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|567768_568101_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|568148_568298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|568355_569882_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|570346_570898_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|570907_571705_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|571821_571923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|571919_572375_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|572374_572545_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|572537_572828_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|572824_573187_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|573183_573324_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|573409_573793_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|574190_575207_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000079503.1|575239_575650_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|575935_576142_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|576306_576501_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
582890:582936	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP009789	Escherichia coli K-12 strain K-12 ER3413 chromosome, complete genome	4558660	1386993	1450939	4558660	lysis,tRNA,tail,transposase	Escherichia_phage(40.62%)	60	NA	NA
WP_000628058.1|1386993_1388226_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1388480_1389464_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1389941_1391315_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1391443_1392379_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1392430_1393666_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1393667_1393883_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1393961_1394171_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1394163_1394358_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1394414_1395224_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1395216_1397817_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1397918_1398194_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1398268_1398439_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1398438_1398660_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1399101_1399590_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1399586_1399742_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1400195_1400672_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1400795_1401092_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1401114_1401537_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1401549_1402407_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1402413_1403160_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1403182_1403743_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1403830_1404016_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1404212_1405670_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1405806_1406070_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1406050_1406410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1408175_1409156_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_071842875.1|1409478_1412841_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	6.2e-12
WP_001698950.1|1412840_1413416_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1413513_1414104_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1414420_1414654_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1414722_1414836_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1415614_1416049_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1416189_1417323_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|1417689_1421214_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1421487_1421754_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1421750_1422173_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1422283_1423273_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_046377550.1|1423480_1426060_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1426116_1426302_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1426309_1426636_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1426807_1427713_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1427948_1429448_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1429505_1431779_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1432026_1434072_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1434356_1435286_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1435297_1435585_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1435593_1436340_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1436354_1436852_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1436859_1437930_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1437926_1438694_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1438693_1439482_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1439483_1440911_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1440900_1441323_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1441322_1442528_+	bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1442554_1443868_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1443968_1444919_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1444900_1445491_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1445594_1445660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1448350_1449579_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254932.1|1449787_1450939_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 4
NZ_CP009789	Escherichia coli K-12 strain K-12 ER3413 chromosome, complete genome	4558660	1609881	1654548	4558660	lysis,protease,tail,transposase	Enterobacteria_phage(30.0%)	59	NA	NA
WP_000527743.1|1609881_1611342_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_120795384.1|1613318_1613432_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836770.1|1613500_1613734_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_000078177.1|1614050_1614641_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1614738_1615314_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1615313_1616276_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1616226_1616796_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1617184_1617418_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_006250222.1|1617461_1618670_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	3.0e-235
WP_000373090.1|1618813_1619224_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1619375_1619549_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1619720_1619876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1619954_1620020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1620022_1620211_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1620221_1620434_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1620796_1621294_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1621290_1621824_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1621820_1622132_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1622136_1622352_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1623105_1623321_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1623621_1623834_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1623888_1623978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1624255_1625008_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1625021_1626071_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1626072_1626351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1626417_1626669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1626885_1627041_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1627112_1627400_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1627399_1627639_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1627663_1627969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1628171_1628504_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1628940_1629090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1629386_1629617_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1629700_1630108_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1630274_1630430_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_038432574.1|1630589_1630808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1631375_1631564_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_038432577.1|1631560_1631752_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001360138.1|1634494_1634605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1634662_1635682_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1635693_1636908_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1637113_1637440_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1637574_1637916_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1637950_1638511_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1638513_1639224_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1639331_1639637_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1639835_1642262_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1642322_1644746_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1644756_1645374_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1645375_1646230_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1646272_1646887_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|1647045_1648338_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1648290_1648986_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|1649110_1650331_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|1650465_1651359_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1651465_1652719_+	MFS transporter	NA	NA	NA	NA	NA
WP_038432580.1|1653115_1653451_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|1653543_1653627_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|1653726_1654548_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP009789	Escherichia coli K-12 strain K-12 ER3413 chromosome, complete genome	4558660	2456183	2467394	4558660	tail,integrase	Enterobacteria_phage(53.33%)	16	2454158:2454174	2471069:2471085
2454158:2454174	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2456183_2457116_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2457427_2458585_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2458737_2459100_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2459096_2460017_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2460013_2461345_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2461379_2461661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2461959_2462400_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2462426_2462945_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2462994_2463270_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2463269_2463764_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2464487_2464850_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2464915_2465740_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2465867_2466404_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2466394_2466757_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2466756_2467062_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2467193_2467394_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2471069:2471085	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP009789	Escherichia coli K-12 strain K-12 ER3413 chromosome, complete genome	4558660	2841185	2848324	4558660		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2841185_2843747_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2843852_2844509_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2844559_2845327_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2845522_2846431_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2846427_2847594_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2847685_2848324_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
