The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	0	2050	3153266		Clostridioides_phage(100.0%)	2	NA	NA
WP_039310459.1|891_1683_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_039310463.1|1714_2050_-	hypothetical protein	NA	A0A1V0E003	Clostridioides_phage	42.2	1.5e-11
>prophage 2
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	5985	6945	3153266		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_039310475.1|5985_6945_-	D-2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	27.0	2.6e-27
>prophage 3
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	11155	15032	3153266		Bacillus_phage(50.0%)	4	NA	NA
WP_039310489.1|11155_12367_+	hypothetical protein	NA	S6BUU4	Bacillus_phage	53.1	4.7e-18
WP_039310491.1|12591_13257_-	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_039310493.1|13375_14272_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_080753087.1|14285_15032_-	ERF family protein	NA	A0A0A7RVW0	Clostridium_phage	44.8	3.5e-32
>prophage 4
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	20874	28931	3153266	coat	Vibrio_phage(66.67%)	5	NA	NA
WP_039310515.1|20874_22005_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.5	3.5e-36
WP_039310516.1|22011_23784_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	32.2	1.1e-55
WP_039310518.1|23987_25019_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_039310520.1|25191_26262_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_039310522.1|26303_28931_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	40.5	3.8e-89
>prophage 5
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	37678	38128	3153266		Xanthomonas_phage(100.0%)	1	NA	NA
WP_039310550.1|37678_38128_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	9.5e-17
>prophage 6
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	42026	45137	3153266		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_039310572.1|42026_43172_-	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	34.8	7.0e-24
WP_039310574.1|43280_45137_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.1	1.3e-139
>prophage 7
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	48854	50660	3153266		Streptococcus_phage(100.0%)	1	NA	NA
WP_039316500.1|48854_50660_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.0	4.7e-22
>prophage 8
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	60648	61407	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039310608.1|60648_61407_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	42.9	3.4e-43
>prophage 9
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	65600	73902	3153266		Morganella_phage(33.33%)	8	NA	NA
WP_039310620.1|65600_66647_-	DNA polymerase IV	NA	A0A1W6JNT0	Morganella_phage	24.5	7.1e-15
WP_039310623.1|66664_67633_-	DUF4003 family protein	NA	NA	NA	NA	NA
WP_039310624.1|67907_68321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039310627.1|68355_68646_-	Dabb family protein	NA	NA	NA	NA	NA
WP_039310628.1|68720_71276_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	31.8	6.7e-91
WP_039310630.1|71426_73067_+	putative manganese-dependent inorganic diphosphatase	NA	NA	NA	NA	NA
WP_039310632.1|73107_73509_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_039310634.1|73527_73902_-	response regulator	NA	B5LWA6	Feldmannia_species_virus	29.8	1.8e-05
>prophage 10
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	90827	92063	3153266		Enterobacteria_phage(100.0%)	1	NA	NA
WP_039310678.1|90827_92063_-	PocR ligand-binding domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	30.6	3.9e-20
>prophage 11
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	97211	104443	3153266		Bacillus_virus(66.67%)	4	NA	NA
WP_039310686.1|97211_98978_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.0	1.3e-72
WP_039310689.1|98996_99542_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_039310691.1|99558_102468_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	30.3	1.9e-89
WP_039310694.1|102493_104443_-	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	41.0	6.4e-118
>prophage 12
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	111556	112798	3153266		Klosneuvirus(100.0%)	1	NA	NA
WP_039310709.1|111556_112798_+	UV DNA damage repair endonuclease UvsE	NA	A0A1V0SKW1	Klosneuvirus	32.3	7.8e-37
>prophage 13
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	118047	118722	3153266		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_039310724.1|118047_118722_+	metal ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.8	9.9e-18
>prophage 14
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	126045	138987	3153266	tRNA	Bacillus_virus(33.33%)	12	NA	NA
WP_039310757.1|126045_127977_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.6e-52
WP_039310760.1|128019_128460_-	dUTP diphosphatase	NA	A0A1L2BX65	Bacteriophage	47.4	1.2e-32
WP_052139316.1|128567_128942_-	prealbumin-like fold domain-containing protein	NA	NA	NA	NA	NA
WP_052139318.1|129003_131244_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.9	2.5e-17
WP_039310763.1|131389_132661_-	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	34.2	5.2e-52
WP_039310765.1|132985_133705_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_052139320.1|133758_135120_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	31.6	1.8e-18
WP_039310768.1|135390_135579_-	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_039310771.1|135600_136356_-	carbohydrate deacetylase	NA	NA	NA	NA	NA
WP_052139322.1|136441_137008_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_039310773.1|137215_138079_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_039310776.1|138120_138987_-|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	34.4	1.7e-30
>prophage 15
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	152785	153427	3153266		Aureococcus_anophage(100.0%)	1	NA	NA
WP_039310814.1|152785_153427_+	undecaprenyl diphosphate synthase family protein	NA	A0A076FI83	Aureococcus_anophage	28.0	2.9e-11
>prophage 16
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	161103	162537	3153266		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_039310833.1|161103_162537_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.1	1.9e-58
>prophage 17
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	170528	181339	3153266		Tupanvirus(33.33%)	9	NA	NA
WP_039310854.1|170528_171428_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	6.7e-22
WP_039310856.1|171473_172127_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.8e-06
WP_144316886.1|172104_173982_-	PAS domain-containing protein	NA	A0A2K9L0Z8	Tupanvirus	26.7	1.1e-18
WP_039310859.1|174212_174770_+	response regulator	NA	A0A2K9L1Q0	Tupanvirus	30.1	4.6e-05
WP_039310861.1|174790_175921_+	universal stress protein	NA	NA	NA	NA	NA
WP_039310864.1|175968_176565_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_039310867.1|176581_178627_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	25.5	4.4e-37
WP_039310869.1|178648_180304_-	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_039310871.1|180535_181339_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	32.5	1.9e-15
>prophage 18
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	190706	191705	3153266		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_039310894.1|190706_191705_-	lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	36.0	8.2e-45
>prophage 19
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	206711	208043	3153266		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_039310928.1|206711_208043_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.4	3.0e-10
>prophage 20
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	213909	218854	3153266		Streptococcus_phage(50.0%)	4	NA	NA
WP_039310941.1|213909_215559_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	33.1	6.5e-55
WP_039310943.1|215649_216789_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039310945.1|216785_217904_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039310947.1|217918_218854_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	1.5e-27
>prophage 21
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	223073	226590	3153266		Bacillus_phage(100.0%)	2	NA	NA
WP_039310956.1|223073_224864_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	5.4e-55
WP_039310959.1|224856_226590_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	9.6e-49
>prophage 22
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	236863	237958	3153266		Mycoplasma_phage(100.0%)	1	NA	NA
WP_039310982.1|236863_237958_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	32.7	1.3e-22
>prophage 23
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	251815	252346	3153266		Cyanophage(100.0%)	1	NA	NA
WP_039311013.1|251815_252346_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	C7F482	Cyanophage	28.8	5.9e-10
>prophage 24
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	268426	275440	3153266		Planktothrix_phage(66.67%)	5	NA	NA
WP_052139335.1|268426_269902_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	7.7e-108
WP_039311057.1|270044_271862_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039311060.1|271875_272637_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	7.2e-33
WP_039311062.1|272840_274694_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039311065.1|274693_275440_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	1.6e-29
>prophage 25
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	281708	286886	3153266		Tupanvirus(25.0%)	6	NA	NA
WP_039311080.1|281708_283169_-	catalase	NA	A0A2K9L572	Tupanvirus	36.6	5.9e-92
WP_052139337.1|283208_283991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311083.1|284085_284631_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	31.2	3.7e-15
WP_039311085.1|284746_285679_-	3'-5' exoribonuclease	NA	B5WZL1	Staphylococcus_phage	28.3	8.0e-26
WP_039311087.1|285719_286340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311089.1|286382_286886_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	29.3	9.3e-13
>prophage 26
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	315015	315426	3153266		Caulobacter_virus(100.0%)	1	NA	NA
WP_039311147.1|315015_315426_+	LAGLIDADG family homing endonuclease	NA	K4JS33	Caulobacter_virus	35.2	4.6e-10
>prophage 27
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	326132	335216	3153266		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_052139344.1|326132_328307_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	42.7	2.6e-27
WP_039311160.1|328531_329083_-	tryptophan transporter	NA	NA	NA	NA	NA
WP_039311161.1|329532_331410_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	29.4	1.1e-13
WP_039311162.1|331511_332402_-	EamA family transporter	NA	NA	NA	NA	NA
WP_039311165.1|332608_333775_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_039311167.1|333815_335216_-	NADPH-dependent glutamate synthase	NA	A0A249XZT7	Enterococcus_phage	26.4	3.3e-07
>prophage 28
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	338420	345401	3153266		Staphylococcus_phage(33.33%)	5	NA	NA
WP_039311172.1|338420_338891_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	60.9	6.0e-46
WP_039311174.1|339022_341254_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	2.4e-76
WP_039311175.1|341526_343542_-	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_039311177.1|343752_343983_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_039311178.1|344105_345401_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	63.1	1.4e-150
>prophage 29
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	364009	364852	3153266		Staphylococcus_phage(100.0%)	1	NA	NA
WP_039311195.1|364009_364852_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.9	1.3e-14
>prophage 30
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	370280	372498	3153266		Bacillus_phage(100.0%)	2	NA	NA
WP_039316568.1|370280_371777_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	5.8e-26
WP_039311201.1|371796_372498_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-39
>prophage 31
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	375977	383914	3153266	tRNA	Aeropyrum_pernix_spindle-shaped_virus(25.0%)	8	NA	NA
WP_039311205.1|375977_376613_-	endonuclease III	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	26.7	3.0e-16
WP_039311208.1|376763_377468_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_039311209.1|377725_378718_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_039311210.1|378743_379325_-	serine O-acetyltransferase	NA	A0A191KBJ5	Streptococcus_virus	41.7	2.2e-10
WP_039311211.1|379340_380246_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	52.5	5.5e-80
WP_039311212.1|380766_382026_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_039311213.1|382330_382975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311214.1|383032_383914_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.5	3.2e-16
>prophage 32
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	388710	395192	3153266		Thermus_phage(50.0%)	4	NA	NA
WP_039311221.1|388710_390633_-	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	33.8	1.7e-83
WP_039311222.1|390776_391757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311223.1|391980_393399_+	L,D-transpeptidase/peptidoglycan binding protein	NA	NA	NA	NA	NA
WP_039311224.1|393419_395192_-	DNA helicase RecQ	NA	A0A167RIL2	Powai_lake_megavirus	38.0	1.8e-82
>prophage 33
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	421318	423416	3153266		Klosneuvirus(50.0%)	2	NA	NA
WP_144316887.1|421318_422476_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.2e-25
WP_039311253.1|422495_423416_+	ornithine carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	32.7	1.2e-29
>prophage 34
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	430701	436950	3153266		Herpes_simplex_virus(100.0%)	1	NA	NA
WP_052139363.1|430701_436950_-	Ig-like domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	25.2	7.2e-22
