The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	1310855	1354666	5298647	terminase,holin,plate,tRNA	Salmonella_phage(37.78%)	59	NA	NA
WP_004143010.1|1310855_1312241_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1312286_1312499_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1312500_1313367_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_071531921.1|1314838_1315174_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038435183.1|1315175_1315394_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	50.7	9.9e-12
WP_038435184.1|1315390_1316185_-	phage-like protein	NA	A0A077KCB2	Edwardsiella_phage	54.2	6.9e-79
WP_023312753.1|1316181_1316406_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
WP_023312754.1|1316931_1317225_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_071844745.1|1317698_1317893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158874.1|1317858_1318077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435185.1|1318280_1318766_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	45.6	6.4e-11
WP_023297269.1|1318837_1319107_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032413998.1|1319106_1319520_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	70.5	7.6e-45
WP_038435187.1|1319785_1320880_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.3	2.5e-31
WP_038435188.1|1320906_1321227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158880.1|1321300_1321522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029499288.1|1321514_1322306_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	52.1	2.8e-64
WP_052191534.1|1322298_1322865_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	78.2	2.6e-48
WP_038435189.1|1322864_1323245_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	95.8	3.0e-64
WP_032454813.1|1324283_1324553_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	80.7	4.6e-35
WP_162921945.1|1325104_1325272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025713730.1|1325417_1325726_+	DUF968 domain-containing protein	NA	I6XGC2	Burkholderia_virus	56.8	7.1e-24
WP_077255790.1|1325718_1326378_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	79.5	4.1e-101
WP_038435191.1|1326374_1326953_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	1.2e-48
WP_038435192.1|1327404_1327674_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	1.1e-31
WP_038435736.1|1327651_1328149_+	lysozyme	NA	A0A0M3ULD1	Salmonella_phage	83.6	5.3e-77
WP_038435193.1|1328145_1328496_+	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	41.5	3.8e-13
WP_023283349.1|1328934_1329204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|1329666_1330155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038435194.1|1330105_1331506_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	2.1e-187
WP_038435195.1|1331743_1333195_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	1.2e-190
WP_038435196.1|1333250_1333799_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.3	8.2e-47
WP_038435197.1|1333850_1335053_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	53.7	3.9e-110
WP_038435198.1|1335056_1335551_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	9.3e-50
WP_038435199.1|1335562_1336504_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.3e-137
WP_021441342.1|1336543_1336825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038435200.1|1336793_1337213_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	2.0e-40
WP_038435201.1|1337209_1337716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804053.1|1337715_1338120_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_025269951.1|1338112_1338664_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.5e-40
WP_025269950.1|1338665_1339817_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.1e-177
WP_025269949.1|1339827_1340268_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	2.1e-61
WP_000393949.1|1340271_1340721_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.3	1.1e-36
WP_016244729.1|1340762_1340915_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_038435202.1|1340904_1342827_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.1	6.2e-190
WP_038435203.1|1342826_1343402_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.5	2.9e-63
WP_025269944.1|1343477_1343705_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	5.6e-18
WP_038435204.1|1343707_1344772_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.6	9.8e-137
WP_038435205.1|1344774_1345125_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	82.2	2.1e-27
WP_141770821.1|1345127_1345574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038435207.1|1345636_1346293_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	58.3	2.5e-74
WP_004152573.1|1346294_1346648_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_038435208.1|1346647_1347847_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.1	1.4e-160
WP_038435209.1|1347843_1348617_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	50.6	3.1e-68
WP_038435210.1|1348616_1349390_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.7	3.0e-26
WP_052191535.1|1349411_1351496_+	CotH kinase family protein	NA	A0A286S1P0	Klebsiella_phage	52.5	3.2e-22
WP_052191536.1|1351508_1352588_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	41.7	8.0e-62
WP_179132354.1|1352736_1353084_+	hypothetical protein	NA	A0A286S1P3	Klebsiella_phage	74.4	2.7e-11
WP_038435212.1|1354348_1354666_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.0	1.3e-20
>prophage 2
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	1834303	1843777	5298647	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1834303_1835419_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1835415_1837356_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1837432_1837654_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1837979_1838297_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1838327_1840607_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1840737_1840956_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1841309_1842011_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_032421153.1|1842055_1843777_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
>prophage 3
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	2080212	2156018	5298647	head,protease,portal,terminase,transposase,capsid,integrase,holin,tRNA,tail	Klebsiella_phage(25.49%)	96	2076915:2076929	2100243:2100257
2076915:2076929	attL	GCGGCCACGGCTACG	NA	NA	NA	NA
WP_004150803.1|2080212_2081319_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2081375_2081834_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2081850_2082501_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2082741_2083992_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_000741346.1|2084105_2085248_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_000089156.1|2085237_2085474_-	excisionase	NA	NA	NA	NA	NA
WP_038435237.1|2085774_2085993_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
WP_052191537.1|2085985_2086630_-	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	39.4	7.5e-15
