The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009876	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 chromosome, complete genome	5228295	318568	326297	5228295	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_004146620.1|318568_321394_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004151744.1|321645_322170_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	95.4	5.1e-54
WP_032433760.1|322294_323875_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	31.7	6.3e-07
WP_076026135.1|324413_325382_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	7.9e-186
WP_000493286.1|325705_326035_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
WP_000780222.1|326015_326297_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
>prophage 2
NZ_CP009876	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 chromosome, complete genome	5228295	1818293	1827758	5228295	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1818293_1819409_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004209695.1|1819405_1821346_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1821422_1821644_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1821969_1822287_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1822317_1824597_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1824718_1824937_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1825290_1825992_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_032432850.1|1826036_1827758_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP009876	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 chromosome, complete genome	5228295	2489231	2500118	5228295		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2489231_2489852_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|2489844_2491110_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002903955.1|2491121_2492024_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2492284_2493046_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2493066_2493927_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|2494224_2494485_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|2494571_2495660_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|2495690_2496956_-	MFS transporter	NA	NA	NA	NA	NA
WP_032433071.1|2497010_2500118_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 4
NZ_CP009876	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 chromosome, complete genome	5228295	3036930	3087447	5228295	terminase,integrase,coat,holin,head,tRNA	Cronobacter_phage(23.08%)	70	3041421:3041442	3087618:3087639
WP_002909105.1|3036930_3037914_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_001386830.1|3038052_3038097_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3038220_3038577_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3038627_3038825_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004189469.1|3038917_3039460_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	6.3e-15
WP_002910026.1|3039463_3041392_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.3e-128
3041421:3041442	attL	GCACGAAAGAGCACATACAAAA	NA	NA	NA	NA
WP_023339729.1|3041757_3042075_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.5	8.1e-23
WP_038434979.1|3042074_3042314_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	49.4	1.4e-14
WP_038435080.1|3042455_3043463_-	acyltransferase	NA	NA	NA	NA	NA
WP_039110706.1|3043625_3047462_-	hypothetical protein	NA	A0A2H5BNP5	Klebsiella_phage	69.5	0.0e+00
WP_038434981.1|3047550_3050028_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	1.6e-198
WP_023328737.1|3050014_3050410_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
WP_023301685.1|3050406_3050877_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.6e-27
WP_038434982.1|3050876_3051353_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	5.1e-37
WP_038434983.1|3051395_3054047_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	41.5	3.5e-103
WP_071888997.1|3054108_3054441_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	54.5	2.3e-28
WP_038434984.1|3054526_3055057_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	85.8	2.6e-82
WP_038434985.1|3055237_3055942_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.8e-63
WP_038434986.1|3056009_3056774_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.4	6.1e-40
WP_032419302.1|3056833_3057055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023339086.1|3057057_3057441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032431569.1|3057437_3057806_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	1.0e-48
WP_038434987.1|3057808_3058171_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.0	4.8e-27
WP_038434988.1|3058170_3058344_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_038434989.1|3058343_3058724_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	3.1e-29
WP_038434991.1|3058726_3058966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038434992.1|3058998_3060054_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.0	1.5e-100
WP_016529582.1|3060050_3060512_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_038434993.1|3060511_3061867_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	52.9	1.1e-129
WP_130166094.1|3062116_3062884_-	hypothetical protein	NA	A0A2I7S4B6	Vibrio_phage	32.9	1.7e-34
WP_087744833.1|3062986_3063997_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.0	1.8e-111
WP_016529585.1|3063914_3065363_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	51.2	1.9e-119
WP_038434995.1|3065374_3066943_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	5.4e-301
WP_032432709.1|3066939_3067590_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	88.9	1.8e-101
WP_045326719.1|3068120_3068507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086372055.1|3068503_3068956_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.9	2.2e-66
WP_032432706.1|3068936_3069260_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	81.9	1.4e-41
WP_038434996.1|3069560_3069752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071814206.1|3069758_3069965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032432705.1|3070399_3071089_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.7	2.1e-63
WP_004884232.1|3071085_3071226_-	YlcG family protein	NA	NA	NA	NA	NA
WP_038434997.1|3071222_3071585_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	81.5	4.7e-51
WP_004141687.1|3071581_3071872_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	88.5	5.3e-45
WP_032432700.1|3071864_3072035_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	63.6	2.1e-09