>prophage 35
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	442466	443480	3153266		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_039311261.1|442466_443480_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	30.8	5.1e-18
>prophage 36
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	446486	450957	3153266		Pandoravirus(50.0%)	4	NA	NA
WP_039311266.1|446486_447569_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	38.7	3.0e-61
WP_039311267.1|447546_448833_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_039311268.1|448848_449901_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_039311269.1|449943_450957_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	29.6	8.4e-21
>prophage 37
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	457273	458935	3153266		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_039311274.1|457273_458935_-	hypothetical protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	30.3	7.1e-17
>prophage 38
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	472517	478858	3153266		Microcystis_phage(50.0%)	5	NA	NA
WP_039311286.1|472517_473990_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.6	9.3e-45
WP_039311287.1|474249_474708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039316583.1|474938_475988_-	galactose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039311288.1|476015_476993_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080753024.1|476989_478858_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.8	5.7e-23
>prophage 39
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	483034	488129	3153266		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_039311293.1|483034_484534_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	2.8e-12
WP_039311294.1|484638_485679_-	galactose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039311295.1|485943_487128_+	galactokinase	NA	NA	NA	NA	NA
WP_039311296.1|487139_488129_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.4	9.9e-59
>prophage 40
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	501201	506340	3153266	tRNA	Mycobacterium_phage(33.33%)	3	NA	NA
WP_039311308.1|501201_502356_-	C40 family peptidase	NA	A0A1C9EHF6	Mycobacterium_phage	45.0	1.7e-14
WP_039311309.1|502684_503323_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	36.2	1.9e-23
WP_039311310.1|503892_506340_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	48.5	8.6e-213
>prophage 41
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	510903	513348	3153266		Bacillus_phage(100.0%)	2	NA	NA
WP_039311316.1|510903_512244_-	hypothetical protein	NA	A0A223LDP1	Bacillus_phage	29.9	1.2e-46
WP_039311317.1|512268_513348_-	AAA family ATPase	NA	A0A141HRX4	Bacillus_phage	33.8	4.4e-44
>prophage 42
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	516855	520055	3153266	tRNA	Cronobacter_phage(50.0%)	3	NA	NA
WP_039311321.1|516855_518082_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	35.4	2.0e-61
WP_039311322.1|518478_518886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311323.1|518981_520055_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.7	3.0e-16
>prophage 43
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	525138	526017	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039311332.1|525138_526017_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	56.8	2.5e-85
>prophage 44
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	532359	537852	3153266		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_039311339.1|532359_535014_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	26.9	3.6e-47
WP_039311343.1|536442_537852_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	31.7	2.0e-60
>prophage 45
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	542607	543426	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_039311353.1|542607_543426_-	transketolase	NA	A0A2K9L6P9	Tupanvirus	33.7	8.5e-32
>prophage 46
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	550586	554090	3153266		Bacillus_phage(50.0%)	3	NA	NA
WP_039311362.1|550586_551474_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.6	6.8e-83
WP_039311364.1|551502_553017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139387.1|553082_554090_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.8	3.3e-09
>prophage 47
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	569156	570449	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039311394.1|569156_570449_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	1.4e-89
>prophage 48
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	574860	576732	3153266		Moumouvirus(100.0%)	1	NA	NA
WP_039311406.1|574860_576732_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	30.0	1.6e-25
>prophage 49
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	583893	585231	3153266		Clostridium_phage(100.0%)	1	NA	NA
WP_039311419.1|583893_585231_-	sensor histidine kinase	NA	X5JAC0	Clostridium_phage	23.8	9.7e-09
>prophage 50
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	589557	594188	3153266		Catovirus(50.0%)	3	NA	NA
WP_172678927.1|589557_590679_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	29.8	5.8e-31
WP_039311428.1|590719_592534_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_039311430.1|592589_594188_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	27.0	7.0e-14
>prophage 51
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	612053	613580	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_039311456.1|612053_613580_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	29.9	6.0e-47
>prophage 52
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	634844	636598	3153266		Klosneuvirus(50.0%)	2	NA	NA
WP_052139395.1|634844_635927_-	HAMP domain-containing histidine kinase	NA	A0A1V0SKH0	Klosneuvirus	27.0	5.1e-08
WP_039311479.1|635926_636598_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.9	6.6e-30
>prophage 53
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	645446	646169	3153266		Planktothrix_phage(100.0%)	1	NA	NA
WP_039311493.1|645446_646169_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-32
>prophage 54
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	651321	653370	3153266	protease	Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_039311503.1|651321_653370_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	43.8	3.9e-110
>prophage 55
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	664934	668074	3153266		Bacillus_phage(100.0%)	3	NA	NA
WP_052139399.1|664934_666368_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.2	3.4e-07
WP_039311535.1|666354_667392_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_039316617.1|667366_668074_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	4.6e-34
>prophage 56
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	680137	682316	3153266		Clostridium_phage(50.0%)	3	NA	NA
WP_039311550.1|680137_680869_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7RVQ3	Clostridium_phage	40.0	2.4e-25
WP_039311552.1|681041_681326_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_039311553.1|681341_682316_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	43.9	1.3e-66
>prophage 57
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	686985	689649	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_080753089.1|686985_689649_+	DUF5011 domain-containing protein	NA	A0A2K9L3D4	Tupanvirus	31.4	2.5e-40
>prophage 58
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	693840	697053	3153266		Planktothrix_phage(100.0%)	3	NA	NA
WP_039311568.1|693840_694608_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.7e-37
WP_039311570.1|694895_696311_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_039311572.1|696366_697053_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.9e-30
>prophage 59
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	700151	700910	3153266		Indivirus(100.0%)	1	NA	NA
WP_039311578.1|700151_700910_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.5	6.7e-15
>prophage 60
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	717214	722436	3153266		Chrysodeixis_includens_nucleopolyhedrovirus(50.0%)	5	NA	NA
WP_080753034.1|717214_719428_+	DUF5011 domain-containing protein	NA	A0A1C8ZY86	Chrysodeixis_includens_nucleopolyhedrovirus	26.8	6.5e-34
WP_039311602.1|719696_720362_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_039311604.1|720386_721319_+	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_039311605.1|721396_722038_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_039311607.1|722031_722436_+	gamma-glutamylcyclotransferase	NA	A0A218KCI8	Bacillus_phage	36.4	1.7e-09
>prophage 61
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	732686	738955	3153266		Indivirus(33.33%)	4	NA	NA
WP_039311620.1|732686_733340_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	34.4	1.3e-22
WP_039311622.1|733342_734101_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_039311624.1|734204_736067_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	25.1	3.0e-16
WP_039311626.1|736255_738955_-	magnesium-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	26.1	1.5e-53
>prophage 62
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	743205	749437	3153266		Bacillus_phage(66.67%)	5	NA	NA
WP_039311634.1|743205_744186_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	38.4	1.6e-29
WP_039311636.1|744202_745231_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039311638.1|745432_745813_-	VOC family protein	NA	NA	NA	NA	NA
WP_039311640.1|745919_747692_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	2.3e-50
WP_039311642.1|747694_749437_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	1.1e-47
>prophage 63
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	753430	755268	3153266	transposase	Lactococcus_phage(50.0%)	3	NA	NA
WP_039311648.1|753430_753886_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.1	1.1e-17
WP_039311650.1|754100_754634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311652.1|755025_755268_-	AbrB family transcriptional regulator	NA	A0A0K2CZ86	Paenibacillus_phage	43.6	3.4e-13
>prophage 64
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	762990	776410	3153266	transposase	Clostridium_botulinum_C_phage(50.0%)	6	NA	NA
WP_039311668.1|762990_766479_+	non-toxic nonhemagglutinin NTNH	NA	Q332E1	Clostridium_botulinum_C_phage	54.3	0.0e+00
WP_039311670.1|766492_770299_+	botulinum neurotoxin type F	NA	Q332E0	Clostridium_botulinum_C_phage	33.3	1.0e-175
WP_039311673.1|770525_772010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139413.1|772887_774159_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	45.1	4.8e-98
WP_039316645.1|774257_775205_-	ROK family protein	NA	NA	NA	NA	NA
WP_039311675.1|775300_776410_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	4.4e-23
>prophage 65
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	789990	791721	3153266		Enterobacteria_phage(100.0%)	1	NA	NA
WP_039311692.1|789990_791721_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.6	3.9e-18
>prophage 66
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	805530	809669	3153266		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_039311711.1|805530_807408_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	32.6	1.9e-87
WP_039311713.1|807622_808291_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.3e-33
WP_039316649.1|808292_809669_+	HAMP domain-containing histidine kinase	NA	A0A2K9L5I4	Tupanvirus	26.3	4.3e-12
>prophage 67
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	818521	822645	3153266		Anomala_cuprea_entomopoxvirus(100.0%)	5	NA	NA
WP_039311730.1|818521_819412_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.5	7.4e-29
WP_039311735.1|819583_819976_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_052139415.1|820070_820400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311737.1|820488_821832_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_039311739.1|821862_822645_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.8	6.3e-16
>prophage 68
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	828102	828834	3153266		Clostridioides_phage(100.0%)	1	NA	NA
WP_039311748.1|828102_828834_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	31.1	1.5e-11
>prophage 69
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	837034	838405	3153266		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_039311773.1|837034_838405_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.5	5.5e-100
>prophage 70
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	843738	853131	3153266		Streptococcus_phage(40.0%)	6	NA	NA
WP_039311783.1|843738_847314_-	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	36.6	9.0e-211
WP_039311785.1|847349_848300_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.9	9.2e-46
WP_039311787.1|848494_849568_+	VanZ family protein	NA	NA	NA	NA	NA
WP_039311796.1|849618_850989_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	34.2	1.1e-44
WP_039311798.1|850985_851864_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	27.1	2.6e-10
WP_039311805.1|852027_853131_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.6	4.0e-24
>prophage 71
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	860057	862883	3153266		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_039311821.1|860057_862883_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	1.5e-309
>prophage 72
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	868181	878659	3153266		Bacillus_virus(40.0%)	10	NA	NA
WP_039311831.1|868181_868871_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	5.0e-17
WP_039311833.1|869187_871167_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_039316653.1|871275_872508_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.0	4.7e-26
WP_039316655.1|872672_873563_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039311836.1|873552_874239_-	cell division ATP-binding protein FtsE	NA	G3M9Y6	Bacillus_virus	27.8	3.1e-19