WP_023339691.1|2086634_2086823_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
WP_038435238.1|2087271_2087469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435239.1|2088263_2089049_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.4	7.1e-60
WP_038435240.1|2089048_2089348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_179132365.1|2089735_2089906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317570.1|2090337_2091033_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_001191665.1|2091130_2091373_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_000230161.1|2091407_2091869_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
WP_023317571.1|2092106_2092319_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_038435241.1|2092275_2093190_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	56.3	3.1e-30
WP_038435242.1|2093186_2093996_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	5.9e-110
WP_004184734.1|2094005_2094383_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_032437712.1|2094395_2095376_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.9e-134
WP_038435243.1|2095389_2095968_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	3.8e-50
WP_004206702.1|2096315_2096726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206701.1|2096722_2097295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057182115.1|2097478_2097778_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	84.8	1.5e-39
WP_032418741.1|2097774_2098314_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
WP_004190674.1|2098310_2098655_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2098651_2098927_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004177174.1|2099162_2099447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497197.1|2099579_2099852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038435244.1|2100176_2100422_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	1.6e-18
2100243:2100257	attR	GCGGCCACGGCTACG	NA	NA	NA	NA
WP_038435245.1|2100544_2101300_+	serine/threonine protein kinase	NA	I6PD73	Cronobacter_phage	47.8	3.6e-61
WP_038435246.1|2101296_2102037_+	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	47.1	1.3e-58
WP_038435248.1|2102422_2102659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038435249.1|2102668_2103010_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	2.7e-48
WP_023342855.1|2103193_2103658_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	1.7e-48
WP_029603006.1|2103611_2105354_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	2.8e-141
WP_029603007.1|2105353_2106661_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
WP_029603008.1|2106673_2107522_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	1.0e-128
WP_004177151.1|2107531_2108749_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.1	1.6e-196
WP_023342850.1|2108791_2109034_+	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.6e-10
WP_004177149.1|2109033_2109360_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	6.2e-42
WP_038435250.1|2109371_2109710_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	9.2e-41
WP_004177147.1|2109706_2110156_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.2	3.9e-63
WP_004177145.1|2110152_2110500_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	8.9e-31
WP_004177142.1|2110556_2111261_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.5e-80
WP_038435251.1|2111291_2111696_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	53.1	7.4e-29
WP_032409576.1|2111707_2112004_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.9	2.5e-26
WP_004177136.1|2112078_2112600_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	1.7e-09
WP_075212289.1|2112688_2113657_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_029603012.1|2113728_2117307_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	62.6	8.7e-246
WP_004177132.1|2117328_2117802_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004177130.1|2117788_2118265_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177128.1|2118277_2118658_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_038435252.1|2118654_2121732_+	kinase	NA	A0A286S259	Klebsiella_phage	62.1	0.0e+00
WP_187524103.1|2121643_2123872_+	CotH kinase family protein	NA	A0A286S1P0	Klebsiella_phage	72.4	2.0e-38
WP_052191540.1|2123884_2124964_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	41.8	2.1e-62
WP_179132354.1|2125112_2125460_+	hypothetical protein	NA	A0A286S1P3	Klebsiella_phage	74.4	2.7e-11
WP_038435253.1|2126689_2127061_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.1	1.0e-24
WP_004892953.1|2127239_2127392_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023279886.1|2127664_2128378_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038435254.1|2128374_2128767_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|2128759_2129083_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004140530.1|2129530_2129758_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|2129870_2131064_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032421220.1|2131131_2131467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|2131686_2131872_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|2131962_2132457_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190904.1|2132483_2132990_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|2133006_2133894_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|2133949_2135356_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|2135352_2136363_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|2136447_2136645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2137211_2137844_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004150790.1|2138459_2139146_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_032410895.1|2139258_2139423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435255.1|2139456_2140965_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|2141085_2141976_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038435256.1|2141982_2143767_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|2143840_2145049_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004892909.1|2145351_2146395_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|2147056_2147971_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|2148060_2148699_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|2148829_2149093_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2149152_2149278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|2149395_2149470_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2149469_2149571_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004179366.1|2149628_2150642_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004179368.1|2150942_2151182_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|2151171_2151510_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150778.1|2151514_2152024_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|2152169_2152862_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|2152893_2154069_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|2154176_2154971_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2154954_2155401_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_032421225.1|2155517_2156018_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	2307233	2334662	5298647	plate,transposase	Salmonella_phage(40.0%)	18	NA	NA
