The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	204458	270283	5310511	tRNA,plate,transposase,protease	Emiliania_huxleyi_virus(11.11%)	56	NA	NA
WP_022645195.1|204458_205811_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|205840_208273_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|208394_208880_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|208883_209909_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|210013_210469_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|210472_211261_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_022645196.1|211260_212409_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_022645197.1|212405_213002_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294757.1|213038_216521_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055746.1|216533_217493_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020966.1|217591_219733_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|219789_220179_+	VOC family protein	NA	NA	NA	NA	NA
WP_022645198.1|220243_221542_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062318.1|221590_221851_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|221837_222038_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|222203_222749_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635528.1|222745_223168_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239184.1|223181_223892_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_022645199.1|224047_224872_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_022645200.1|224924_226643_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094006.1|226753_227461_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|227457_227862_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|227979_228795_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|228834_229488_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593991.1|229480_230512_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|230699_231272_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_022645201.1|237041_237845_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_000648568.1|237841_238756_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|238996_239797_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211702.1|239873_240644_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|240691_242050_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|242121_242877_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|242910_243633_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|243629_244097_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|244161_244893_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_022645202.1|245427_246213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645203.1|246362_246830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645204.1|246844_247753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645205.1|247796_248279_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022645206.1|248302_249655_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122988716.1|249665_253100_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022645208.1|253208_254624_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_022645209.1|254628_255372_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_022645210.1|255368_258128_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	7.2e-83
WP_022645211.1|258136_258898_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022645212.1|258902_260234_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|260236_260761_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113710.1|260757_262038_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_022645213.1|262062_263145_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022645214.1|263108_264959_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022645215.1|264962_265376_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022645216.1|265382_266858_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_022645217.1|266908_267133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037391.1|267167_267668_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|268364_268883_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_085949836.1|269069_270283_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
>prophage 2
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	290427	373697	5310511	tail,integrase,terminase,protease,capsid,portal,holin,plate,head	Shigella_phage(41.38%)	92	284273:284288	316839:316854
284273:284288	attL	CATCTGCAACTGCTGG	NA	NA	NA	NA
WP_022645228.1|290427_291483_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
WP_022645229.1|291770_292874_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
WP_022645230.1|292885_294139_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	3.4e-96
WP_000051887.1|294343_295507_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|295733_296039_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_027662058.1|296038_296401_-	hypothetical protein	NA	U5P092	Shigella_phage	96.7	9.8e-65
WP_038431918.1|296391_296928_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	4.1e-99
WP_000016389.1|297472_297907_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549626.1|297878_298085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|298332_298959_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|299056_299257_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|299294_299846_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|300021_300201_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104972.1|300190_301132_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.7	8.6e-153
WP_072731119.1|301128_301623_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	9.6e-87
WP_021823605.1|301622_302276_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210155.1|302272_302599_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_000767113.1|302595_302985_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061418.1|303004_303802_+	KilA-N domain-containing protein	NA	S5FM84	Shigella_phage	99.2	2.2e-149
WP_023352842.1|303809_304799_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	1.2e-194
WP_080086273.1|304813_305194_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_000357056.1|305208_306228_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_000917724.1|306547_306751_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_038431922.1|306901_307954_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.6	1.3e-205
WP_001120490.1|308030_308357_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_021540768.1|308360_308837_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	98.1	4.9e-88
WP_001434542.1|308820_309201_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	87.2	2.6e-52
WP_038431925.1|309376_309946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038431926.1|310046_310382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038431927.1|310532_310883_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	93.1	8.3e-61
WP_000929182.1|311009_311504_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	5.6e-87
WP_122988188.1|311737_313234_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	2.8e-299
WP_000605613.1|313245_313428_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	96.7	1.1e-24
WP_038431929.1|313427_314669_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	3.4e-242
WP_001193631.1|314646_315297_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_038431931.1|315311_316517_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	2.4e-224
WP_000601366.1|316566_316767_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	98.5	4.5e-27
WP_038431933.1|316769_317093_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	9.7e-56
316839:316854	attR	CATCTGCAACTGCTGG	NA	NA	NA	NA
WP_000702402.1|317089_317500_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	9.1e-75
WP_000213502.1|317474_317981_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000779296.1|317977_318538_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	100.0	6.1e-106
WP_000497751.1|318546_318717_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_038431935.1|318700_320197_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	2.5e-271
WP_000090997.1|320196_320553_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_038431937.1|320549_320819_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	3.0e-42
WP_001459474.1|320960_322796_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.5	7.7e-307
WP_038431939.1|322856_324185_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	5.5e-246
WP_038431941.1|324181_325261_+|plate	baseplate protein	plate	M1FN92	Enterobacteria_phage	99.4	5.0e-205
WP_001459477.1|325260_325809_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	1.1e-96
WP_000424723.1|325808_326234_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	3.9e-81
WP_023307733.1|326220_327279_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	99.7	1.1e-201
WP_001459479.1|327269_327854_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	9.2e-113