WP_039311838.1|874397_875252_-	YitT family protein	NA	NA	NA	NA	NA
WP_039311840.1|875311_876157_-	YitT family protein	NA	NA	NA	NA	NA
WP_039311844.1|876273_877218_-	transketolase family protein	NA	NA	NA	NA	NA
WP_039311846.1|877219_878044_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	30.6	8.1e-14
WP_171991927.1|878314_878659_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5RCS0	Lactobacillus_phage	37.7	8.9e-15
>prophage 73
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	882968	884419	3153266		Lactococcus_phage(50.0%)	2	NA	NA
WP_039311856.1|882968_883319_-	single-stranded DNA-binding protein	NA	Q0ILF5	Lactococcus_phage	43.0	4.9e-21
WP_039311858.1|883432_884419_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	40.5	7.8e-56
>prophage 74
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	890157	896905	3153266	tRNA	Streptococcus_phage(50.0%)	7	NA	NA
WP_039311870.1|890157_890397_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	60.3	2.2e-20
WP_039311872.1|890507_891353_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.7	2.2e-54
WP_039311876.1|891345_892116_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_039311879.1|892251_893553_-	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	50.5	1.2e-24
WP_039311881.1|894270_894558_-	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_039311883.1|894624_895284_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_039311887.1|895309_896905_-	acetaldehyde dehydrogenase (acetylating)	NA	A0A1X9I5D4	Streptococcus_phage	27.7	4.9e-07
>prophage 75
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	901265	902219	3153266	holin	Tetraselmis_virus(100.0%)	1	NA	NA
WP_039311906.1|901265_902219_-|holin	choline TMA-lyase-activating enzyme	holin	A0A2P0VNQ0	Tetraselmis_virus	28.3	2.5e-14
>prophage 76
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	920070	927164	3153266	protease	Pandoravirus(33.33%)	10	NA	NA
WP_039311926.1|920070_920748_+	uracil-DNA glycosylase	NA	S4VYQ4	Pandoravirus	43.6	1.5e-45
WP_039311928.1|920841_921042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311931.1|921113_921311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311934.1|921451_922060_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_144316891.1|922397_922928_-	flavodoxin	NA	NA	NA	NA	NA
WP_039311936.1|923259_923439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039311938.1|923556_924288_+	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	31.4	9.0e-33
WP_039311941.1|924343_924784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039311944.1|924824_925766_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_039316671.1|925934_927164_-	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	39.4	6.8e-17
>prophage 77
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	933380	937253	3153266		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_039311957.1|933380_934106_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	34.0	1.5e-24
WP_039311959.1|934154_934826_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	46.7	1.8e-19
WP_039311961.1|935154_936162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139427.1|936176_937253_-	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	29.9	4.2e-10
>prophage 78
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	955054	955954	3153266		Catovirus(100.0%)	1	NA	NA
WP_039311976.1|955054_955954_-	patatin-like phospholipase family protein	NA	A0A1V0SCG0	Catovirus	28.7	6.5e-09
>prophage 79
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	971698	977123	3153266		Iris_mild_mosaic_virus(50.0%)	3	NA	NA
WP_039311994.1|971698_974134_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	44.0	1.5e-07
WP_039311997.1|974166_975600_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_052139434.1|975842_977123_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.1	1.8e-28
>prophage 80
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	985123	987541	3153266		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_039312001.1|985123_987541_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	37.9	1.3e-08
>prophage 81
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1019543	1020449	3153266		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_039312057.1|1019543_1020449_-	D-2-hydroxyacid dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	32.0	5.2e-30
>prophage 82
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1033336	1034251	3153266		Staphylococcus_phage(100.0%)	1	NA	NA
WP_039312071.1|1033336_1034251_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.2	4.7e-39
>prophage 83
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1038195	1044062	3153266		Pneumococcus_phage(25.0%)	6	NA	NA
WP_039312081.1|1038195_1039836_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	38.7	1.3e-55
WP_039312083.1|1040071_1040689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039312085.1|1040795_1041587_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	42.9	2.1e-59
WP_039312087.1|1041586_1042078_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.5	3.1e-29
WP_039312089.1|1042810_1043590_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_039312091.1|1043582_1044062_-	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	30.8	5.9e-09
>prophage 84
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1048162	1049125	3153266		Salmonella_phage(100.0%)	1	NA	NA
WP_039312102.1|1048162_1049125_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.0	9.7e-51
>prophage 85
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1053111	1055478	3153266		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_039312111.1|1053111_1055478_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.5	3.8e-40
>prophage 86
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1059863	1060589	3153266	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_039316698.1|1059863_1060589_+|tRNA	tRNA 2-thiocytidine biosynthesis protein TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	38.0	8.6e-36
>prophage 87
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1066031	1071216	3153266		Bacillus_phage(40.0%)	5	NA	NA
WP_039312127.1|1066031_1066952_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	47.1	8.4e-44
WP_039312129.1|1067055_1068009_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	8.4e-23
WP_039312131.1|1068011_1068710_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	6.4e-36
WP_039312133.1|1068871_1069378_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	37.6	7.9e-12
WP_039312135.1|1069815_1071216_-	FAD-binding protein	NA	A0A218MMS0	uncultured_virus	24.3	2.5e-23
>prophage 88
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1076233	1076620	3153266		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_039312145.1|1076233_1076620_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	33.3	2.0e-07
>prophage 89
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1122756	1123416	3153266		Planktothrix_phage(100.0%)	1	NA	NA
WP_039316709.1|1122756_1123416_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.4	3.7e-25
>prophage 90
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1140582	1141374	3153266		Paenibacillus_phage(100.0%)	1	NA	NA
WP_039312243.1|1140582_1141374_-	MBL fold metallo-hydrolase	NA	A0A0B5A2C7	Paenibacillus_phage	39.7	7.4e-41
>prophage 91
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1147032	1150384	3153266		Microcystis_virus(33.33%)	3	NA	NA
WP_052139448.1|1147032_1148223_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	61.8	6.2e-31
WP_039312257.1|1148406_1149411_+	DnaD domain protein	NA	A0A1L2BY83	Clostridium_phage	79.3	4.9e-05
WP_039312258.1|1149403_1150384_+	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	26.0	6.9e-12
>prophage 92
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1155025	1164165	3153266	protease	Staphylococcus_phage(20.0%)	8	NA	NA
WP_039312264.1|1155025_1156267_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	37.8	4.8e-10
WP_039312266.1|1156299_1157055_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_039312268.1|1157152_1157677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039312271.1|1157818_1158010_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_039312273.1|1158105_1159392_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.5	2.3e-76
WP_039312275.1|1159920_1160721_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.1	9.9e-33
WP_039312278.1|1160807_1162145_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	45.7	1.1e-105
WP_039312280.1|1162272_1164165_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	25.6	8.3e-22
>prophage 93
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1167321	1175426	3153266	protease	Clostridium_phage(33.33%)	12	NA	NA
WP_039312289.1|1167321_1167756_-	single-stranded DNA-binding protein	NA	Q8SBL5	Clostridium_phage	60.0	1.7e-31
WP_039312291.1|1167772_1168060_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_039312293.1|1168161_1168356_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_039312295.1|1168369_1169257_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_039312296.1|1169279_1169516_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_039312298.1|1169679_1170306_+	LysE family transporter	NA	NA	NA	NA	NA
WP_039312300.1|1170318_1171473_+	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	31.1	1.6e-47
WP_039312302.1|1171529_1172111_+|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	36.6	5.3e-20
WP_039312303.1|1172225_1172726_-	DUF4446 family protein	NA	NA	NA	NA	NA
WP_039312305.1|1172771_1173656_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.1	5.6e-13
WP_039312307.1|1173652_1174435_-	ParA family protein	NA	Q8JL10	Natrialba_phage	29.8	1.3e-21
WP_039312310.1|1174643_1175426_-	nucleoid occlusion protein	NA	S5WII0	Leptospira_phage	35.1	2.2e-16
>prophage 94
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1187050	1191533	3153266		Bacillus_virus(50.0%)	2	NA	NA
WP_173406287.1|1187050_1188961_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.2	6.0e-153
WP_039312335.1|1188983_1191533_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	34.4	6.8e-120
>prophage 95
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1200264	1202466	3153266	tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_039312344.1|1200264_1201539_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.3	2.4e-89
WP_039312346.1|1201758_1202466_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	33.1	3.0e-25
>prophage 96
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1210535	1214249	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039312354.1|1210535_1214249_+	helicase-exonuclease AddAB subunit AddA	NA	S5M596	Bacillus_phage	24.8	1.7e-18
>prophage 97
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1218256	1219603	3153266	tRNA	unidentified_phage(100.0%)	1	NA	NA
WP_039312360.1|1218256_1219603_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	40.4	6.4e-77
>prophage 98
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1223147	1231351	3153266		Bacillus_virus(25.0%)	6	NA	NA
WP_039312364.1|1223147_1226270_+	AAA family ATPase	NA	G3MAB6	Bacillus_virus	25.8	1.7e-11
WP_039312367.1|1226301_1226916_-	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_039312370.1|1226987_1227860_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.0	2.9e-14
WP_039312372.1|1228080_1228932_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.6	6.6e-27
WP_039312374.1|1229337_1230153_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039312376.1|1230166_1231351_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	5.8e-13
>prophage 99
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1238247	1239156	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_039312389.1|1238247_1239156_-	phosphatidylserine decarboxylase	NA	A0A2K9L169	Tupanvirus	29.1	6.6e-17
>prophage 100
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1248539	1250129	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_039312401.1|1248539_1250129_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	25.8	4.1e-54
>prophage 101
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1265066	1267131	3153266		Streptococcus_phage(100.0%)	2	NA	NA
WP_039312426.1|1265066_1265885_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.0	2.5e-47
WP_039312428.1|1265886_1267131_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.5	1.7e-108
>prophage 102
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1272125	1276917	3153266	holin	Bacillus_virus(33.33%)	4	NA	NA
WP_039312439.1|1272125_1273262_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.5	2.3e-27
WP_039312441.1|1273476_1274655_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039312443.1|1274647_1275379_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.4	5.3e-09
WP_039312445.1|1275867_1276917_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.1	4.9e-64
>prophage 103
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1288488	1293794	3153266		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_039312460.1|1288488_1289013_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	43.0	1.1e-21
WP_039312462.1|1289037_1289406_+	DUF3783 domain-containing protein	NA	NA	NA	NA	NA
WP_039312464.1|1289408_1290086_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039312466.1|1290191_1293794_+	S8 family serine peptidase	NA	A0A2K9L199	Tupanvirus	44.3	3.5e-05
>prophage 104
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1297499	1298426	3153266		Staphylococcus_phage(100.0%)	1	NA	NA
WP_039312473.1|1297499_1298426_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	45.7	5.5e-35
>prophage 105
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1304109	1307220	3153266	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_039312488.1|1304109_1307220_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	34.4	4.6e-187