WP_032432698.1|3072015_3072483_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	2.9e-32
WP_032432696.1|3072684_3072942_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	1.7e-26
WP_032432693.1|3073519_3073717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497179.1|3074486_3074780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032432691.1|3074779_3075067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178825.1|3075733_3075940_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	98.5	3.6e-32
WP_032432690.1|3075936_3076362_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	34.4	6.9e-09
WP_038434999.1|3076358_3076661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074181083.1|3076660_3078076_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.3	8.3e-184
WP_073545955.1|3078080_3078932_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.3	6.9e-85
WP_004151298.1|3078972_3079119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435002.1|3079153_3079438_-	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	56.2	1.3e-19
WP_038435003.1|3079458_3079671_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039110713.1|3079779_3080376_+	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	9.0e-07
WP_074403789.1|3080789_3080915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071888999.1|3080907_3081132_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	90.9	4.1e-29
WP_045326713.1|3081121_3081556_+	hypothetical protein	NA	G0YQE7	Erwinia_phage	55.1	3.1e-41
WP_016529276.1|3081626_3081911_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_032432680.1|3081926_3082772_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.5e-68
WP_032432679.1|3082768_3083449_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.5	6.7e-123
WP_038435005.1|3083445_3083874_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	5.8e-64
WP_032432677.1|3083870_3084527_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	88.0	2.1e-113
WP_032432674.1|3084523_3085600_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	69.5	4.7e-147
WP_004146321.1|3085596_3085815_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_038435006.1|3085816_3086041_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	48.6	4.7e-09
WP_023342699.1|3086223_3087447_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	59.0	4.3e-136
3087618:3087639	attR	GCACGAAAGAGCACATACAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP009876	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 chromosome, complete genome	5228295	3148436	3176210	5228295	plate,transposase,tRNA	Salmonella_phage(33.33%)	26	NA	NA
WP_002910404.1|3148436_3149693_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_038435007.1|3149963_3150575_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004898981.1|3150574_3151423_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3151606_3152554_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004200291.1|3152678_3154358_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_004175547.1|3154358_3155405_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3155627_3155903_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|3156175_3156760_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3156877_3157969_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016530916.1|3158051_3158381_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3158466_3159381_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032433200.1|3159512_3160928_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004175538.1|3160947_3161391_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_077255940.1|3161393_3161930_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_076026152.1|3161910_3162927_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032433205.1|3162956_3164720_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032433206.1|3164853_3168264_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032433208.1|3168247_3169405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004175522.1|3169408_3169675_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|3169972_3170158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076026135.1|3170301_3171270_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	7.9e-186
WP_076026143.1|3171602_3171830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955172.1|3172299_3173506_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_038435084.1|3174228_3174357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435010.1|3174382_3175156_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	28.2	1.2e-11
WP_076026135.1|3175241_3176210_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	7.9e-186
>prophage 6
NZ_CP009876	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 chromosome, complete genome	5228295	4472603	4523811	5228295	portal,terminase,integrase,lysis,plate,holin,tail,head,transposase,capsid,tRNA	Escherichia_phage(26.53%)	57	4482095:4482110	4515023:4515038
WP_002916879.1|4472603_4473617_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|4473854_4474070_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002917631.1|4474181_4475927_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|4476145_4477987_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|4478086_4478593_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_023343301.1|4478951_4479170_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_032433542.1|4479263_4479671_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
WP_032433545.1|4479711_4480872_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
WP_023343304.1|4480871_4481351_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
WP_032433547.1|4481367_4483806_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
4482095:4482110	attL	GCAATGATGGCATTTA	NA	NA	NA	NA
WP_014343413.1|4483798_4483918_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_004195711.1|4483950_4484226_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_032433549.1|4484286_4484802_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
WP_019724797.1|4484815_4485997_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_032433550.1|4486106_4487186_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
WP_032433551.1|4487197_4487926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125116968.1|4487931_4490262_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.2e-108
WP_076026137.1|4490197_4490785_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	56.8	4.1e-52