WP_073553528.1|2307233_2308577_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004176431.1|2308573_2309263_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032421272.1|2309259_2310966_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032421273.1|2310970_2311462_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_032421274.1|2311726_2314381_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.2e-97
WP_165451997.1|2314382_2316893_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	3.0e-19
WP_004179554.1|2316885_2318118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071527865.1|2318124_2318487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255787.1|2319173_2320142_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_077255791.1|2320143_2321139_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	9.0e-185
WP_087830521.1|2321424_2322522_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
WP_021469292.1|2323410_2323632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023282457.1|2323971_2325180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254212.1|2325176_2328635_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032421278.1|2328631_2330230_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190508.1|2331311_2331782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032421279.1|2331858_2333613_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004176418.1|2333576_2334662_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	2461733	2539793	5298647	head,portal,terminase,capsid,integrase,holin,protease,tail	Klebsiella_phage(34.04%)	86	2452247:2452263	2513491:2513507
2452247:2452263	attL	GATTGGCGTGCTGGCGA	NA	NA	NA	NA
WP_004224598.1|2461733_2462249_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
WP_002903398.1|2462541_2462700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880203.1|2463307_2463571_-	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	44.1	7.7e-11
WP_017880204.1|2463578_2464142_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	64.1	1.5e-67
WP_038435272.1|2464143_2464872_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.9	7.3e-35
WP_038435273.1|2465336_2466122_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.6e-62
WP_038435274.1|2466121_2466421_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.9	2.7e-12
WP_019705289.1|2466809_2467454_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_024176406.1|2467548_2467758_+	cell division protein	NA	NA	NA	NA	NA
WP_021313640.1|2467783_2468245_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	4.9e-69
WP_071888936.1|2468482_2468662_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	2.7e-15
WP_038435276.1|2468651_2469605_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	68.7	2.3e-89
WP_038435277.1|2469601_2470411_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.2	4.2e-108
WP_032412833.1|2470420_2470798_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_038435278.1|2470810_2471791_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	7.1e-134
WP_038435279.1|2471804_2472383_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_187524105.1|2472940_2473786_+	hypothetical protein	NA	A0A1B2IGT1	Erwinia_phage	73.1	1.1e-109
WP_038435280.1|2473788_2473938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048334541.1|2473975_2474095_-	small membrane protein	NA	NA	NA	NA	NA
WP_017145563.1|2474769_2475165_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|2475151_2475433_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_038435281.1|2475432_2476062_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.4	3.4e-105
WP_038435282.1|2476069_2476345_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	3.5e-06
WP_038435284.1|2477302_2477548_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	65.4	3.6e-18
WP_038435285.1|2477609_2477960_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	1.2e-51
WP_004884285.1|2478094_2478589_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_004899643.1|2478585_2480316_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.2	4.6e-301
WP_038435286.1|2480510_2481740_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.7	7.7e-202
WP_004884313.1|2481726_2482380_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_021313628.1|2482394_2483603_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_023302596.1|2483641_2483845_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.3e-07
WP_038435287.1|2483841_2484162_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	42.2	5.3e-14
WP_004216816.1|2484231_2484429_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	98.5	6.4e-26
WP_038435288.1|2484430_2484763_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	1.0e-55
WP_032437723.1|2484755_2485295_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	3.7e-92
WP_038435289.1|2485291_2485657_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	91.7	2.5e-60
WP_032432336.1|2485714_2486206_+|tail	phage major tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	5.0e-88
WP_032440655.1|2486249_2486603_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	98.3	1.4e-60
WP_038435290.1|2486635_2486899_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	97.7	1.5e-43
WP_052191542.1|2486895_2487327_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	94.3	4.4e-64
WP_038435292.1|2487388_2489824_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	92.5	0.0e+00
WP_032447774.1|2489823_2490303_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	6.6e-93
WP_023343209.1|2490289_2490772_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	97.5	2.5e-84
WP_017880229.1|2490781_2491162_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_038435293.1|2491158_2494227_+	kinase	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
WP_052191543.1|2494304_2496368_+	CotH kinase family protein	NA	A0A286S1P0	Klebsiella_phage	73.3	1.8e-38
WP_052191544.1|2496380_2497460_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	41.8	1.2e-62
WP_071888937.1|2498155_2498578_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.1e-26
WP_038435295.1|2498970_2500071_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.5	1.1e-114
WP_023313074.1|2500199_2501318_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_020805029.1|2501437_2502883_-	amidohydrolase	NA	NA	NA	NA	NA