>prophage 106
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1313534	1314260	3153266		Bacillus_virus(100.0%)	1	NA	NA
WP_039312502.1|1313534_1314260_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.5	2.4e-14
>prophage 107
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1318130	1318892	3153266		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_039312508.1|1318130_1318892_+	ABC transporter ATP-binding protein	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	30.9	2.7e-11
>prophage 108
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1325022	1334979	3153266	tRNA	Acinetobacter_phage(25.0%)	8	NA	NA
WP_039312518.1|1325022_1326798_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	42.9	1.1e-137
WP_039312521.1|1326842_1327376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039312523.1|1327505_1328000_-	FUSC family protein	NA	NA	NA	NA	NA
WP_039312525.1|1328504_1330448_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	31.9	3.4e-95
WP_039312527.1|1330542_1331904_+|tRNA	class I tRNA ligase family protein	tRNA	A0A2P1EMD9	Moumouvirus	28.4	3.1e-26
WP_039312529.1|1332104_1332782_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_039312531.1|1332879_1333665_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_039312533.1|1333917_1334979_+	3D domain-containing protein	NA	A0A0K2CZX2	Bacillus_phage	56.4	1.6e-17
>prophage 109
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1343980	1346098	3153266		Clostridium_phage(100.0%)	1	NA	NA
WP_039312553.1|1343980_1346098_+	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	37.2	3.4e-125
>prophage 110
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1350234	1352277	3153266		Clostridioides_phage(50.0%)	2	NA	NA
WP_039312560.1|1350234_1350753_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A2R2ZH61	Clostridioides_phage	38.0	8.9e-27
WP_039312562.1|1350789_1352277_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.0	1.2e-44
>prophage 111
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1355589	1358880	3153266	tRNA	Streptococcus_phage(50.0%)	3	NA	NA
WP_039312570.1|1355589_1356711_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.8	9.6e-42
WP_039312572.1|1356877_1357444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039312574.1|1357485_1358880_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	37.6	2.7e-86
>prophage 112
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1364633	1365452	3153266		Singapore_grouper_iridovirus(100.0%)	1	NA	NA
WP_039312584.1|1364633_1365452_-	purine-nucleoside phosphorylase	NA	Q5YFI9	Singapore_grouper_iridovirus	42.9	6.1e-62
>prophage 113
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1369307	1374006	3153266		Bacillus_phage(50.0%)	4	NA	NA
WP_039312594.1|1369307_1370678_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	39.7	1.7e-37
WP_039312596.1|1370733_1371693_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	38.3	1.5e-48
WP_039312599.1|1371900_1372587_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.9	5.8e-50
WP_039312602.1|1372587_1374006_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	37.9	2.6e-36
>prophage 114
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1380608	1381160	3153266		Paenibacillus_phage(100.0%)	1	NA	NA
WP_039312615.1|1380608_1381160_+	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	7.3e-11
>prophage 115
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1384472	1384748	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039312623.1|1384472_1384748_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	57.3	6.2e-19
>prophage 116
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1390253	1394082	3153266	protease,tRNA	Escherichia_phage(33.33%)	3	NA	NA
WP_039312643.1|1390253_1391654_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0U2S5Z2	Escherichia_phage	25.3	3.9e-08
WP_039312646.1|1391655_1392195_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	4.5e-13
WP_039312649.1|1392279_1394082_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A9YVR1	Ostreococcus_tauri_virus	51.8	6.3e-112
>prophage 117
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1398765	1403914	3153266	protease,tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_039312663.1|1398765_1400271_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.6	1.0e-91
WP_052139476.1|1400374_1401274_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_039312666.1|1401656_1402145_-	LURP-one-related family protein	NA	NA	NA	NA	NA
WP_039312667.1|1402513_1403914_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	31.0	6.7e-53
>prophage 118
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1414804	1416851	3153266		Bacillus_virus(50.0%)	3	NA	NA
WP_039312683.1|1414804_1415485_+	thymidylate kinase	NA	G3MB74	Bacillus_virus	37.0	7.3e-29
WP_039312686.1|1415567_1415897_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_039312689.1|1415921_1416851_+	DNA polymerase III subunit delta'	NA	A0A218MMC7	uncultured_virus	28.9	1.2e-05
>prophage 119
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1421142	1424690	3153266	protease	Cronobacter_phage(50.0%)	2	NA	NA
WP_039312711.1|1421142_1423578_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	35.5	2.5e-127
WP_039312714.1|1423754_1424690_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	42.3	2.6e-61
>prophage 120
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1432618	1455770	3153266	tRNA	Vibrio_phage(37.5%)	20	NA	NA
WP_039312748.1|1432618_1434334_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	24.4	1.7e-05
WP_039312751.1|1434349_1435753_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	31.2	3.7e-51
WP_039312754.1|1435803_1436220_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_052139482.1|1436255_1437185_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_039312757.1|1437199_1437712_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_039316749.1|1437805_1438426_+	RNA polymerase sporulation sigma factor SigH	NA	NA	NA	NA	NA
WP_039312760.1|1438641_1439835_+	elongation factor Tu	NA	M4M9V7	Vibrio_phage	50.0	3.1e-06
WP_039312763.1|1440061_1440211_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_039312766.1|1440262_1440493_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_039312769.1|1440523_1441045_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	28.5	2.5e-08
WP_039312772.1|1441133_1441559_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_039312775.1|1441612_1442302_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_039312778.1|1442512_1443016_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_039312781.1|1443065_1443431_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_039312784.1|1443795_1447500_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	22.9	5.6e-46
WP_039312786.1|1447520_1451057_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.2	2.8e-71
WP_024614758.1|1451261_1451636_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_039312791.1|1451784_1452255_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_039312794.1|1452329_1454402_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	1.7e-60
WP_039312760.1|1454576_1455770_+	elongation factor Tu	NA	M4M9V7	Vibrio_phage	50.0	3.1e-06
>prophage 121
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1466824	1467475	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_039312861.1|1466824_1467475_+	adenylate kinase	NA	A0A2K9L833	Tupanvirus	40.9	1.1e-10
>prophage 122
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1472241	1473947	3153266		Planktothrix_phage(50.0%)	2	NA	NA
WP_039312888.1|1472241_1473087_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	34.3	8.3e-22
WP_039312891.1|1473071_1473947_+	energy-coupling factor transporter ATPase	NA	W5SAS9	Pithovirus	25.6	1.0e-14
>prophage 123
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1482305	1488847	3153266		Bacillus_phage(80.0%)	5	NA	NA
WP_039312918.1|1482305_1482989_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	4.6e-39
WP_052139612.1|1483620_1484829_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	3.8e-28
WP_039312922.1|1484902_1485259_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.4	1.2e-25
WP_144316916.1|1485561_1487784_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A127AW21	Bacillus_phage	45.4	6.9e-193
WP_039312928.1|1487809_1488847_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A127AVZ3	Bacillus_phage	37.7	6.7e-66
>prophage 124
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1499297	1499939	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039312955.1|1499297_1499939_-	cell wall hydrolase	NA	A0A0E3XAL9	Bacillus_phage	49.2	1.3e-22
>prophage 125
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1508495	1512599	3153266		Bacillus_phage(50.0%)	3	NA	NA
WP_039312983.1|1508495_1509839_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	26.6	1.3e-24
WP_039312986.1|1510456_1510957_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_039312988.1|1511006_1512599_+	citramalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.0	1.8e-09
>prophage 126
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1517205	1518873	3153266		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_039312999.1|1517205_1518873_+	biosynthetic-type acetolactate synthase large subunit	NA	C7U069	Ostreococcus_tauri_virus	27.6	5.6e-38
>prophage 127
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1531553	1532699	3153266		Faustovirus(100.0%)	1	NA	NA
WP_039313036.1|1531553_1532699_+	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	31.8	5.6e-29
>prophage 128
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1535773	1543974	3153266		Bacillus_phage(50.0%)	6	NA	NA
WP_080753041.1|1535773_1536967_+	hypothetical protein	NA	A0A2R8FFC0	Cedratvirus	61.2	8.0e-47
WP_039316764.1|1537113_1538979_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.6e-60
WP_039313042.1|1538968_1540711_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.5	1.2e-38
WP_039313045.1|1540725_1541172_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039313048.1|1541381_1541624_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_039313050.1|1542147_1543974_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	39.7	9.3e-111
>prophage 129
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1547828	1549760	3153266	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_039313061.1|1547828_1549760_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.4	1.6e-116
>prophage 130
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1559127	1566860	3153266		Streptococcus_phage(50.0%)	5	NA	NA
WP_039313086.1|1559127_1561770_-	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.1	1.8e-86
WP_039313089.1|1562120_1563188_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	33.9	3.0e-37
WP_039313091.1|1563483_1564062_+	zinc dependent phospholipase C family protein	NA	NA	NA	NA	NA
WP_039313094.1|1564257_1564632_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	40.2	4.8e-14
WP_039313097.1|1564652_1566860_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	4.4e-115
>prophage 131
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1576064	1577459	3153266		Enterococcus_phage(100.0%)	1	NA	NA
WP_173406288.1|1576064_1577459_+	NADPH-dependent glutamate synthase	NA	A0A249XZT7	Enterococcus_phage	23.5	4.7e-06
>prophage 132
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1580603	1582529	3153266		uncultured_virus(100.0%)	2	NA	NA
WP_039313133.1|1580603_1580888_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	52.1	4.1e-18
WP_039313136.1|1580903_1582529_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	54.6	9.6e-152
>prophage 133
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1593424	1596548	3153266		Klosneuvirus(50.0%)	2	NA	NA
WP_039313170.1|1593424_1594879_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.2	2.1e-97
WP_039313176.1|1595015_1596548_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.4	2.3e-22
>prophage 134
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1611650	1622322	3153266	tRNA	Bacillus_phage(40.0%)	9	NA	NA
WP_039313204.1|1611650_1613309_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	58.0	2.8e-183
WP_039313207.1|1613591_1614218_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	45.7	2.6e-49
WP_080753095.1|1614269_1615169_-	radical SAM protein	NA	NA	NA	NA	NA
WP_039313214.1|1615363_1615945_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_039313217.1|1615968_1616781_+	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	51.0	1.6e-70
WP_039313221.1|1616898_1617381_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_039313224.1|1617446_1617902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039313227.1|1618041_1620306_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	40.1	3.9e-127
WP_039313230.1|1620330_1622322_+	NAD-dependent DNA ligase LigA	NA	Q332J4	Clostridium_botulinum_C_phage	37.2	2.1e-108
>prophage 135
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1630577	1632150	3153266	integrase	Bacillus_phage(50.0%)	2	1630440:1630479	1640935:1640974
1630440:1630479	attL	TCGAATCCAAAGGTCGGGGGTTCAAATCCCTCTAGGTGCA	NA	NA	NA	NA
WP_039313251.1|1630577_1631780_-|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	29.5	5.1e-33
WP_039313255.1|1631808_1632150_-	XRE family transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	45.3	1.1e-14
1640935:1640974	attR	TCGAATCCAAAGGTCGGGGGTTCAAATCCCTCTAGGTGCA	NA	NA	NA	NA
>prophage 136
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1650202	1652299	3153266		Bacillus_phage(50.0%)	2	NA	NA
WP_039313299.1|1650202_1650886_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	5.4e-40
WP_039313303.1|1650889_1652299_+	HAMP domain-containing histidine kinase	NA	A0A1V0SKH0	Klosneuvirus	26.1	1.4e-10
>prophage 137