WP_032433553.1|4490792_4491701_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_014343405.1|4491705_4492053_-	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_015959011.1|4492049_4492691_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_045326985.1|4493033_4494077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032433555.1|4494405_4494855_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
WP_032433558.1|4494847_4495315_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
WP_032427129.1|4495277_4495436_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	3.8e-13
WP_032433560.1|4495410_4495842_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	1.1e-41
WP_032433563.1|4495838_4496336_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
WP_032433564.1|4496322_4496613_-|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
WP_019725382.1|4496617_4496821_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_009309691.1|4496820_4497327_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_072196895.1|4497423_4498143_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.2	3.1e-94
WP_025710540.1|4498170_4499229_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_032433566.1|4499302_4500157_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.3	9.6e-127
WP_009309687.1|4500322_4502092_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
WP_032433567.1|4502091_4503135_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
WP_032433569.1|4503647_4503842_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
WP_032433571.1|4503840_4504272_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
WP_032433573.1|4504410_4505361_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
WP_071557792.1|4505338_4505647_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
WP_162897204.1|4505683_4505839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048292468.1|4506267_4506708_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
WP_004178082.1|4506785_4508273_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_072198081.1|4508735_4510805_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.4	0.0e+00
WP_032433578.1|4510953_4511175_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
WP_032433580.1|4511174_4511402_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
WP_032433585.1|4511469_4511808_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_023343330.1|4511771_4511972_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
WP_032433586.1|4511979_4512489_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	6.4e-86
WP_001630878.1|4512519_4512783_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_032433588.1|4512912_4513488_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_032433590.1|4513487_4514486_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	4.5e-192
WP_032433591.1|4514508_4515756_+	hypothetical protein	NA	NA	NA	NA	NA
4515023:4515038	attR	TAAATGCCATCATTGC	NA	NA	NA	NA
WP_004152397.1|4516135_4517455_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	NA	NA	NA	NA
WP_004199234.1|4517704_4518586_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|4518873_4519653_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|4519649_4520675_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|4520781_4523811_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP009878	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-852	51622	185	51571	51622	tail,terminase,head,portal,capsid	Klebsiella_phage(84.91%)	54	NA	NA
WP_032408986.1|185_1151_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.6	1.9e-155
WP_040120186.1|1229_2729_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	66.6	1.9e-146
WP_040120187.1|2797_15502_-	carbohydrate binding domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.1	0.0e+00
WP_014228919.1|15564_16176_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_021462612.1|16191_16542_-	hypothetical protein	NA	K7PLP0	Enterobacteria_phage	38.1	3.9e-10
WP_040120188.1|16573_17284_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-136
WP_020803197.1|17285_18041_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
WP_040120189.1|18037_18376_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	87.5	1.2e-56
WP_169512886.1|18375_21786_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	71.6	0.0e+00
WP_023339374.1|21988_22354_-	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	88.5	8.1e-51
WP_014228913.1|22410_22872_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_017898997.1|22903_23305_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_017880258.1|23301_23691_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_014228910.1|23671_24010_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_020317538.1|24006_24324_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_047722540.1|24304_24502_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	78.0	1.8e-20
WP_023279519.1|24758_26045_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	84.3	1.7e-204
WP_040120191.1|26122_27043_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.6	2.5e-149
WP_040120192.1|27079_28339_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	3.6e-223
WP_040120193.1|28511_30221_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	94.7	0.0e+00
WP_032408957.1|30255_30690_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
WP_077254208.1|31191_31623_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	2.6e-40
WP_032408958.1|31619_31904_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
WP_032408959.1|31900_32263_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	93.3	2.0e-62
WP_032409000.1|32262_33033_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	53.0	2.5e-65
WP_032408961.1|33340_33640_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_117037470.1|33751_33946_-	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
WP_032408962.1|33893_34370_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	2.3e-61
WP_032408963.1|34386_34878_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	5.4e-82
WP_032408964.1|34874_35186_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	90.1	1.7e-44
WP_032408965.1|35244_36306_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	92.9	6.0e-171
WP_032408967.1|36623_36851_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_032409001.1|36862_37084_-	hypothetical protein	NA	O64358	Escherichia_phage	89.0	8.7e-32
WP_023339392.1|37254_37563_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339393.1|37562_37850_+	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339395.1|38201_38429_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_032408968.1|38449_38776_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