WP_038431942.1|327857_328628_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.0e-51
WP_000368085.1|328627_329230_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	1.2e-99
WP_001106828.1|329201_329642_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_032164935.1|329663_330053_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	4.2e-13
WP_021570684.1|330082_330637_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.5	4.4e-88
WP_063077857.1|330875_331691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032336984.1|332167_333109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023150042.1|333361_334732_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_001019920.1|335914_336529_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|336778_337108_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001361803.1|337420_338131_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_022645232.1|338099_339743_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_022645233.1|339732_342258_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716409.1|342283_342952_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730982.1|343009_343597_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|343671_344214_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000866436.1|345297_345438_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|345437_345701_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|346065_346167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182338.1|346640_347783_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000860025.1|348027_348948_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001328123.1|349104_350031_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012311907.1|350230_351124_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001172285.1|351154_352144_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001174452.1|352170_353022_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_022645237.1|353587_357841_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_022645238.1|357961_358819_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022645239.1|359066_359936_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001355150.1|360095_360689_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474002.1|360700_360937_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_022645240.1|361045_362371_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	2.3e-111
WP_001361807.1|362597_363452_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_022645241.1|363977_364697_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023918.1|364707_366135_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_022645242.1|366127_366823_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_022645243.1|367065_367566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645244.1|367759_369448_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.2e-59
WP_022645245.1|369461_370934_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022645246.1|370947_371535_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131040.1|371663_373697_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 3
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	570422	636737	5310511	tRNA,tail,integrase,terminase,protease,capsid,portal,transposase,head,lysis	Enterobacteria_phage(61.11%)	76	581351:581397	628283:628329
WP_000912345.1|570422_571808_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143564.1|571843_572365_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|572472_572685_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|572686_573553_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|574024_574567_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_022645303.1|574786_575479_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_022645304.1|575509_578119_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255235.1|579926_580442_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|580444_581077_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
581351:581397	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|581410_582574_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|582772_583051_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_022645305.1|583098_583317_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	5.4e-34
WP_000548537.1|583708_583900_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|583872_584055_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000186848.1|584051_584732_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_022645306.1|584728_585514_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	6.9e-148
WP_020241285.1|585519_585816_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233579.1|585892_586099_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	83.8	7.1e-28
WP_000858975.1|586693_587383_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|587487_587718_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182772.1|587787_588327_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_000147901.1|588323_589343_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_000788890.1|589339_590041_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_000145902.1|590037_590340_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
WP_001070451.1|590407_590740_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|590831_590939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709074.1|590996_592523_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
WP_001351655.1|592634_592958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379700.1|593419_593776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072130332.1|593865_593967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|593963_594419_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|594418_594589_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|594581_594872_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|594868_595231_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|595227_595368_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_022645308.1|595453_595831_+	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	8.1e-54
WP_000780581.1|595986_596511_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592546.1|596703_597663_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_022645309.1|598014_598746_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|598933_599149_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135261.1|599148_599646_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_000092273.1|599642_600110_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|600097_600250_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|600601_601012_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|601068_601302_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|601690_602236_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027268.1|602210_604136_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|604132_604339_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001553867.1|604335_605937_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
WP_022645310.1|605917_607237_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001297109.1|607246_607579_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_022645311.1|607634_608660_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
WP_000158919.1|608701_609100_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|609111_609465_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000985119.1|609476_610055_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683105.1|610051_610447_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001547245.1|610454_611195_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
WP_001468358.1|611210_611633_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
WP_022645312.1|611614_612049_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_022645313.1|612041_614603_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_000847321.1|614599_614929_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_001152639.1|614928_615627_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_022645314.1|615632_616376_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_000090891.1|616312_616945_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_023909233.1|617005_620485_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_038431964.1|620552_621152_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_023909117.1|621216_623574_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	2.2e-117
WP_001204892.1|623573_623843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645319.1|623855_624896_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	91.9	2.1e-176
WP_000386784.1|625907_626657_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201842.1|626905_627859_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177457.1|628371_629133_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