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1657328	1665174	3153266	tRNA	Streptococcus_phage(33.33%)	7	NA	NA
WP_039313314.1|1657328_1659191_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	27.4	3.9e-40
WP_039313317.1|1659432_1660395_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039313320.1|1660362_1660938_-	lipase	NA	NA	NA	NA	NA
WP_039313323.1|1660957_1661578_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_039313326.1|1661778_1662789_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.5	4.8e-69
WP_039313329.1|1662807_1663830_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_039313332.1|1664004_1665174_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	1.2e-15
>prophage 138
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1672663	1673365	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039313352.1|1672663_1673365_+	ribonuclease Z	NA	A0A076G6T0	Bacillus_phage	39.0	6.4e-44
>prophage 139
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1684651	1689542	3153266		Amsacta_moorei_entomopoxvirus(50.0%)	4	NA	NA
WP_039313384.1|1684651_1686181_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	27.2	1.2e-10
WP_039313387.1|1686170_1687262_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039313390.1|1687263_1688214_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039313394.1|1688423_1689542_-	glycosyltransferase family 4 protein	NA	A0A1X9SJL4	Sulfolobus_islandicus_rod-shaped_virus	30.6	1.3e-06
>prophage 140
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1701411	1703031	3153266		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_039313427.1|1701411_1703031_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.8	3.2e-155
>prophage 141
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1706326	1706914	3153266		Clostridium_phage(100.0%)	1	NA	NA
WP_039313439.1|1706326_1706914_+	thymidine kinase	NA	A0A249XXF6	Clostridium_phage	55.3	8.8e-55
>prophage 142
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1710504	1713746	3153266		Pandoravirus(50.0%)	5	NA	NA
WP_039313450.1|1710504_1711548_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	38.4	6.8e-50
WP_039313453.1|1711566_1712019_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_039313456.1|1712094_1712544_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_039313458.1|1712561_1713191_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_039313462.1|1713251_1713746_-	dCMP deaminase family protein	NA	V5LNH9	Emiliania_huxleyi_virus	54.6	5.3e-45
>prophage 143
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1724849	1733447	3153266	protease	Pseudomonas_phage(20.0%)	9	NA	NA
WP_080753096.1|1724849_1725806_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	34.9	1.7e-31
WP_039313491.1|1725944_1726721_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_039313493.1|1726824_1727076_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	58.7	6.2e-18
WP_039313499.1|1727200_1728235_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_039313502.1|1728272_1728821_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	35.9	4.0e-17
WP_144316898.1|1728922_1729540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039313504.1|1730858_1732034_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.9	5.1e-155
WP_039313507.1|1732068_1732875_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_039313510.1|1732877_1733447_-	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	27.9	6.4e-10
>prophage 144
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1739252	1741490	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039313525.1|1739252_1741490_+	ATP-dependent RecD-like DNA helicase	NA	U5J9B0	Bacillus_phage	32.3	1.8e-79
>prophage 145
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1746911	1748018	3153266		Mycobacterium_phage(100.0%)	1	NA	NA
WP_144316899.1|1746911_1748018_+	peptide chain release factor 2	NA	A0A2I2MPK0	Mycobacterium_phage	41.9	3.4e-07
>prophage 146
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1766053	1766389	3153266		Klosneuvirus(100.0%)	1	NA	NA
WP_039313581.1|1766053_1766389_-	hypothetical protein	NA	A0A1V0SKV2	Klosneuvirus	61.6	1.5e-22
>prophage 147
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1774667	1781156	3153266		Phaeocystis_globosa_virus(33.33%)	5	NA	NA
WP_039313607.1|1774667_1776494_+	DNA mismatch repair protein MutS	NA	R4TQI0	Phaeocystis_globosa_virus	24.8	2.7e-09
WP_039313610.1|1776523_1777441_+	exonuclease domain-containing protein	NA	G3MBN3	Bacillus_virus	32.3	3.7e-15
WP_039313613.1|1777518_1777929_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_039313616.1|1778155_1778425_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_039313619.1|1778474_1781156_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	6.5e-113
>prophage 148
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1817022	1824236	3153266		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_039313711.1|1817022_1818381_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	32.2	1.8e-55
WP_039313714.1|1819001_1821269_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	34.9	3.9e-42
WP_039313716.1|1821261_1822521_+	McrC family protein	NA	NA	NA	NA	NA
WP_039313719.1|1822886_1824236_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	32.1	4.0e-42
>prophage 149
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1843572	1843983	3153266		Vibrio_phage(100.0%)	1	NA	NA
WP_039316811.1|1843572_1843983_+	peptide deformylase	NA	A0A2I7QLT9	Vibrio_phage	35.0	2.3e-09
>prophage 150
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1860539	1861286	3153266		Enterococcus_phage(100.0%)	1	NA	NA
WP_039313793.1|1860539_1861286_+	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	42.4	9.9e-19
>prophage 151
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1864704	1865559	3153266		Streptococcus_phage(100.0%)	1	NA	NA
WP_039313801.1|1864704_1865559_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	30.0	3.8e-22
>prophage 152
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1878201	1879551	3153266		Pandoravirus(100.0%)	1	NA	NA
WP_039313846.1|1878201_1879551_+	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	24.3	3.6e-27
>prophage 153
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1894489	1898828	3153266		Planktothrix_phage(50.0%)	5	NA	NA
WP_039313897.1|1894489_1895452_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.2e-29
WP_039313900.1|1895452_1896091_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039313903.1|1896138_1896951_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039313905.1|1897091_1898150_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_144316900.1|1898177_1898828_+	viroplasmin family protein	NA	D9J0S8	Brochothrix_phage	34.8	5.0e-19
>prophage 154
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1902350	1904954	3153266		Agrobacterium_phage(100.0%)	1	NA	NA
WP_039313917.1|1902350_1904954_+	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.8	7.2e-125
>prophage 155
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1928374	1934026	3153266		Bacillus_phage(50.0%)	6	NA	NA
WP_039313980.1|1928374_1929037_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	6.0e-36
WP_039313983.1|1929020_1930451_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.7	1.2e-09
WP_039313986.1|1930537_1932010_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_039313989.1|1932021_1932699_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	5.1e-22
WP_039313993.1|1932726_1932909_-	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_039313996.1|1933057_1934026_-	P1 family peptidase	NA	L7XZF8	Megavirus	28.6	2.1e-13
>prophage 156
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1943476	1947611	3153266		Hokovirus(50.0%)	4	NA	NA
WP_039314020.1|1943476_1944610_+	ATP phosphoribosyltransferase regulatory subunit	NA	A0A1V0SFH3	Hokovirus	25.3	7.7e-15
WP_039314022.1|1944613_1945246_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_039314024.1|1945267_1946566_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_039316825.1|1946582_1947611_+	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	26.8	9.8e-17
>prophage 157
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1954033	1956196	3153266		Catovirus(100.0%)	1	NA	NA
WP_039314044.1|1954033_1956196_+	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.9	1.4e-81
>prophage 158
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1965507	1966737	3153266	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_039314062.1|1965507_1966737_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	35.7	4.8e-63
>prophage 159
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1973561	1974587	3153266		Pieris_rapae_granulovirus(100.0%)	1	NA	NA
WP_039314086.1|1973561_1974587_-	glycoside hydrolase family 18 protein	NA	V9XRY7	Pieris_rapae_granulovirus	35.6	2.5e-41
>prophage 160
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1981267	1985650	3153266	protease	Agrobacterium_phage(33.33%)	3	NA	NA
WP_039314101.1|1981267_1981864_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.8	9.9e-54
WP_039314103.1|1981898_1983197_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	60.7	3.0e-148
WP_039314105.1|1983325_1985650_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.8	1.2e-168
>prophage 161
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	1991830	1995428	3153266		Bacillus_virus(50.0%)	2	NA	NA
WP_039314121.1|1991830_1993306_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	1.4e-128
WP_039316832.1|1993415_1995428_+	UvrD-helicase domain-containing protein	NA	Q331U3	Clostridium_botulinum_C_phage	28.2	2.6e-45
>prophage 162
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2023573	2026096	3153266		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_039314180.1|2023573_2026096_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	9.0e-72
>prophage 163
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2033265	2034396	3153266		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_039314192.1|2033265_2034396_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.3	1.1e-45
>prophage 164
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2038846	2041138	3153266		Hokovirus(100.0%)	1	NA	NA
WP_039314200.1|2038846_2041138_+	UvrD-helicase domain-containing protein	NA	A0A1V0SG90	Hokovirus	25.3	1.3e-08
>prophage 165
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2046932	2051497	3153266		Pandoravirus(50.0%)	6	NA	NA
WP_039314222.1|2046932_2047508_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	46.9	2.4e-49
WP_039314225.1|2047518_2048865_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	41.0	5.7e-33
WP_039314227.1|2048861_2049635_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_039314230.1|2049624_2050179_+	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	46.2	1.4e-41
WP_039314233.1|2050193_2050670_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_039314236.1|2050687_2051497_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	9.4e-23
>prophage 166
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2054730	2056137	3153266		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_052139517.1|2054730_2056137_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.0	1.6e-06
>prophage 167
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2086492	2089087	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039314324.1|2086492_2089087_+	DNA polymerase I	NA	S5M8J1	Bacillus_phage	34.3	6.6e-54
>prophage 168
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2094985	2107282	3153266		Vibrio_phage(20.0%)	10	NA	NA
WP_039314338.1|2094985_2097019_+	PTS transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	42.5	5.4e-11
WP_158380618.1|2097128_2099051_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.2	3.3e-26
WP_052139521.1|2099059_2101081_+	two-component sensor histidine kinase	NA	A0A2K9L5I4	Tupanvirus	24.3	6.8e-14
WP_039314341.1|2101144_2101645_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_039314343.1|2101742_2103902_+	type IA DNA topoisomerase	NA	A0A1V0SB35	Catovirus	23.6	3.5e-16
WP_039314346.1|2103956_2104364_+	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_039314348.1|2104464_2105181_-	LrgB family protein	NA	NA	NA	NA	NA
WP_039314351.1|2105164_2105551_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_039316849.1|2105736_2106522_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_039314354.1|2106514_2107282_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	1.6e-32
>prophage 169
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2111380	2112673	3153266		Stx2-converting_phage(100.0%)	1	NA	NA
WP_039314370.1|2111380_2112673_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	31.3	8.5e-18
>prophage 170
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2122549	2124801	3153266		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_039314395.1|2122549_2123533_+	linear amide C-N hydrolase	NA	A7IWP6	Paramecium_bursaria_Chlorella_virus	28.9	2.1e-21
WP_039314398.1|2123877_2124801_+	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	39.7	4.4e-53
>prophage 171
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2129924	2136368	3153266		Tetraselmis_virus(66.67%)	6	NA	NA
WP_039314420.1|2129924_2132156_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.9	1.0e-183
WP_039316855.1|2132315_2133026_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	31.1	2.5e-27
WP_039314423.1|2133067_2133337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039314426.1|2133433_2134051_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_039314429.1|2134294_2135245_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_039314432.1|2135354_2136368_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.5	1.0e-66
>prophage 172
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2140937	2142632	3153266	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_039314440.1|2140937_2142632_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	36.2	7.6e-91