WP_032414878.1|2502882_2504193_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_032415663.1|2504359_2505268_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004143055.1|2505369_2505933_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_032419018.1|2505929_2506736_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002903522.1|2506905_2507592_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151559.1|2507602_2508259_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_032421298.1|2508269_2509472_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_032421299.1|2509481_2510834_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_032421300.1|2510823_2511588_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004143067.1|2511580_2511970_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_015958361.1|2513029_2514274_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
2513491:2513507	attR	TCGCCAGCACGCCAATC	NA	NA	NA	NA
WP_023316278.1|2514298_2514646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152246.1|2514809_2516462_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_004148278.1|2516516_2518028_-	anion permease	NA	NA	NA	NA	NA
WP_016946652.1|2518669_2521447_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	1.2e-66
WP_016946653.1|2521514_2522465_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004176303.1|2522445_2523165_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_009308938.1|2523161_2524778_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176301.1|2524933_2525290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179719.1|2525453_2526374_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004190310.1|2526638_2528294_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_038435296.1|2528451_2529378_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015874762.1|2529367_2530270_-	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_015958367.1|2530269_2530887_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_016946654.1|2530890_2531850_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	89.5	2.3e-52
WP_032421303.1|2531986_2532787_-	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_032421304.1|2532786_2533620_-	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004143106.1|2533612_2533912_-	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143107.1|2533929_2534772_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_021313857.1|2534771_2536427_-	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_002903679.1|2536651_2537686_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903681.1|2538128_2538491_+	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903683.1|2538477_2538807_+	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903685.1|2538850_2538967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903687.1|2538980_2539793_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	2576145	2587031	5298647		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2576145_2576766_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_009485280.1|2576758_2578024_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	98.8	4.3e-232
WP_002903955.1|2578035_2578938_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2579198_2579960_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|2579980_2580841_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|2581137_2581398_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|2581484_2582573_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_032421308.1|2582603_2583869_-	MFS transporter	NA	NA	NA	NA	NA
WP_038435301.1|2583923_2587031_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 7
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	3234502	3269216	5298647	plate,transposase,tRNA	Tupanvirus(25.0%)	29	NA	NA
WP_002910404.1|3234502_3235759_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3236029_3236641_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004898981.1|3236640_3237489_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3237672_3238620_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_020324125.1|3238744_3240424_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_004175547.1|3240424_3241471_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3241692_3241968_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|3242240_3242825_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3242942_3244034_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_020323957.1|3244114_3244444_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3244527_3245442_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3245573_3246989_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004175538.1|3247008_3247452_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_020806091.1|3247454_3247991_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_020806092.1|3247971_3248988_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_023304842.1|3249017_3250781_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_038435429.1|3250914_3254325_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004180395.1|3254308_3255466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004180396.1|3255469_3255736_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_038435430.1|3255965_3256292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323962.1|3256480_3256720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217423.1|3257001_3257118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004180403.1|3257163_3258054_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.9	2.0e-10
WP_077255787.1|3259071_3260040_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_071888940.1|3260977_3262009_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_004180405.1|3262576_3265063_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004180406.1|3265524_3267222_-	OmpA family protein	NA	NA	NA	NA	NA
WP_038435433.1|3267225_3267879_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_015874925.1|3267875_3269216_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	3449560	3471502	5298647	transposase,integrase	Stenotrophomonas_phage(33.33%)	14	3442535:3442549	3473206:3473220
3442535:3442549	attL	ACCAGCAGGCGGCCA	NA	NA	NA	NA
WP_038435459.1|3449560_3450829_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	1.3e-74
WP_038435761.1|3450978_3451701_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004899253.1|3451712_3452609_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004899254.1|3452685_3453570_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004899257.1|3453569_3454427_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004899261.1|3454662_3457437_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020805474.1|3457864_3458896_-|transposase	IS630-like element ISSpu2 family transposase	transposase	NA	NA	NA	NA
WP_077255797.1|3459589_3460558_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	4.6e-186
WP_016530710.1|3460993_3461800_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_031590183.1|3463388_3464420_+|transposase	IS630-like element ISSpu2 family transposase	transposase	NA	NA	NA	NA
WP_004899294.1|3464901_3465765_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004899298.1|3465761_3465977_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_071888940.1|3468843_3469875_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_144340097.1|3470376_3471502_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