628283:628329	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_022645321.1|629315_630206_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_022645322.1|630206_633179_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_022645323.1|633165_635403_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_022645324.1|635600_636737_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	955341	1029426	5310511	tail,integrase,terminase,protease,capsid,portal,plate,head,lysis	Salmonella_phage(68.0%)	80	955241:955267	989620:989646
955241:955267	attL	ATAAATTTCAGGCAACAAAAAACCCAC	NA	NA	NA	NA
WP_001595551.1|955341_956394_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
WP_022645415.1|956476_958153_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_022645416.1|958173_958770_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
WP_000188448.1|958865_959087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645417.1|959119_959629_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|959636_959837_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001311552.1|959800_960142_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244228.1|960209_960443_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001399246.1|960442_960670_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_000104157.1|960666_961524_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_022645418.1|961520_963935_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_001154434.1|964088_964277_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217562.1|964287_964521_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_022645419.1|964695_965754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645420.1|966287_968069_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022645421.1|968105_969140_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
WP_022645422.1|969139_970906_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_022645423.1|971048_971882_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742503.1|971898_972957_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_021534472.1|972960_973611_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000673523.1|973706_974171_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|974170_974374_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|974377_974593_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_022645424.1|974573_975086_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.0e-87
WP_022645425.1|975087_975465_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
WP_022645426.1|975461_975890_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_001595569.1|975985_976417_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_021522006.1|976409_976856_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
WP_022645427.1|976797_977604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993764.1|977707_978286_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_000177597.1|978282_978642_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_022645428.1|978628_979537_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_022645429.1|979529_980135_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
WP_022645430.1|980131_981673_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.2	7.6e-199
WP_022645431.1|981672_982275_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
WP_000046146.1|982408_983581_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|983590_984106_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_022645432.1|984160_984463_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
WP_000763311.1|984477_984597_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_022645433.1|984589_987667_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_022645434.1|987663_988149_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
WP_022645435.1|988145_989246_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
WP_000972391.1|989336_989555_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|989790_991476_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
989620:989646	attR	ATAAATTTCAGGCAACAAAAAACCCAC	NA	NA	NA	NA
WP_000681108.1|991745_992123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195231.1|992152_992410_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_022645436.1|992569_992857_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_022645437.1|992840_993563_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|993623_994526_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|994613_995090_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126075.1|995440_996553_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|996647_997781_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105436.1|997790_998744_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|998740_999586_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|999645_1000134_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149713.1|1000174_1001302_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|1001330_1002062_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464489.1|1002287_1002956_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001702.1|1002955_1003672_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|1003678_1004410_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1004427_1005156_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270657.1|1005373_1005889_-	lipoprotein	NA	NA	NA	NA	NA
WP_022645438.1|1006536_1008306_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_001160731.1|1008516_1008840_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|1008836_1009667_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|1009663_1010677_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022645439.1|1010775_1012206_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566375.1|1012216_1013218_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815366.1|1013254_1014973_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000178691.1|1015105_1016074_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_022645440.1|1016085_1017738_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_022645441.1|1017880_1018780_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|1019237_1019933_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|1020358_1022017_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001400542.1|1022013_1022970_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|1023120_1024236_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_022645444.1|1024232_1026179_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
WP_000410785.1|1026251_1026476_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1026798_1027119_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1027149_1029426_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
>prophage 5
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	1756793	1852075	5310511	tail,terminase,protease,portal,transposase,lysis	Enterobacteria_phage(38.6%)	103	NA	NA
WP_088895425.1|1756793_1758022_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_071586389.1|1759580_1759799_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	58.6	3.7e-19
WP_022645702.1|1764518_1766111_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|1766189_1767143_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194902.1|1767391_1768927_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	3.2e-16
WP_022645703.1|1768920_1769949_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222725.1|1769948_1770941_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172485.1|1770952_1771975_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_022645704.1|1772001_1772877_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558525.1|1772900_1773191_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_022645705.1|1773247_1774006_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_022645706.1|1774009_1774924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645707.1|1775120_1776572_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_022645708.1|1776799_1778218_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_022645709.1|1778356_1778716_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1778715_1779642_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156623.1|1779705_1781094_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366505.1|1781194_1782076_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645710.1|1782153_1783269_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1783418_1784609_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1784633_1785299_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_022645711.1|1785510_1785945_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1785965_1786349_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803527.1|1786380_1786599_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087204.1|1786629_1787529_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_022645712.1|1787723_1788911_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1789037_1789133_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592819.1|1789351_1790242_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