>prophage 173
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2149175	2150042	3153266		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
WP_080753057.1|2149175_2150042_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	52.2	1.6e-65
>prophage 174
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2157355	2159816	3153266		Planktothrix_phage(50.0%)	2	NA	NA
WP_039314473.1|2157355_2158453_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.5	9.7e-23
WP_039314474.1|2158478_2159816_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	23.7	6.3e-16
>prophage 176
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2188905	2191212	3153266		Clostridium_phage(50.0%)	2	NA	NA
WP_052139528.1|2188905_2189274_-	single-stranded DNA-binding protein	NA	Q8SBL5	Clostridium_phage	36.1	1.2e-12
WP_039314559.1|2189835_2191212_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	35.8	1.9e-68
>prophage 177
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2196482	2199696	3153266		Phage_TP(50.0%)	2	NA	NA
WP_039314568.1|2196482_2198408_+	U32 family peptidase	NA	Q6DW11	Phage_TP	30.3	2.7e-20
WP_039314570.1|2198421_2199696_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.9	1.4e-25
>prophage 178
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2204287	2217848	3153266		Cyanophage(22.22%)	12	NA	NA
WP_039314587.1|2204287_2205046_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	2.7e-24
WP_039314590.1|2205045_2205783_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039314591.1|2205874_2206375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039314594.1|2206397_2207009_-	J domain-containing protein	NA	A0A2H4UUB5	Bodo_saltans_virus	50.0	4.6e-06
WP_039314596.1|2206995_2207913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039314599.1|2208305_2212064_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.8	2.1e-32
WP_039314602.1|2212082_2212562_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.4	2.0e-28
WP_039314611.1|2212561_2213275_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	43.4	2.0e-45
WP_039314614.1|2213278_2214715_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	1.0e-56
WP_039314615.1|2214727_2215729_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	46.2	7.2e-65
WP_039314618.1|2215716_2216328_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.2	2.9e-24
WP_039314626.1|2216345_2217848_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	S4VT61	Pandoravirus	36.1	2.7e-47
>prophage 179
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2224226	2225042	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_039314641.1|2224226_2225042_+	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	44.1	7.7e-33
>prophage 180
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2232517	2234212	3153266		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_039314666.1|2232517_2234212_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.9e-49
>prophage 181
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2251883	2253179	3153266	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_039314725.1|2251883_2253179_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SLE3	Klosneuvirus	30.4	2.5e-41
>prophage 182
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2258456	2264468	3153266		Pandoravirus(33.33%)	5	NA	NA
WP_039314735.1|2258456_2259911_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.0	3.3e-26
WP_039314739.1|2259979_2261641_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	34.2	3.0e-60
WP_039314743.1|2262096_2262927_+	VanW family protein	NA	NA	NA	NA	NA
WP_039314746.1|2263114_2263513_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039314749.1|2263622_2264468_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.0	3.6e-49
>prophage 183
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2269580	2271375	3153266		Bacillus_phage(100.0%)	2	NA	NA
WP_039314768.1|2269580_2270273_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.4e-40
WP_039314770.1|2270262_2271375_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	1.3e-27
>prophage 184
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2284679	2285750	3153266		Planktothrix_phage(100.0%)	1	NA	NA
WP_039314805.1|2284679_2285750_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	5.4e-26
>prophage 185
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2297213	2302227	3153266		Synechococcus_phage(33.33%)	5	NA	NA
WP_039314828.1|2297213_2297642_-	galactose-6-phosphate isomerase subunit LacA	NA	A0A222YX14	Synechococcus_phage	31.7	2.1e-05
WP_039314830.1|2297671_2298424_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.3	6.0e-24
WP_039314833.1|2298675_2298987_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_039314835.1|2299139_2300804_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_039314837.1|2300826_2302227_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	31.9	1.2e-54
>prophage 186
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2312086	2315194	3153266		Rhodococcus_phage(100.0%)	1	NA	NA
WP_039314860.1|2312086_2315194_+	DEAD/DEAH box helicase	NA	D4P754	Rhodococcus_phage	27.6	1.6e-38
>prophage 187
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2328821	2335056	3153266		Clostridioides_phage(33.33%)	3	NA	NA
WP_039314888.1|2328821_2331161_+	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	26.3	5.4e-31
WP_039314891.1|2332185_2332560_+	HIT family protein	NA	D7NW73	Streptomyces_phage	41.3	3.7e-14
WP_039314895.1|2332572_2335056_+	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	30.3	2.7e-28
>prophage 188
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2339403	2340324	3153266		Marseillevirus(100.0%)	1	NA	NA
WP_052139535.1|2339403_2340324_-	deoxyribonuclease IV	NA	A0A2R3ZQP0	Marseillevirus	24.9	9.0e-14
>prophage 189
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2366920	2370507	3153266		Organic_Lake_phycodnavirus(100.0%)	2	NA	NA
WP_144316906.1|2366920_2368705_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.2	9.9e-17
WP_052139538.1|2368701_2370507_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	28.7	2.0e-17
>prophage 190
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2376676	2377786	3153266		Mycoplasma_phage(100.0%)	1	NA	NA
WP_039314990.1|2376676_2377786_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	36.2	3.1e-24
>prophage 191
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2387523	2388933	3153266		Pandoravirus(100.0%)	1	NA	NA
WP_039315013.1|2387523_2388933_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	32.9	1.2e-62
>prophage 192
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2392015	2398902	3153266		Bacillus_phage(100.0%)	8	NA	NA
WP_039315024.1|2392015_2392876_+	CAP domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	40.2	6.2e-17
WP_039315027.1|2393109_2393901_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	39.0	6.0e-06
WP_039315030.1|2394050_2394827_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_039315033.1|2394973_2395420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315035.1|2395435_2396113_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_039315038.1|2396133_2396751_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_173406293.1|2396830_2397514_+	response regulator	NA	W8CYM9	Bacillus_phage	32.3	5.5e-32
WP_039315043.1|2397519_2398902_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	33.1	5.1e-37
>prophage 193
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2403384	2404275	3153266		Streptococcus_phage(100.0%)	1	NA	NA
WP_039315053.1|2403384_2404275_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	31.2	6.9e-11
>prophage 194
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2409158	2409845	3153266		Planktothrix_phage(100.0%)	1	NA	NA
WP_039316904.1|2409158_2409845_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	2.3e-38
>prophage 195
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2426094	2427831	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039315118.1|2426094_2427831_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.2	1.6e-16
>prophage 196
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2434682	2438162	3153266		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_039315134.1|2434682_2435222_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	39.3	9.0e-30
WP_039315138.1|2435863_2436160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315141.1|2436218_2438162_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	A0A1B0RXH7	Streptococcus_phage	27.4	8.5e-62
>prophage 197
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2442003	2442804	3153266		Planktothrix_phage(100.0%)	1	NA	NA
WP_039315152.1|2442003_2442804_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.2e-31
>prophage 198
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2449662	2451123	3153266		Bacillus_phage(100.0%)	1	NA	NA
WP_039315164.1|2449662_2451123_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	24.8	7.9e-12
>prophage 199
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2454846	2456346	3153266		Staphylococcus_phage(100.0%)	1	NA	NA
WP_039315180.1|2454846_2456346_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.3	4.0e-19
>prophage 200
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2460337	2462212	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_039315194.1|2460337_2462212_+	PAS domain-containing sensor histidine kinase	NA	A0A2K9L5I4	Tupanvirus	21.1	9.5e-10
>prophage 201
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2465971	2473450	3153266		Bacillus_phage(33.33%)	7	NA	NA
WP_039315208.1|2465971_2468053_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.0	2.3e-12
WP_039315211.1|2468165_2468798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080753071.1|2468857_2469367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039315217.1|2469456_2470632_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_039315220.1|2470809_2471745_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	46.9	5.1e-73
WP_039315223.1|2471744_2472698_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_039315225.1|2472694_2473450_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	9.7e-22
>prophage 202
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2503028	2504933	3153266		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_039315292.1|2503028_2504933_+	mannonate oxidoreductase	NA	F2Y0V3	Organic_Lake_phycodnavirus	28.5	1.3e-17
>prophage 203
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2509693	2514183	3153266		Yersinia_phage(33.33%)	3	NA	NA
WP_039315302.1|2509693_2512102_+	glycyl radical protein	NA	A0A2C9CWX5	Yersinia_phage	55.4	3.5e-09
WP_039315304.1|2512114_2512792_+	fructose-6-phosphate aldolase	NA	R9S7J6	Prochlorococcus_phage	37.3	8.9e-35
WP_039315306.1|2513220_2514183_+	histidine decarboxylase, pyruvoyl type	NA	A0A1B1ISG5	uncultured_Mediterranean_phage	31.9	9.7e-35
>prophage 204
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2532542	2537056	3153266		Staphylococcus_phage(33.33%)	5	NA	NA
WP_039315343.1|2532542_2533289_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.2	2.5e-38
WP_039315346.1|2533301_2534123_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_039315349.1|2534135_2534903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315352.1|2534930_2535629_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.4	1.9e-35
WP_039315354.1|2535628_2537056_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.2	1.1e-13
>prophage 205
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2540217	2541756	3153266		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_039315373.1|2540217_2541756_-	DUF5011 domain-containing protein	NA	M1GXS8	Acanthocystis_turfacea_Chlorella_virus	29.5	1.2e-23
>prophage 206
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2547151	2547985	3153266		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_039315394.1|2547151_2547985_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.3	1.9e-26
>prophage 207
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2566436	2568491	3153266		Pseudomonas_phage(100.0%)	1	NA	NA
WP_052139558.1|2566436_2568491_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	39.3	4.8e-47
>prophage 208
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2572546	2582650	3153266		Tupanvirus(33.33%)	8	NA	NA
WP_039315466.1|2572546_2573737_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	36.4	5.4e-51
WP_039315469.1|2574198_2574774_+	DUF5105 domain-containing protein	NA	NA	NA	NA	NA
WP_039315471.1|2574906_2576199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315473.1|2576199_2576988_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	7.2e-28
WP_039315477.1|2577052_2577703_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_039315480.1|2577787_2578291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039315483.1|2578444_2579134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080753073.1|2579371_2582650_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.3	1.2e-23
>prophage 209
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2590003	2599023	3153266		Bacillus_phage(25.0%)	7	NA	NA
WP_039315501.1|2590003_2591773_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.6	1.6e-27
WP_039315503.1|2591773_2593441_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	27.1	9.3e-17
WP_039315505.1|2593459_2593858_+	YbaN family protein	NA	NA	NA	NA	NA
WP_039315507.1|2593861_2594167_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_039315508.1|2594180_2595860_+	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_039315510.1|2595975_2598147_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.0	6.2e-29
WP_052139562.1|2598276_2599023_+	conserved phage C-terminal domain-containing protein	NA	Q8SBM0	Clostridium_phage	34.8	3.2e-25
>prophage 210
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2602055	2604796	3153266		Staphylococcus_phage(100.0%)	2	NA	NA