3473206:3473220	attR	TGGCCGCCTGCTGGT	NA	NA	NA	NA
>prophage 9
NZ_CP009863	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 chromosome, complete genome	5298647	3543767	3557254	5298647	transposase	Salmonella_phage(18.18%)	12	NA	NA
WP_077255787.1|3543767_3544736_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_077255791.1|3544737_3545733_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	9.0e-185
WP_038435495.1|3545904_3546909_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
WP_004144151.1|3547309_3547432_+	small membrane protein	NA	NA	NA	NA	NA
WP_004152483.1|3547855_3549022_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004175260.1|3549202_3549757_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_038435496.1|3549771_3550662_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	6.2e-28
WP_038435497.1|3550693_3551563_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_038435498.1|3551589_3552654_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_038435768.1|3552812_3554183_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.2	1.4e-31
WP_038435499.1|3554205_3555621_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	8.9e-53
WP_038435500.1|3555847_3557254_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 1
NZ_CP009864	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence	62589	0	46849	62589	transposase,integrase	Escherichia_phage(28.57%)	40	2606:2623	9790:9807
WP_001749988.1|2132_2702_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
2606:2623	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_000845048.1|3094_4108_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|4263_4737_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|4957_5224_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|5366_6131_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|6391_7606_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|7639_9043_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|9454_9661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|9665_10154_-	restriction endonuclease	NA	NA	NA	NA	NA
9790:9807	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
WP_001452736.1|10362_10674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|10709_11024_-	KikA protein	NA	NA	NA	NA	NA
WP_001749964.1|11020_11365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|11380_11731_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749963.1|11794_12529_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000440698.1|12537_12819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|12828_13122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|13171_13489_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_001749961.1|13488_16089_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_001749960.1|16106_16820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749959.1|16827_17055_+	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749958.1|17070_18111_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000646594.1|18329_19028_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000735066.1|19038_19923_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101710.1|19922_21083_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_000128596.1|21124_22120_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000792636.1|22119_22653_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210551.1|22826_22955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|26670_27990_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|28239_29121_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|29507_30287_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|30283_31309_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|31415_34445_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|34554_36270_+	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_001217881.1|37384_37942_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_014454105.1|38175_38730_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|38799_39588_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|39647_40472_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001067855.1|41970_42675_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012561167.1|43247_43613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|43612_46849_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
>prophage 2
NZ_CP009864	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPC-e4e, complete sequence	62589	58494	60188	62589		Morganella_phage(50.0%)	2	NA	NA
WP_000861760.1|58494_58935_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|58922_60188_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
>prophage 1
NZ_CP009865	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence	159360	4037	66092	159360	transposase,integrase	Salmonella_phage(42.86%)	55	29852:29897	53088:53133
WP_000654804.1|4037_5006_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_050484630.1|5194_6583_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_077255809.1|6703_7672_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	1.4e-171
WP_077255810.1|7807_8776_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.7e-180
WP_023288366.1|8964_9981_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023288364.1|11231_11768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900946.1|14088_15099_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_023287153.1|15828_16995_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_004117790.1|16994_17966_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004189163.1|19720_20161_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_040120112.1|20157_20508_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	8.9e-39
WP_004902302.1|20538_22131_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_032747566.1|22224_22680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031967.1|23428_24397_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	2.8e-13
WP_020477096.1|25660_26104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409750.1|26113_26521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014386528.1|26563_27523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181760.1|27519_28278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|28274_28598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072193960.1|28895_29864_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
29852:29897	attL	TCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCCT	NA	NA	NA	NA
WP_017901102.1|30196_31333_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016946352.1|31509_31764_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_016946353.1|31849_32917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107835450.1|33051_33213_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_004729622.1|33406_34159_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001567390.1|34399_35269_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023287190.1|35402_36626_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004729618.1|36811_37585_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001194072.1|37650_38352_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006687059.1|38417_39524_-	alkene reductase	NA	NA	NA	NA	NA