WP_022645713.1|1790496_1790889_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_022645714.1|1791254_1793300_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1793436_1794183_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_022645715.1|1794271_1794958_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1795134_1795338_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527788.1|1795373_1796834_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
WP_000347484.1|1796923_1798207_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1798811_1798925_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1798993_1799227_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1799543_1800134_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001546828.1|1800361_1800655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546829.1|1800697_1801738_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
WP_001546830.1|1801748_1802027_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_001546831.1|1802023_1804396_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001228249.1|1804460_1805060_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_022645716.1|1805127_1808607_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023277304.1|1808667_1809315_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_024946565.1|1809212_1809956_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
WP_001152382.1|1809961_1810660_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
WP_000447253.1|1810669_1810999_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_022645718.1|1810998_1814064_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_063815218.1|1814047_1814365_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
WP_001370402.1|1814373_1814760_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_022645720.1|1814820_1815564_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
WP_001079410.1|1815574_1815976_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
WP_000677120.1|1815972_1816563_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
WP_022645721.1|1816574_1816850_-	phage protein	NA	K7PH43	Enterobacteria_phage	98.9	3.8e-45
WP_001097050.1|1816842_1817166_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136588.1|1817251_1819279_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985958.1|1819223_1820732_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001072975.1|1820731_1820944_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934104.1|1820940_1823043_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_022645722.1|1823042_1823537_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000548593.1|1824089_1824296_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|1824591_1824765_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|1824937_1825093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|1825240_1825429_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1825439_1825652_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|1826016_1826514_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092966.1|1826510_1827044_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_000196128.1|1827040_1827352_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
WP_000839562.1|1827356_1827572_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|1827823_1828198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645723.1|1828369_1828798_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000562553.1|1829164_1829296_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762886.1|1830191_1831013_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
WP_000904111.1|1831027_1831384_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_001376415.1|1831396_1832446_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
WP_032140164.1|1832447_1832726_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000980999.1|1832792_1833044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|1833260_1833473_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001546200.1|1833517_1833625_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_022645725.1|1834487_1835510_-	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
WP_001151189.1|1835709_1836111_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
WP_000054505.1|1836151_1837117_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
WP_000705349.1|1837097_1837619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1837602_1837830_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1837907_1838315_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379591.1|1838507_1838660_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001241299.1|1838659_1839037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159335.1|1839005_1839206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001317853.1|1839708_1839897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|1839893_1840085_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_024946566.1|1840177_1842649_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_000005552.1|1842721_1842973_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876976.1|1843007_1844288_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001389342.1|1844289_1844418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|1844475_1845495_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1845506_1846721_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001304355.1|1846926_1847253_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705197.1|1847387_1847729_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1847763_1848324_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|1848326_1849037_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1849144_1849450_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_022645727.1|1849648_1852075_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 6
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	2396190	2404906	5310511		Enterobacteria_phage(42.86%)	8	NA	NA
WP_000735124.1|2396190_2397318_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
WP_001362820.1|2397327_2398566_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_001100791.1|2398597_2399146_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_000857549.1|2399150_2400029_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023627.1|2400086_2400986_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000699418.1|2400985_2402071_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_000183060.1|2402443_2403337_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116131.1|2403511_2404906_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
>prophage 7
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	2497020	2506462	5310511		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001329822.1|2497020_2498157_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
WP_022645869.1|2498153_2500154_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001296231.1|2500278_2500740_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2500780_2501251_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_012311742.1|2501297_2502017_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001334139.1|2502013_2503699_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001240398.1|2503920_2504652_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2504711_2504819_+	protein YohO	NA	NA	NA	NA	NA
WP_022645871.1|2504799_2505531_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_022645872.1|2505535_2506462_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 8
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	2900937	2907881	5310511	holin	Escherichia_phage(88.89%)	10	NA	NA
WP_000017552.1|2900937_2901090_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2901107_2901299_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|2901609_2902128_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_022645975.1|2902143_2902683_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	2.9e-44
WP_032152016.1|2902902_2903385_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	90.0	3.2e-71
WP_024946531.1|2903381_2904011_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	1.8e-114
WP_001546697.1|2904000_2904309_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
WP_001275999.1|2904295_2904700_-	membrane protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
WP_024946530.1|2904922_2905219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188253.1|2907623_2907881_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
>prophage 9
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	2912016	2946507	5310511	tail,integrase,terminase	Escherichia_phage(50.0%)	38	2909840:2909855	2947276:2947291
2909840:2909855	attL	TCGGGCGCGGCGGCGG	NA	NA	NA	NA
WP_032152018.1|2912016_2915406_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	3.4e-183
WP_024946525.1|2915405_2918153_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.5	1.2e-117
WP_000332877.1|2918152_2918728_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_000228790.1|2918727_2919192_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.1e-84