WP_039316945.1|2602055_2603600_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	65.6	6.1e-188
WP_039315513.1|2603614_2604796_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	30.5	9.4e-32
>prophage 211
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2609813	2610434	3153266		Clostridioides_phage(100.0%)	1	NA	NA
WP_158380620.1|2609813_2610434_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	42.9	5.1e-29
>prophage 212
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2627291	2628074	3153266		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_039315542.1|2627291_2628074_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.0e-21
>prophage 213
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2638557	2639952	3153266		Moraxella_phage(100.0%)	1	NA	NA
WP_039315573.1|2638557_2639952_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	26.8	7.0e-42
>prophage 214
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2644858	2645599	3153266		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_039315591.1|2644858_2645599_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.0	7.8e-16
>prophage 215
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2655453	2658906	3153266		Bacillus_virus(33.33%)	4	NA	NA
WP_039315626.1|2655453_2656722_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.5	1.8e-89
WP_039315628.1|2656832_2657285_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_039315631.1|2657287_2658469_+	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	40.7	1.6e-42
WP_039315634.1|2658471_2658906_+	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	55.2	3.5e-32
>prophage 216
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2661924	2664570	3153266	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_039315647.1|2661924_2664570_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	33.6	2.8e-60
>prophage 217
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2671143	2676309	3153266		Bacillus_phage(25.0%)	5	NA	NA
WP_039315671.1|2671143_2671788_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	34.4	1.2e-07
WP_039315674.1|2671791_2673036_+	U32 family peptidase	NA	Q6DW11	Phage_TP	40.0	1.2e-56
WP_039315676.1|2673048_2673666_+	uridine kinase	NA	A0A2K9L178	Tupanvirus	42.2	3.3e-36
WP_039316950.1|2673867_2675454_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_039315679.1|2675607_2676309_+	RNA polymerase sporulation sigma factor SigK	NA	A0A2H4JC68	uncultured_Caudovirales_phage	40.1	1.0e-17
>prophage 218
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2683642	2732248	3153266	bacteriocin,capsid,integrase,terminase	Clostridium_phage(69.05%)	61	2686049:2686078	2725293:2725322
WP_039315694.1|2683642_2684350_+	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	45.0	8.5e-20
WP_039315697.1|2684430_2685204_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0A0RV91	Bacillus_phage	43.0	6.1e-48
WP_039315700.1|2685270_2685549_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_039315706.1|2685628_2686078_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
2686049:2686078	attL	ATGGAAGAAATAAATAGATTAATGAGATAA	NA	NA	NA	NA
WP_039315710.1|2686122_2687226_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	30.2	9.1e-29
WP_039315713.1|2687299_2687764_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RVV2	Clostridium_phage	48.0	5.0e-29
WP_080753102.1|2687795_2688254_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTR3	Clostridium_phage	44.8	5.8e-22
WP_039315720.1|2688415_2688625_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_039315723.1|2688648_2689398_+	phage antirepressor KilAC domain-containing protein	NA	A0A2D1GQG9	Lysinibacillus_phage	45.7	4.3e-46
WP_039315726.1|2689411_2689744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158380621.1|2689984_2690122_+	hypothetical protein	NA	M9Q1J2	Clostridium_phage	57.1	8.6e-06
WP_039315729.1|2690243_2690432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144316909.1|2690443_2690623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315731.1|2690634_2691288_+	ERF family protein	NA	A0A0A7RVW0	Clostridium_phage	37.7	6.0e-28
WP_039315734.1|2691300_2692203_+	DUF1351 domain-containing protein	NA	A0A2H4J082	uncultured_Caudovirales_phage	31.4	7.7e-18
WP_039315737.1|2692217_2692931_+	hypothetical protein	NA	A0A2P1JTY8	Anoxybacillus_phage	53.8	5.7e-32
WP_039315739.1|2692930_2693275_+	hypothetical protein	NA	A0A0A7RTL9	Clostridium_phage	51.8	2.1e-24
WP_039315741.1|2693287_2693680_+	hypothetical protein	NA	A0A0A7RUF3	Clostridium_phage	64.6	8.5e-38
WP_039315742.1|2693713_2694427_+	hypothetical protein	NA	A0A0A7RWW3	Clostridium_phage	58.1	7.1e-67
WP_052139572.1|2694511_2694766_+	hypothetical protein	NA	M9Q2L5	Clostridium_phage	39.7	5.0e-07
WP_039315744.1|2694762_2695242_+	Holliday junction resolvase RecU	NA	NA	NA	NA	NA
WP_039315745.1|2695400_2696801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052139623.1|2697001_2697478_+	hypothetical protein	NA	Q0SPJ6	Clostridium_phage	42.5	1.8e-26
WP_039315749.1|2697518_2698349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173406290.1|2698742_2698913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315751.1|2698999_2699470_+|terminase	terminase small subunit	terminase	S5MA50	Brevibacillus_phage	55.9	2.7e-30
WP_039315753.1|2699462_2700827_+|terminase	terminase	terminase	M9Q2I1	Clostridium_phage	89.8	1.3e-247
WP_039315755.1|2700884_2701625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315757.1|2701670_2703182_+|capsid	phage capsid protein	capsid	M9Q246	Clostridium_phage	86.8	9.9e-252
WP_052139573.1|2703165_2704419_+|capsid	capsid protein	capsid	M9Q2F2	Clostridium_phage	79.8	3.4e-189
WP_039315759.1|2704465_2705176_+	hypothetical protein	NA	K4NXB8	Burkholderia_phage	25.6	2.7e-10
WP_039315761.1|2705275_2705890_+	hypothetical protein	NA	M9Q248	Clostridium_phage	75.5	4.5e-62
WP_039315763.1|2705913_2706819_+	hypothetical protein	NA	M9Q2F4	Clostridium_phage	92.0	1.7e-161
WP_039315765.1|2706833_2707082_+	hypothetical protein	NA	M9Q1H8	Clostridium_phage	67.9	5.4e-14
WP_039315767.1|2707118_2707481_+	hypothetical protein	NA	M9Q2K9	Clostridium_phage	85.8	5.1e-53
WP_039315769.1|2707483_2707810_+	hypothetical protein	NA	M9Q2I3	Clostridium_phage	88.0	2.7e-53
WP_039315771.1|2707809_2708193_+	hypothetical protein	NA	M9Q249	Clostridium_phage	88.2	4.7e-57
WP_039315773.1|2708192_2708579_+	hypothetical protein	NA	M9Q2F6	Clostridium_phage	88.3	3.7e-62
WP_039315774.1|2708587_2709055_+	hypothetical protein	NA	M9Q1I1	Clostridium_phage	86.4	1.4e-71
WP_039315776.1|2709066_2709435_+	hypothetical protein	NA	M9Q2L0	Clostridium_phage	64.5	9.4e-31
WP_052139575.1|2709382_2709757_+	hypothetical protein	NA	M9Q2I4	Clostridium_phage	83.3	7.5e-52
WP_039315780.1|2709801_2713002_+	membrane protein	NA	M9Q251	Clostridium_phage	67.0	5.3e-271
WP_039315782.1|2713005_2713359_+	hypothetical protein	NA	M9Q2F8	Clostridium_phage	72.6	4.6e-43
WP_039315784.1|2713380_2713644_+	hypothetical protein	NA	M9Q1I4	Clostridium_phage	64.3	8.8e-23
WP_039315786.1|2713705_2714086_+	hypothetical protein	NA	M9Q2L1	Clostridium_phage	65.1	3.9e-40
WP_052139577.1|2714122_2718556_+	hypothetical protein	NA	M9Q2I5	Clostridium_phage	36.0	2.8e-20
WP_039315788.1|2718605_2718839_+	hemolysin XhlA family protein	NA	I2E8W7	Clostridium_phage	59.7	8.1e-20
WP_052139578.1|2718864_2719362_+	cobalt ABC transporter permease	NA	Q0SPG5	Clostridium_phage	59.7	2.4e-45
WP_039315790.1|2720394_2721264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039315792.1|2721308_2721494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139624.1|2721834_2722086_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_039315795.1|2722439_2723519_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	30.9	1.2e-20
WP_039315797.1|2723521_2724262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315799.1|2724293_2725055_+	adenine-specific DNA-methyltransferase	NA	A0A0F7IN59	Polaribacter_phage	31.2	7.7e-19
WP_039315801.1|2725472_2726207_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
2725293:2725322	attR	ATGGAAGAAATAAATAGATTAATGAGATAA	NA	NA	NA	NA
WP_039315802.1|2726221_2726920_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.9	5.6e-40
WP_039315804.1|2726925_2728602_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	37.4	1.1e-33
WP_039315806.1|2728804_2729686_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039315808.1|2729711_2730599_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_039315810.1|2730600_2731485_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_039315811.1|2731498_2732248_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.9	6.0e-16
>prophage 219
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2735637	2737371	3153266		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_039315819.1|2735637_2737371_-	NFACT family protein	NA	I3UJX9	Ostreococcus_lucimarinus_virus	35.4	3.1e-07
>prophage 220
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2752256	2754288	3153266		Enterococcus_phage(50.0%)	2	NA	NA
WP_039315863.1|2752256_2753105_+	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.1	2.3e-35
WP_039315865.1|2753094_2754288_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	38.2	4.0e-46
>prophage 221
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2767859	2773156	3153266	integrase	uncultured_Mediterranean_phage(40.0%)	5	2763825:2763842	2778937:2778954
2763825:2763842	attL	AATGGAATTTTAAATTTA	NA	NA	NA	NA
WP_039315890.1|2767859_2768738_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	24.1	1.2e-18
WP_039315895.1|2769053_2770358_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.4	4.3e-134
WP_039315896.1|2770496_2771690_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.4	3.3e-32
WP_039315898.1|2771799_2772570_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	9.6e-09
WP_045726331.1|2772535_2773156_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.4	1.1e-18
2778937:2778954	attR	TAAATTTAAAATTCCATT	NA	NA	NA	NA
>prophage 222
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2776658	2778188	3153266		Clostridium_phage(100.0%)	1	NA	NA
WP_052139587.1|2776658_2778188_-	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	38.0	6.2e-68
>prophage 223
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2783970	2786284	3153266		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_039315910.1|2783970_2784837_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.6	4.9e-54
WP_039315911.1|2784910_2786284_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.7	8.2e-11
>prophage 224
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2793614	2794505	3153266		Cedratvirus(100.0%)	1	NA	NA
WP_039315920.1|2793614_2794505_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	6.9e-11
>prophage 225
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2805316	2825648	3153266	tRNA	Ostreococcus_lucimarinus_virus(14.29%)	16	NA	NA
WP_039315933.1|2805316_2808583_+	DEAD/DEAH box helicase	NA	A0A0P0CJA9	Ostreococcus_lucimarinus_virus	29.7	9.9e-39
WP_172678910.1|2808700_2808862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315935.1|2808899_2809097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315936.1|2809375_2812051_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.0	1.1e-51
WP_039315938.1|2812064_2814020_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.3	9.0e-80
WP_039316977.1|2814048_2814978_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_039315940.1|2815023_2815266_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_039315942.1|2815324_2816611_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_039315944.1|2816748_2817354_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	51.6	2.5e-12
WP_039315945.1|2817510_2817933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315946.1|2818029_2818590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039315947.1|2818632_2819625_-	tyrosine recombinase XerC	NA	W8EHC2	Mycobacterium_phage	27.6	5.0e-10
WP_039315949.1|2820235_2821762_-	DUF2828 family protein	NA	A0A076G571	Listeria_phage	25.1	1.2e-18
WP_039315951.1|2821953_2822139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039315952.1|2822262_2823654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039315954.1|2823746_2825648_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	8.6e-51
>prophage 226
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2830438	2832694	3153266		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_039315962.1|2830438_2831200_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	47.1	3.4e-59
WP_039315963.1|2831278_2832694_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.1	6.6e-40
>prophage 227
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2839083	2839566	3153266		Pneumococcus_phage(100.0%)	1	NA	NA
WP_039315972.1|2839083_2839566_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	36.1	1.1e-10
>prophage 228
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2851700	2852456	3153266		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_039316992.1|2851700_2852456_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.4	6.7e-15
>prophage 229
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2858006	2869689	3153266	protease	Mycobacterium_phage(50.0%)	10	NA	NA
WP_039315996.1|2858006_2858267_-	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	37.3	3.8e-10
WP_171991999.1|2858441_2859977_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_039315999.1|2860313_2861360_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	64.9	4.8e-120
WP_039316001.1|2861503_2862094_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_039316003.1|2862077_2863424_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_039316005.1|2863531_2865928_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.8	5.3e-90