WP_023339397.1|38768_39014_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_023339398.1|39010_39487_-	hypothetical protein	NA	Q6UAU1	Klebsiella_phage	61.5	6.5e-16
WP_032408969.1|39614_40223_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	1.7e-98
WP_040120194.1|40634_41372_-	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	84.1	1.1e-118
WP_032408972.1|41361_41571_-	Cro/Cl family transcriptional regulator	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_032408973.1|41651_42260_+	helix-turn-helix domain-containing protein	NA	Q6UAU6	Klebsiella_phage	90.6	2.6e-102
WP_032408974.1|42510_46485_+	hypothetical protein	NA	Q6UAU7	Klebsiella_phage	95.4	0.0e+00
WP_032408975.1|46496_46745_+	hypothetical protein	NA	O64346	Escherichia_phage	96.3	4.4e-40
WP_040120195.1|46741_47071_+	hypothetical protein	NA	O64345	Escherichia_phage	72.5	1.9e-43
WP_032408977.1|47073_47406_+	hypothetical protein	NA	O64344	Escherichia_phage	85.3	7.2e-46
WP_032408979.1|47402_47738_+	hypothetical protein	NA	Q6UAV0	Klebsiella_phage	96.4	2.0e-59
WP_032408980.1|47807_48035_+	hypothetical protein	NA	Q6UAV1	Klebsiella_phage	98.6	6.4e-38
WP_077255427.1|48213_48378_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	73.3	4.6e-06
WP_032408981.1|48423_48588_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	92.6	1.8e-18
WP_032408982.1|48584_48815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015974471.1|48811_49594_+	Bro-N domain-containing protein	NA	Q6UAV5	Klebsiella_phage	100.0	4.2e-145
WP_040120196.1|49648_51571_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	94.5	0.0e+00
>prophage 1
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	0	2424	178563		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000843497.1|1455_1653_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004182013.1|1686_2424_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
>prophage 2
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	7517	9595	178563		Bacillus_phage(100.0%)	2	NA	NA
WP_001188930.1|7517_8198_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|8194_9595_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
>prophage 3
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	14110	14824	178563		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004182006.1|14110_14824_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 4
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	18281	22588	178563		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_004152097.1|18281_18707_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|18719_20009_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|20056_21808_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|21825_22188_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|22237_22588_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
>prophage 5
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	26248	105535	178563	integrase,transposase	Escherichia_phage(34.78%)	74	28627:28686	65803:66624
WP_019725651.1|26248_27244_-	hypothetical protein	NA	A0A2H4UVR4	Bodo_saltans_virus	34.9	2.1e-32
WP_015065500.1|27540_28191_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	1.8e-77
28627:28686	attL	TCGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|28691_29396_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011977766.1|30416_30752_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|30924_31206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|31259_31871_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_011977825.1|31867_32029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|32055_33048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|33392_34097_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|34727_35558_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|35688_36243_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|36386_37091_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|37201_37444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164043.1|37475_38126_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|38231_39431_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|39462_40347_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|40484_40892_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000509965.1|41653_42259_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_040120198.1|42353_45251_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	1.6e-181
WP_014386481.1|47658_48303_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|49083_49788_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|50001_51015_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|51170_51644_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|51864_52131_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|52273_53038_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|53298_54513_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|54546_55950_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001067855.1|56298_57003_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004186977.1|59747_60452_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	6.9e-139
WP_001097412.1|61799_62363_-	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_001348195.1|62386_62761_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001515734.1|62825_63389_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000046891.1|63631_63967_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001067855.1|65092_65797_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015065551.1|65884_66898_-	replication protein	NA	NA	NA	NA	NA
65803:66624	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGAAAAAATAGCTAAATGATATCCGTCAGGACGGCGGAGCCAGGGCCAGCTCCAGCTGATACAGGTTCTGAATGGCCAGCTGCTGCAGCCGCTCCGTTGTACACCAGTAAGCCTCGTCTGCCGGCATTGTCTTCAGGATATGAAGCGACATTTCGTGAATCTGGCGCTCACGAGAATATCTGGCCAGGCGGTTAGCTCGTTTACGTTCGGCGCCACGCTGCCGACGGAACCTCAGTGCATCGAGAGTTTTTTGACGGTACCAGCGCTCACGTGCTGCACACGGGGAGATCTCCTCATCTTCACGCAGAATCCCCTCCTCGATAAGACGACGACGCTCTTCGCTTTGCCGGAGCTTTTTTTGTTGTTCCGCATCAAGTTTTTCCAGATCCACTCCCAGCATCTGAAACCCTAACGCGGTGATATAGACGTATTTAGGAAGCCAGGTACGGGATTCCCTGTCCCAGCTATTTTCTTCAGATACAGCCAGGACACCAAAACGAACCTGTTCGTCAATCAACCGGGACAGACGTGAGACTGTTACCTCTGTTTCCGGAATAACTTTTCCATGACTGTCTTTCTGGCTGAGTTCTTTTGCCAGACGAGAAATACACATACCGACCGTCAGCTTGCCGGCATCACAGAAGCTGATCAGCACTGGCCAGATAGCATCCAGCAGACGTTGCTTTTCCGGCCGGAAGCCATACCGGCGGCCAGCCCGACGACGTTCCCTGACGTACAGCGGATGAAGCGATACGTGCATACGCA	NA	NA	NA	NA