WP_001018550.1|2919191_2921663_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_000179260.1|2921662_2922268_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_000012377.1|2922324_2922660_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_024946524.1|2922670_2923108_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	94.5	1.9e-70
WP_024946523.1|2923159_2924146_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	94.5	2.5e-179
WP_001048075.1|2924160_2924856_-	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000133160.1|2924858_2925155_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_024946522.1|2925151_2926831_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
WP_000335899.1|2926845_2927052_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_024946521.1|2927813_2928419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946520.1|2928423_2929893_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	97.4	1.2e-289
WP_024946519.1|2929889_2930564_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_024946517.1|2931056_2931986_-	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	50.6	7.9e-66
WP_024946516.1|2932499_2933264_-	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	95.6	2.4e-68
WP_001593200.1|2933265_2933565_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.4e-56
WP_024946515.1|2933561_2934107_-	hypothetical protein	NA	J9Q748	Salmonella_phage	83.2	3.2e-83
WP_024946514.1|2934103_2934583_-	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	54.2	1.5e-28
WP_021558026.1|2934644_2934992_-	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	5.9e-59
WP_001066741.1|2935109_2935895_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_000086414.1|2935891_2936707_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_000402896.1|2936722_2936923_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
WP_001282459.1|2937073_2937304_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2937458_2938043_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001198620.1|2938196_2938349_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	100.0	5.4e-25
WP_001102254.1|2938351_2938651_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
WP_000802268.1|2938647_2939469_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A2R9YJH7	Escherichia_phage	100.0	1.2e-163
WP_000063834.1|2939465_2940407_+	recombinase RecT	NA	A0A2R9YJJ1	Escherichia_phage	100.0	4.5e-178
WP_000675390.1|2940456_2940705_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|2940862_2941114_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000163456.1|2941106_2941757_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	100.0	5.0e-128
WP_001077944.1|2941753_2941948_+	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	9.7e-27
WP_024946512.1|2941951_2943202_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	3.0e-238
WP_000138270.1|2943394_2944972_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|2945040_2946507_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
2947276:2947291	attR	TCGGGCGCGGCGGCGG	NA	NA	NA	NA
>prophage 10
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	4281535	4288260	5310511	integrase	Morganella_phage(50.0%)	12	4278639:4278651	4287075:4287087
4278639:4278651	attL	CACTCTCCACATC	NA	NA	NA	NA
WP_038432186.1|4281535_4282795_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	77.9	1.5e-192
WP_001000002.1|4282890_4283856_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.2	3.0e-07
WP_001090782.1|4283970_4284174_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000412541.1|4284173_4284605_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	5.1e-28
WP_001019370.1|4284617_4285451_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000042978.1|4285443_4285623_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_038432187.1|4285619_4286648_+	ash family protein	NA	NA	NA	NA	NA
WP_001065738.1|4286640_4286835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024673.1|4286831_4287095_+	hypothetical protein	NA	NA	NA	NA	NA
4287075:4287087	attR	GATGTGGAGAGTG	NA	NA	NA	NA
WP_000181940.1|4287091_4287313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038432188.1|4287305_4287908_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_038432190.1|4287918_4288260_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	63.3	1.1e-33
>prophage 11
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	4292876	4299427	5310511		Sodalis_phage(33.33%)	7	NA	NA
WP_000420670.1|4292876_4293338_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	9.9e-62
WP_000909176.1|4293331_4294009_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_038432194.1|4294008_4295430_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	52.5	8.2e-123
WP_038432195.1|4295429_4297535_+	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	37.1	6.1e-90
WP_000087355.1|4297554_4298169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678612.1|4298691_4298892_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	43.1	1.3e-05
WP_032288720.1|4298971_4299427_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	2.2e-45
>prophage 12
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	4788746	4876393	5310511	tail,tRNA,integrase,terminase,protease,capsid,portal,holin,plate,head,lysis	Enterobacteria_phage(24.29%)	105	4854564:4854579	4875817:4875832
WP_022646405.1|4788746_4789538_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
WP_022646406.1|4789551_4790007_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646407.1|4790003_4790711_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646408.1|4790707_4792318_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646409.1|4792320_4793037_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_038432214.1|4793029_4794007_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	47.8	1.4e-86
WP_022646411.1|4793997_4794357_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_000679403.1|4794455_4795157_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646412.1|4795166_4796207_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_001269711.1|4796194_4796404_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646413.1|4796403_4797357_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_022646414.1|4797356_4799732_-	hypothetical protein	NA	A4JWL0	Burkholderia_virus	26.0	1.0e-56
WP_015674804.1|4799833_4799962_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646415.1|4799921_4800239_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|4800289_4800814_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646416.1|4800813_4802238_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000875310.1|4802227_4802425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646417.1|4802421_4802877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|4803021_4803336_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000266448.1|4803348_4803954_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_022646418.1|4803956_4804244_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000619864.1|4804781_4805129_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
WP_022646419.1|4805183_4806533_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_022646420.1|4807057_4808707_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000757333.1|4809061_4809304_+	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_001296632.1|4809417_4810056_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_022646421.1|4810052_4810790_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022646422.1|4810789_4812886_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295279.1|4812932_4813211_-	periplasmic protein	NA	NA	NA	NA	NA
WP_000202902.1|4813424_4813835_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252058.1|4813928_4814819_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_022646423.1|4814833_4816378_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695389.1|4816531_4817722_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179165.1|4818086_4819202_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000973665.1|4819273_4820614_+	maltoporin LamB	NA	NA	NA	NA	NA
WP_000783444.1|4820856_4821777_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_022646424.1|4822004_4823585_+	SopA family protein	NA	NA	NA	NA	NA
WP_001308201.1|4823807_4824305_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455227.1|4824317_4825190_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017354.1|4825344_4827768_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002907.1|4827938_4828307_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646078.1|4828416_4829025_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001361471.1|4829097_4830423_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001296638.1|4830538_4830748_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416263.1|4830789_4831305_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_022646425.1|4831622_4832627_+	DUF2713 family protein	NA	NA	NA	NA	NA
WP_001300034.1|4832988_4833111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000458583.1|4833346_4833919_+	SocA family protein	NA	NA	NA	NA	NA
WP_014640052.1|4833948_4834335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908888.1|4834374_4834548_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	94.7	1.4e-21