WP_040120148.1|39737_40067_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	5.7e-11
WP_000888080.1|40096_40435_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000210409.1|40439_41021_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|41162_41720_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012695450.1|41904_42489_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	2.0e-22
WP_144340103.1|45784_46195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004186900.1|46985_47870_-	hypothetical protein	NA	J9Q7H0	Salmonella_phage	43.2	2.6e-50
WP_014386535.1|49123_49582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437747.1|50421_50763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946198.1|50870_51083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902250.1|51204_51483_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_016946197.1|51473_51956_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077255812.1|55171_56140_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.5	9.1e-182
53088:53133	attR	AGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGA	NA	NA	NA	NA
WP_187524108.1|56157_56931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279773.1|56996_57965_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	2.9e-180
WP_023328906.1|58134_58440_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040120117.1|58441_58975_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_040120118.1|59167_60091_-	cation transporter	NA	NA	NA	NA	NA
WP_071888966.1|60351_60672_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.1e-19
WP_040120120.1|60717_62007_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	1.9e-166
WP_035897523.1|62019_62448_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_040120121.1|62733_64077_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004187019.1|64092_64377_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	6.4e-19
WP_004187025.1|64366_64615_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_077255813.1|65123_66092_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	9.4e-171
>prophage 2
NZ_CP009865	Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence	159360	71386	144093	159360	transposase	Bacillus_phage(20.0%)	59	NA	NA
WP_077255814.1|71386_72355_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	90.7	2.1e-170
WP_032415729.1|72956_73739_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	6.1e-136
WP_004181705.1|74921_75572_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004181707.1|75911_77156_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_040120125.1|77164_77944_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_004187003.1|77933_78740_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_004181711.1|78752_80336_+	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_004187005.1|80335_82081_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001101446.1|82626_83652_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023280920.1|83970_84939_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	1.1e-182
WP_004118347.1|85971_86406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152084.1|86621_88022_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|88018_88699_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|88753_89683_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|89687_90068_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_171888087.1|90107_90998_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|91003_92821_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_004181747.1|95507_97046_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
WP_004114612.1|97095_97443_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_004114613.1|97439_97817_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004118669.1|98668_99406_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|99439_99637_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|99677_102125_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|102251_102692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|102778_105925_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004098959.1|105935_107228_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|107341_107695_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|107723_109109_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|109298_109979_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|109971_111447_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004187113.1|111697_112129_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004187110.1|112276_112627_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_032426221.1|112812_113721_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000361404.1|114264_115287_-	helicase UvrD	NA	NA	NA	NA	NA
WP_004206609.1|115271_116834_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|116907_117324_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|117320_117551_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004206608.1|118016_118592_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_040120126.1|118599_119928_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_004206605.1|120112_121486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032426215.1|121496_122585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120127.1|123325_124249_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	90.9	5.3e-163
WP_040120128.1|125531_126290_+	3-oxoacyl-ACP reductase FabG	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.0	3.9e-15
WP_052191562.1|126521_128012_+	cytosine permease	NA	NA	NA	NA	NA
WP_040120129.1|128001_129246_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_040120130.1|129242_130628_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_052191565.1|130708_131422_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_102781620.1|131556_132450_-	allantoinase PuuE	NA	NA	NA	NA	NA
WP_175439479.1|132485_132845_-	RidA family protein	NA	NA	NA	NA	NA
WP_040120133.1|132844_133864_-	NAD(P)-dependent oxidoreductase	NA	A0A1D7XFE8	Escherichia_phage	25.4	7.7e-14
WP_040120134.1|133874_134753_-	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	28.2	5.2e-11
WP_040120135.1|134745_135630_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.4	1.2e-15
WP_052191566.1|135622_136435_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_052191567.1|136464_137076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040120136.1|137146_138391_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_123677978.1|138862_139537_-	MFS transporter	NA	NA	NA	NA	NA
WP_023288261.1|141182_141626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120159.1|141646_142396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654804.1|143124_144093_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