WP_022631532.1|66890_67442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386216.1|67434_67512_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_022631531.1|67723_67993_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_023157996.1|68128_68608_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.2e-17
WP_015065549.1|68783_69092_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
WP_022631529.1|69088_69739_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_015065546.1|69794_70439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065545.1|70488_71091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065544.1|71251_71845_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_015065543.1|72000_72726_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
WP_015065542.1|72805_78064_-	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.8	8.0e-06
WP_072198073.1|80504_81194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831056.1|81386_82118_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_071604857.1|82368_82971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|85899_86976_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_148311843.1|86950_87190_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_072159542.1|87189_88569_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_016831053.1|88546_88990_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_004152678.1|89035_89593_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_004144400.1|89564_89804_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_004152677.1|89814_90567_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_016831051.1|90587_90914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052135631.1|90926_91130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076026135.1|91173_92142_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	7.9e-186
WP_015065558.1|92218_92473_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_023313940.1|92504_94460_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_039109927.1|94518_95166_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_015632509.1|95441_96431_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_016831047.1|96427_96829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831046.1|96863_97499_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004167468.1|97498_97888_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_016831045.1|97887_100527_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_023158008.1|100598_100997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831042.1|101437_101842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831041.1|101908_102220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386199.1|102220_102439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409654.1|102756_103167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386196.1|103298_103883_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_076026135.1|104566_105535_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	7.9e-186
>prophage 6
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	111991	115593	178563		Cronobacter_phage(25.0%)	7	NA	NA
WP_004182076.1|111991_112813_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_004182074.1|113645_114059_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|114059_114338_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|114327_114648_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152719.1|114728_114953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182070.1|114963_115176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|115236_115593_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 7
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	121670	130774	178563	transposase	Micromonas_pusilla_virus(20.0%)	10	NA	NA
WP_009310020.1|121670_122711_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_086937184.1|122880_124256_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_004182064.1|124455_124830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152639.1|124885_125212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152640.1|125208_125937_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004182061.1|125933_126365_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004182059.1|126409_128467_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	9.1e-22
WP_004182058.1|128536_128785_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004182056.1|128833_129376_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.3	9.3e-51
WP_004182054.1|130210_130774_-	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 8
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	133856	138095	178563		Pectobacterium_phage(33.33%)	5	NA	NA
WP_004152754.1|133856_134111_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118478.1|134347_134773_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004118481.1|135292_135523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024623221.1|135756_137268_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.1e-24
WP_004182047.1|137669_138095_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
>prophage 9
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	147770	156545	178563	integrase,transposase	Macacine_betaherpesvirus(50.0%)	7	138676:138690	164157:164171
138676:138690	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_004182039.1|147770_148742_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_004182032.1|148741_149908_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
WP_004182030.1|150659_151670_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|152387_153128_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_039109834.1|154271_155219_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
WP_071527918.1|155245_155557_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_068814619.1|155576_156545_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
164157:164171	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
>prophage 10
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	161853	170357	178563	holin,transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_004178088.1|161853_163851_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|164890_166098_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|167526_167958_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|168208_169684_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|169676_170357_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
>prophage 11
NZ_CP009879	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence	178563	173730	176877	178563		Leptospira_phage(100.0%)	1	NA	NA
WP_004098958.1|173730_176877_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