WP_001093916.1|4834595_4834877_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_024946495.1|4834913_4835666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023908886.1|4835884_4836709_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_000135680.1|4836774_4837137_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_021530636.1|4837804_4838479_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	100.0	3.5e-132
WP_021527487.1|4838569_4838770_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.3e-31
WP_024946496.1|4838813_4839371_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
WP_071789194.1|4839546_4839726_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
WP_038432216.1|4839715_4840657_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.0	2.7e-138
WP_023908881.1|4840653_4841142_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.2	8.6e-80
WP_001401088.1|4841141_4841795_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_000210154.1|4841791_4842118_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767133.1|4842114_4842504_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_023908880.1|4842523_4843333_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	8.2e-152
WP_024946498.1|4843340_4844330_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
WP_023908878.1|4844343_4845096_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	4.2e-134
WP_001181554.1|4845288_4845492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946499.1|4845621_4845957_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	93.7	2.5e-54
WP_021543581.1|4845960_4846437_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
WP_023908876.1|4846433_4846877_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	94.6	2.3e-71
WP_021543580.1|4846915_4847290_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	96.0	1.8e-61
WP_000699783.1|4847407_4847611_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	4.9e-13
WP_024946501.1|4847676_4848027_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.2e-62
WP_000929184.1|4848153_4848648_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_065312442.1|4848881_4850378_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000605605.1|4850389_4850572_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_023908874.1|4850571_4851813_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	2.9e-241
WP_001193633.1|4851790_4852441_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_023908873.1|4852455_4853661_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	1.7e-222
WP_023908872.1|4853710_4853899_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	93.5	8.8e-25
WP_021543573.1|4853910_4854216_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	87.1	3.9e-38
WP_021543572.1|4854225_4854564_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	84.8	4.6e-48
WP_021543571.1|4854560_4855010_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	78.5	1.3e-61
4854564:4854579	attL	ACGGATTTTAGTCTGG	NA	NA	NA	NA
WP_021543570.1|4855006_4855351_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	94.7	1.9e-54
WP_023908871.1|4855410_4856115_+	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	90.6	1.8e-110
WP_021543568.1|4856129_4856501_+	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	90.2	3.1e-58
WP_021543567.1|4856524_4856803_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	80.4	1.5e-33
WP_021543566.1|4856861_4857203_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	64.5	7.6e-35
WP_024946502.1|4857248_4860491_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	88.8	0.0e+00
WP_023908869.1|4860483_4860825_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	66.4	7.9e-40
WP_021543563.1|4860824_4861523_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	98.3	1.8e-131
WP_032152077.1|4861527_4862271_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.4e-152
WP_000741576.1|4862168_4862816_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
WP_038432220.1|4862876_4866356_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001228252.1|4866423_4867023_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_022646430.1|4867087_4869436_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.3	9.5e-92
WP_022646431.1|4869432_4869714_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001595444.1|4869723_4870428_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
WP_022646432.1|4870438_4870726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217539.1|4870836_4871085_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332260.1|4871146_4872244_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	4.0e-210
WP_000543825.1|4872332_4873370_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891408.1|4873503_4873746_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_022646433.1|4873911_4874895_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|4874977_4876393_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
4875817:4875832	attR	CCAGACTAAAATCCGT	NA	NA	NA	NA
>prophage 13
NZ_CP009859	Escherichia coli strain ECONIH1 chromosome, complete genome	5310511	5067459	5132669	5310511	tRNA,integrase,protease,capsid,transposase,holin	Vibrio_phage(21.43%)	57	5106054:5106096	5118457:5118499
WP_001162184.1|5067459_5068812_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|5068866_5069253_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106226.1|5069297_5069762_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|5069921_5072060_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_038432234.1|5072453_5074109_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|5074158_5075580_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|5075698_5076646_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|5076830_5076884_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|5077024_5079721_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|5079926_5080313_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|5080385_5080847_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|5080859_5081795_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|5081798_5081933_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230276.1|5082213_5082609_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500698.1|5082739_5083453_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256673.1|5083523_5084117_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001305652.1|5084261_5084714_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_038432236.1|5084836_5086759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012914.1|5086815_5087820_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|5087981_5088398_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059402.1|5088542_5089046_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023908893.1|5089237_5090434_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416392.1|5090489_5093345_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|5093344_5093788_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|5094046_5095558_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584117.1|5095824_5096925_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|5096924_5098007_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_038432237.1|5098167_5099670_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001309159.1|5099747_5100746_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|5100812_5102132_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|5102193_5102958_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|5102981_5104013_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|5104229_5104793_+	gluconokinase	NA	NA	NA	NA	NA
WP_001309160.1|5104796_5105816_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
5106054:5106096	attL	ACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCGGCACCA	NA	NA	NA	NA
WP_001007918.1|5106706_5107006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038432238.1|5107444_5107984_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.0	6.4e-28
WP_038432108.1|5109987_5110176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005056.1|5110195_5110363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038432107.1|5110416_5111202_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_038432106.1|5111399_5111810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033557919.1|5111811_5112150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000898164.1|5112479_5112692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038432102.1|5112688_5113051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038432241.1|5113069_5114098_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_071884075.1|5114184_5114388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038432243.1|5114402_5116235_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.8	1.2e-30
WP_038432097.1|5116269_5116983_+	hypothetical protein	NA	I7I023	Enterobacteria_phage	50.2	2.7e-50
WP_038432244.1|5117064_5118336_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000050905.1|5122605_5122749_+	hypothetical protein	NA	NA	NA	NA	NA