WP_109091832.1|2866030_2866729_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_039316007.1|2866803_2868003_-	aspartate kinase	NA	NA	NA	NA	NA
WP_039316009.1|2868021_2868312_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_039316011.1|2868381_2869689_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.3	1.1e-49
>prophage 230
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2875470	2884271	3153266		Cafeteria_roenbergensis_virus(50.0%)	6	NA	NA
WP_039316027.1|2875470_2877516_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	33.6	2.2e-28
WP_039316029.1|2877530_2877848_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_039316031.1|2877840_2878107_-	YlxR family protein	NA	NA	NA	NA	NA
WP_039316032.1|2878126_2879236_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_039316033.1|2879251_2879710_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_039316034.1|2879942_2884271_-	PolC-type DNA polymerase III	NA	M1IQE0	Bacillus_phage	21.0	4.2e-21
>prophage 231
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2889510	2890272	3153266		Flavobacterium_phage(100.0%)	1	NA	NA
WP_039316046.1|2889510_2890272_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.3	1.8e-31
>prophage 232
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2894590	2900682	3153266		Cafeteria_roenbergensis_virus(33.33%)	5	NA	NA
WP_039316996.1|2894590_2896684_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	41.3	3.4e-109
WP_039316059.1|2896730_2897789_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	30.6	1.9e-31
WP_039316061.1|2897802_2899332_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_039316063.1|2899440_2899806_+	YraN family protein	NA	NA	NA	NA	NA
WP_039316066.1|2899875_2900682_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	37.0	2.8e-19
>prophage 233
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2911450	2912489	3153266		Moumouvirus(50.0%)	2	NA	NA
WP_039316088.1|2911450_2912149_-	ribonuclease III	NA	A0A2P1ELX5	Moumouvirus	35.8	3.9e-25
WP_039316090.1|2912258_2912489_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	43.5	8.5e-06
>prophage 234
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2919920	2923062	3153266		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_039316106.1|2919920_2920403_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	48.0	6.8e-29
WP_039316108.1|2920402_2920963_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_039316109.1|2921031_2923062_-	ATP-dependent DNA helicase RecG	NA	E3T5E1	Cafeteria_roenbergensis_virus	23.7	1.1e-08
>prophage 235
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2928030	2930211	3153266		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_052139596.1|2928030_2930211_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	32.7	5.4e-25
>prophage 236
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2934992	2942413	3153266		Synechococcus_phage(25.0%)	8	NA	NA
WP_039316132.1|2934992_2935436_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.9	5.0e-18
WP_039316134.1|2935448_2937644_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_039317006.1|2937697_2938888_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.5	9.2e-51
WP_039316136.1|2938893_2939112_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_039316138.1|2939092_2939725_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.9	1.0e-24
WP_039316141.1|2939724_2939994_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_039316143.1|2940009_2940891_-	YicC family protein	NA	NA	NA	NA	NA
WP_039316145.1|2941051_2942413_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	6.2e-43
>prophage 237
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2948453	2949371	3153266		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_039317008.1|2948453_2949371_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.7	5.7e-08
>prophage 238
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2969411	2971139	3153266		Streptococcus_phage(100.0%)	1	NA	NA
WP_039316200.1|2969411_2971139_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.6	5.6e-134
>prophage 239
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2976113	2978465	3153266		Phage_TP(100.0%)	1	NA	NA
WP_039316210.1|2976113_2978465_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.8	4.1e-26
>prophage 240
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2983380	2984400	3153266	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_039316218.1|2983380_2984400_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	5.1e-34
>prophage 241
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	2988359	2988881	3153266		Agrobacterium_phage(100.0%)	1	NA	NA
WP_039317013.1|2988359_2988881_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	38.8	1.7e-17
>prophage 242
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3002504	3004493	3153266		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_039316250.1|3002504_3003479_-	ATP-binding cassette domain-containing protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	25.7	6.6e-07
WP_039316251.1|3003485_3004493_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.6	4.0e-15
>prophage 243
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3009003	3009663	3153266		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_039316260.1|3009003_3009663_-	single-stranded DNA-binding protein	NA	A0A2H4J8K3	uncultured_Caudovirales_phage	50.2	3.9e-51
>prophage 244
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3016098	3018747	3153266	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_039316272.1|3016098_3018747_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.7	3.1e-176
>prophage 245
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3025773	3033411	3153266		Bacillus_virus(20.0%)	7	NA	NA
WP_039316281.1|3025773_3027018_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.5	8.4e-31
WP_039316282.1|3027165_3027837_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.7	6.3e-41
WP_039316283.1|3027836_3029363_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.0	6.5e-09
WP_039317023.1|3029399_3030140_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.4e-12
WP_039316284.1|3030148_3031081_-	dipeptidase	NA	NA	NA	NA	NA
WP_039316285.1|3031132_3032044_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_039316286.1|3032175_3033411_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.2	1.8e-102
>prophage 246
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3040897	3042588	3153266		Clostridium_phage(50.0%)	2	NA	NA
WP_039316294.1|3040897_3041260_-	hypothetical protein	NA	A0A0A7RTI7	Clostridium_phage	65.5	7.1e-31
WP_039316295.1|3041349_3042588_-	serine/threonine protein kinase	NA	A0A1V0SBS0	Catovirus	33.9	4.0e-17
>prophage 247
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3047963	3048743	3153266		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_039316302.1|3047963_3048743_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.2e-19
>prophage 248
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3058041	3060120	3153266		Klosneuvirus(50.0%)	3	NA	NA
WP_039316324.1|3058041_3059145_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	38.8	4.6e-65
WP_039316325.1|3059212_3059611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039316327.1|3059910_3060120_+	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	55.7	2.3e-13
>prophage 249
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3063831	3068592	3153266		Liberibacter_phage(50.0%)	6	NA	NA
WP_039316335.1|3063831_3065118_-	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	25.9	4.8e-13
WP_039316337.1|3065265_3065991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139600.1|3065990_3066497_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_039316339.1|3066603_3067194_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_039316341.1|3067505_3067901_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_144316926.1|3067926_3068592_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.2	3.2e-21
>prophage 250
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3084917	3086474	3153266		Tupanvirus(100.0%)	1	NA	NA
WP_039316378.1|3084917_3086474_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.9	2.3e-49
>prophage 251
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3092166	3093045	3153266		Staphylococcus_phage(100.0%)	1	NA	NA
WP_039316391.1|3092166_3093045_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.9	5.4e-24
>prophage 252
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3096982	3116532	3153266	tRNA	uncultured_Mediterranean_phage(33.33%)	18	NA	NA
WP_052139601.1|3096982_3098746_-	SH3 domain-containing protein	NA	A0A249XSM6	Mycobacterium_phage	32.6	1.2e-11
WP_039316396.1|3098896_3099682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039316398.1|3099866_3100412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039316400.1|3100557_3100935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039316402.1|3100976_3102779_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	31.4	3.1e-18
WP_039316403.1|3102832_3104083_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	27.7	1.3e-31
WP_039316405.1|3104094_3105531_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_039316408.1|3105540_3106140_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.5	3.2e-20
WP_039316410.1|3106159_3106609_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_039316412.1|3106623_3108807_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	37.5	6.2e-13
WP_039316414.1|3108918_3109437_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.2	1.7e-30
WP_039316416.1|3109510_3110368_-	phosphoesterase	NA	NA	NA	NA	NA
WP_039316418.1|3110511_3111381_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	3.9e-35
WP_039316420.1|3111385_3112636_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_039316422.1|3112886_3113165_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_039316424.1|3113296_3114430_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	1.1e-90
WP_039316426.1|3114459_3115485_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_039316428.1|3115497_3116532_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	27.5	9.8e-09
>prophage 253
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3120809	3121547	3153266		Planktothrix_phage(100.0%)	1	NA	NA
WP_039316436.1|3120809_3121547_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	3.8e-31
>prophage 254
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3131190	3131838	3153266		Streptococcus_phage(100.0%)	1	NA	NA
WP_039316456.1|3131190_3131838_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.2	2.1e-33
>prophage 255
NZ_CP006905	Clostridium baratii str. Sullivan chromosome, complete genome	3153266	3145598	3149763	3153266		Mycoplasma_phage(50.0%)	5	NA	NA
WP_039316481.1|3145598_3146654_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	41.4	9.3e-39
WP_039316482.1|3146646_3147486_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039316483.1|3147479_3148262_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_039316485.1|3148265_3149312_+	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039316487.1|3149355_3149763_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.5	1.0e-22
>prophage 1
NZ_CP006906	Clostridium baratii str. Sullivan plasmid pCBJ, complete sequence	185364	110772	136232	185364		Bacillus_phage(37.5%)	30	NA	NA
WP_040113706.1|110772_111441_-	thymidylate kinase	NA	G4YAU9	Emiliania_huxleyi_virus	29.5	1.9e-05
WP_040113708.1|111442_111961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113710.1|112023_112506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139640.1|112622_113705_-	hypothetical protein	NA	Q0SPI3	Clostridium_phage	37.7	1.9e-23
WP_040113712.1|113716_113995_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	45.6	2.5e-12
WP_040113715.1|114122_114329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113717.1|114397_114700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113720.1|114736_115588_-	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	31.3	7.0e-29
WP_040113723.1|115663_116413_-	hypothetical protein	NA	A0A0E3U2S4	Fusobacterium_phage	40.0	1.9e-09
WP_040113725.1|116471_117695_-	toprim domain-containing protein	NA	A7KV10	Bacillus_phage	37.5	1.5e-51
WP_040113727.1|117766_118105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113729.1|118139_118892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113730.1|118863_119502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113731.1|119513_119777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113734.1|119776_122116_-	AAA family ATPase	NA	A7KV18	Bacillus_phage	38.6	2.1e-99
WP_144316928.1|122157_122889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139641.1|122907_123393_-	hypothetical protein	NA	A7XCC1	Tanapox_virus	41.5	4.6e-17
WP_052139642.1|123507_124329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113738.1|124341_124641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113739.1|124689_126543_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	31.3	3.5e-73
WP_040113740.1|126595_128194_-	chaperonin GroEL	NA	A0A219YK71	uncultured_virus	41.1	8.1e-111
WP_052139643.1|128261_128999_-	hypothetical protein	NA	A7KV38	Bacillus_phage	39.0	5.0e-31
WP_052139644.1|129208_130207_-	hypothetical protein	NA	A0A2R3ZXV6	Staphylococcus_phage	32.1	1.5e-17
WP_040113741.1|130277_130760_-	hypothetical protein	NA	A7KV38	Bacillus_phage	36.4	2.3e-16
WP_040113742.1|130772_131084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113743.1|131080_131554_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_040113745.1|131578_131833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139645.1|131851_134143_-	DNA polymerase III subunit alpha	NA	A7KV44	Bacillus_phage	31.3	1.7e-85
WP_052139646.1|134275_134920_-	HNH endonuclease	NA	M4I0R9	Staphylococcus_phage	43.7	9.7e-23
WP_040113747.1|135116_136232_-	PHP domain-containing protein	NA	G3MA70	Bacillus_virus	29.3	2.8e-33