5118457:5118499	attR	ACCGTAGAAATACGTGCCGGTTCGAGTCCGGCCTTCGGCACCA	NA	NA	NA	NA
WP_000483767.1|5122776_5124123_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|5124731_5125949_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|5125960_5127079_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|5127121_5127247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|5127299_5127557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|5128194_5129346_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000625671.1|5130195_5130609_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|5130671_5132669_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
>prophage 1
NZ_CP009860	Escherichia coli strain ECONIH1 plasmid pECO-824, complete sequence	121385	0	73501	121385	transposase,integrase	Macacine_betaherpesvirus(29.41%)	66	23116:23133	66837:66854
WP_001348615.1|945_1848_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|2714_3686_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|3685_4852_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_024946706.1|5439_6195_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	2.5e-142
WP_000016982.1|6968_7775_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|7775_8081_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|8082_8301_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000151784.1|8867_9380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542067.1|9413_10547_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000905949.1|10713_11487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528931.1|11499_12000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261278.1|12264_12495_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034046.1|12491_12908_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001144732.1|12952_16747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261286.1|17127_17358_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034044.1|17354_17771_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001128474.1|17845_19411_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361402.1|19395_20418_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000949004.1|21724_22639_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|22638_23466_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
23116:23133	attL	CAGGGTGATGTGATCCTG	NA	NA	NA	NA
WP_001101723.1|23462_24320_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|24316_25174_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|26416_26797_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000095526.1|27176_28370_-	MFS transporter	NA	NA	NA	NA	NA
WP_000602863.1|28505_30230_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000011908.1|30230_31178_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015721.1|31177_32920_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|32916_34194_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973519.1|34275_36477_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000361611.1|39482_40460_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066953.1|40744_41485_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_042344623.1|41605_41788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|42930_44100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|44295_44589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|44694_44970_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|44969_45254_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|45858_46611_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|46656_47622_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|47654_48035_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001077068.1|48059_48950_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000796505.1|49182_49377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338039.1|49921_50800_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|50789_51677_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|51687_52512_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|52517_53591_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|53583_54894_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067834.1|56813_57518_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_013362816.1|57840_59373_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_023909256.1|59599_59941_-	chaperonin	NA	NA	NA	NA	NA
WP_013362817.1|59901_60351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170852050.1|60865_61036_-	rRNA adenine methyltransferase	NA	E4ZFP9	Streptococcus_phage	92.7	3.4e-20
WP_013362818.1|60980_61718_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
WP_013362819.1|61843_61939_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001067855.1|62073_62778_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|62899_63805_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|63801_65040_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|65039_65624_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|66116_66881_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
66837:66854	attR	CAGGATCACATCACCCTG	NA	NA	NA	NA
WP_000130000.1|67107_67413_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|67423_68629_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|68784_68988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|69115_69955_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|69948_70296_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|70501_71290_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|71420_71894_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067834.1|72796_73501_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 2
NZ_CP009860	Escherichia coli strain ECONIH1 plasmid pECO-824, complete sequence	121385	78482	83469	121385	transposase	Escherichia_phage(66.67%)	6	NA	NA
WP_000255944.1|78482_79505_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|79504_80284_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_023144756.1|80759_80894_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_013023861.1|81764_81977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139341.1|82107_82668_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205718.1|82722_83469_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
>prophage 3
NZ_CP009860	Escherichia coli strain ECONIH1 plasmid pECO-824, complete sequence	121385	102941	112496	121385	transposase	Yersinia_phage(20.0%)	14	NA	NA
WP_001234469.1|102941_103763_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107535.1|103881_104169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275859.1|104193_104400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032143370.1|104401_104590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|105090_105249_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_085947770.1|105446_106816_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|106975_107695_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|107691_108126_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|108180_110139_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000005990.1|110204_110438_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290841.1|110500_111040_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032143370.1|111273_111462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016238251.1|111682_111907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|111932_112496_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
>prophage 4
NZ_CP009860	Escherichia coli strain ECONIH1 plasmid pECO-824, complete sequence	121385	118217	120103	121385		Vibrio_phage(50.0%)	3	NA	NA
WP_040123392.1|118217_118832_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.6	1.9e-23
WP_071884080.1|118830_119181_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|119227_120103_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
>prophage 1
NZ_CP009861	Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence	47560	0	6404	47560		Escherichia_phage(25.0%)	10	NA	NA
WP_000269912.1|253_601_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001259435.1|600_900_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_001523084.1|1063_1444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240784.1|1547_1973_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	74.5	3.6e-50
WP_001523087.1|2074_2335_+	helix-turn-helix domain-containing protein	NA	A0A248SLB9	Klebsiella_phage	54.9	7.2e-09
WP_033545979.1|2957_3146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033545977.1|3156_4326_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	73.2	6.2e-52
WP_000183351.1|4322_4514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523089.1|5458_5707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156167.1|5750_6404_-	ParA family protein	NA	A0A219YB79	Aeromonas_phage	32.5	9.2e-21
>prophage 2
NZ_CP009861	Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence	47560	9488	44372	47560	holin,plate,tail,portal,capsid,protease,terminase	Vibrio_phage(41.94%)	46	NA	NA
WP_001270825.1|9488_9821_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	39.8	2.9e-15
WP_001250512.1|9824_10202_+	hypothetical protein	NA	A0A2I7R3L8	Vibrio_phage	35.1	6.3e-06
WP_001705004.1|10371_11439_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000823235.1|11516_11798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521425.1|11794_12160_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
WP_001706266.1|12189_12348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040123394.1|12344_13028_+	hypothetical protein	NA	Q71T76	Escherichia_phage	66.4	1.2e-82
WP_001705006.1|13030_13375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040123395.1|13367_14087_+	ead/Ea22-like family protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	92.6	1.5e-69
WP_001271967.1|14465_14861_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	82.3	6.1e-52
WP_000254764.1|14847_15144_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	63.7	2.3e-27
WP_024188806.1|15127_15673_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	79.6	2.0e-85
WP_000147212.1|15669_15948_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.8	4.0e-18
WP_040123396.1|16624_17212_+	S-adenosylmethionine-binding protein	NA	G9L699	Escherichia_phage	76.5	1.8e-79
WP_040123397.1|17325_17595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222808.1|17594_17792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040123398.1|17866_18166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167745242.1|18352_18505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040123399.1|18554_18965_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	79.6	1.6e-39
WP_040123400.1|19199_19823_+	ParB N-terminal domain-containing protein	NA	A0A0E3JS81	Verrucomicrobia_phage	43.2	1.5e-33
WP_001372310.1|19822_21196_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_040123403.1|21236_21932_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	33.8	1.3e-28
WP_001185429.1|22488_23079_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
WP_001019009.1|23078_23630_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
WP_001406385.1|23635_25492_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	62.7	8.5e-237
WP_001523057.1|25503_25743_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	52.0	6.8e-14
WP_001523059.1|25739_27314_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.5	4.6e-191
WP_016240779.1|27306_28371_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.0	8.7e-77
WP_016240780.1|28380_28764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001523065.1|28784_29828_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	8.8e-74
WP_001523066.1|29828_30221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083980.1|30220_30565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609134.1|30561_31047_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	3.0e-16
WP_001523067.1|31047_31338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040123401.1|31337_32801_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	53.4	4.2e-146
WP_000070729.1|32817_33339_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	57.8	1.5e-50
WP_000450805.1|33348_33630_+|tail	phage tail assembly protein	tail	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
WP_001523070.1|33784_36577_+|tail	phage tail tape measure protein	tail	A0A097P6S4	Vibrio_phage	39.6	4.8e-18
WP_001705025.1|36777_37779_+	phage late control D family protein	NA	A0A067ZG47	Vibrio_phage	42.5	1.3e-69
WP_001523073.1|37781_38402_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.0e-29
WP_000635200.1|38398_38866_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001523074.1|38862_39183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040123402.1|39179_40304_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.2	4.9e-86
WP_001523076.1|40296_40878_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.0	2.1e-16
WP_001523079.1|40908_43755_+|tail	tail fiber protein	tail	Q858V4	Yersinia_virus	46.4	8.6e-172
WP_001523080.1|43754_44372_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	3.5e-86
>prophage 1
NZ_CP009862	Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence	80186	0	64377	80186	transposase,integrase	Escherichia_phage(20.0%)	58	23562:23621	60207:60816
WP_001749988.1|2132_2702_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|3094_4108_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|4263_4737_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|4957_5224_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|5366_6131_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|6391_7606_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|7639_9043_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|9454_9661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|9665_10154_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|10362_10674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|10709_11024_-	KikA protein	NA	NA	NA	NA	NA
WP_001749964.1|11020_11365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|11380_11731_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749963.1|11794_12529_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000440698.1|12537_12819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|12828_13122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|13171_13489_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_040123405.1|13488_16089_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_001749960.1|16106_16820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749959.1|16827_17055_+	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749958.1|17070_18111_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001257173.1|18193_18340_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_000646594.1|18329_19028_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000735066.1|19038_19923_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_000101710.1|19922_21083_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_000128596.1|21124_22120_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000792636.1|22119_22653_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210551.1|22826_22955_-	hypothetical protein	NA	NA	NA	NA	NA
23562:23621	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_004152397.1|26670_27990_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|28239_29121_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|29507_30287_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|30283_31309_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|31415_34445_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|34554_36270_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001217881.1|37384_37942_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_014454105.1|38175_38730_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|38799_39588_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|39647_40472_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|41171_42032_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001166628.1|43504_43960_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294660.1|44031_44382_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732276.1|44397_44673_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522993.1|44700_45108_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000281123.1|45146_46829_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_001277463.1|46846_47212_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|47208_47445_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|47510_47723_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001162012.1|47852_48410_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|48412_51385_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427619.1|51463_52468_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|53394_54231_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|54230_55034_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|55094_55910_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|56239_56416_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|56597_57602_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|59498_60203_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012561167.1|60775_61141_-	hypothetical protein	NA	NA	NA	NA	NA
60207:60816	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCAGTCCACGCCTCAGAACTTGTGGGCTCGCTTTTAAAAAGTTCCCGTCCGTCAGGGCTGGCGCAGGCGATTATGGAGGTGGGACGGGTCAACAAGACGCTGTACCTCCTCAACTACATTGATGATGAAGAATATCGTCGCAGGATACTGACTCAGCTTAACCGGGGAGAAGGCCGTCACGCCGTGGCAAGGGCGATCTGTTACGGCCAACGTGGTGAGATTAGAAAACGTTACCGTGAGGGGCAGGAGGATCAACTGGGTGCGCTGGGGCTTGTCACTAACGCAGTTGTATTGTGGAACACGCTTTATATGCAGGAAGCGCTATCACATTTGCGCAGCGCTGGTGAGATCCCGGAAGACGAGCATATCTCACGCCTGTCGCCACTGATGTACGGTCATATCAACATGCTGGGACATTATACGTTCACGCTGCCGGAAAATATTCTGAAGGGAGAGTTGAGGCCATTAAATTTCAATTCAAACAATGAATTATTGCCTTAACGTGGTTTTTTACACGATTGAACCTCGAACCCCTATATCGGCTAAAGCAC	NA	NA	NA	NA
WP_012561166.1|61140_64377_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
>prophage 2
NZ_CP009862	Escherichia coli strain ECONIH1 plasmid pKPC-629, complete sequence	80186	76091	77785	80186		Morganella_phage(50.0%)	2	NA	NA
WP_000861760.1|76091_76532_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|76519_77785_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
