The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009880	Pantoea sp. PSNIH1 chromosome, complete genome	3488376	70089	119101	3488376	integrase,tail,terminase,protease,head,bacteriocin	Cronobacter_phage(29.09%)	76	61923:61937	77947:77961
61923:61937	attL	ATAGCCTGAACGCGA	NA	NA	NA	NA
WP_039379169.1|70089_70698_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	30.4	2.1e-11
WP_039379170.1|70941_71880_+	membrane protein	NA	E7DYY8	Enterobacteria_phage	73.4	1.6e-114
WP_039379171.1|72212_73370_+|integrase	tyrosine-type recombinase/integrase	integrase	E7DYQ6	Enterobacteria_phage	70.1	8.9e-160
WP_039379173.1|73376_73700_-	phage repressor protein	NA	A0A2H4J4R6	uncultured_Caudovirales_phage	43.0	7.5e-24
WP_039379174.1|73699_73939_-	hypothetical protein	NA	A0A2H4J1N5	uncultured_Caudovirales_phage	58.2	1.8e-19
WP_039379175.1|74161_74413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379176.1|74777_77108_-	hypothetical protein	NA	B1GS50	Salmonella_phage	56.5	1.6e-54
WP_039379177.1|77165_79643_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	82.5	0.0e+00
77947:77961	attR	ATAGCCTGAACGCGA	NA	NA	NA	NA
WP_039379178.1|79629_80160_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	41.2	9.4e-24
WP_052246429.1|80235_80625_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	81.4	4.0e-56
WP_039379180.1|80638_81109_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	83.3	3.7e-72
WP_039379182.1|81108_81606_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	86.7	9.0e-85
WP_039379184.1|81605_85043_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	51.8	1.5e-215
WP_082032636.1|85101_85602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379185.1|85674_86349_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	59.8	2.6e-74
WP_144380221.1|86388_87108_-	hypothetical protein	NA	E5DV63	Deep-sea_thermophilic_phage	41.2	2.5e-27
WP_039379189.1|87207_87957_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	77.9	3.3e-99
WP_039379192.1|88024_88408_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	67.7	4.0e-48
WP_039379195.1|88404_88773_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	59.0	1.3e-35
WP_039379200.1|88775_89123_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	70.4	1.5e-41
WP_039379207.1|89291_89669_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	45.6	1.4e-21
WP_039379210.1|89671_90037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379213.1|90046_91114_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	9.4e-156
WP_039385590.1|91124_91559_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	2.8e-50
WP_039379224.1|91562_92960_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	68.5	7.7e-166
WP_071882918.1|92984_93944_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.4	6.5e-116
WP_039379230.1|93891_95349_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	72.9	6.3e-195
WP_039379233.1|95360_96824_-	phage DNA Packaging protein	NA	G0ZND4	Cronobacter_phage	91.9	1.4e-266
WP_039379235.1|96810_97380_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	75.1	1.9e-75
WP_039379237.1|97405_97585_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_039379239.1|97632_97869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039379242.1|97946_98162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379245.1|98245_98497_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_039379247.1|98529_98715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379250.1|98753_98990_-	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	41.6	1.1e-05
WP_039379253.1|99091_99631_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	78.2	7.2e-80
WP_039379256.1|100115_100388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379259.1|100384_100639_-	hypothetical protein	NA	S4TWQ5	Salmonella_phage	53.7	3.4e-11
WP_039379263.1|100638_101112_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	41.0	1.8e-26
WP_039379266.1|101108_101411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379268.1|101397_101793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379274.1|102163_102931_-	antitermination protein	NA	E5AGG3	Erwinia_phage	57.4	1.8e-76
WP_144380222.1|102930_103338_-	hypothetical protein	NA	A0A248SKX0	Klebsiella_phage	44.0	6.8e-22
WP_158448513.1|103306_103453_-	YlcG family protein	NA	A0A2H4JF91	uncultured_Caudovirales_phage	56.1	8.3e-07
WP_039379278.1|103445_103814_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A2H4J472	uncultured_Caudovirales_phage	89.9	7.7e-57
WP_039379280.1|103810_104101_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	96.9	4.2e-50
WP_082032637.1|104093_104249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379288.1|104445_104622_-	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	55.2	1.1e-10
WP_039379291.1|104618_104927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039379294.1|104923_105118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144380224.1|105120_105633_-	hypothetical protein	NA	Q9MC50	Pseudomonas_phage	43.0	6.5e-30
WP_039379297.1|105610_106033_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	73.3	7.2e-51
WP_071882895.1|106402_106585_-	DUF551 domain-containing protein	NA	A0A2D2W4W0	Escherichia_phage	41.3	1.4e-06
WP_144380225.1|106666_106834_-	protein ninD	NA	Q8HAF7	Salmonella_phage	58.1	7.1e-10
WP_039379307.1|106921_107266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144380226.1|107456_108890_-	AAA family ATPase	NA	Q716D2	Shigella_phage	71.9	2.4e-199
WP_039379309.1|108886_109741_-	hypothetical protein	NA	K7P7U6	Enterobacteria_phage	43.1	1.7e-46
WP_039379312.1|109914_110187_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	65.0	1.4e-18
WP_039379315.1|110325_110556_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	82.7	5.5e-29
WP_082032668.1|110636_111344_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	75.7	5.2e-102
WP_039379322.1|112458_112695_+	hypothetical protein	NA	Q3HQW9	Burkholderia_phage	41.9	9.4e-08
WP_039379324.1|112713_112920_+	DUF551 domain-containing protein	NA	W6MW45	Pseudomonas_phage	53.7	4.3e-17
WP_144380313.1|113072_113210_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_039379326.1|113337_113640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039379329.1|113639_114554_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	77.3	5.8e-138
WP_039379332.1|114550_115033_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	75.6	5.0e-64
WP_052246433.1|115039_115195_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.2	1.9e-09
WP_144380227.1|115239_115539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039379339.1|115535_115994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039379342.1|116060_116327_+	hypothetical protein	NA	A0A2H4EW60	Aeromonas_phage	44.3	1.1e-12
WP_039379344.1|116330_116522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039379348.1|116929_117172_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	83.3	6.8e-30
WP_039379351.1|117168_117708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039379355.1|117964_118165_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	59.1	5.9e-19
WP_052246434.1|118211_118790_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	49.2	9.3e-41
WP_039379359.1|118906_119101_+	excisionase	NA	K7P7V0	Enterobacteria_phage	69.8	3.3e-19
>prophage 2
NZ_CP009880	Pantoea sp. PSNIH1 chromosome, complete genome	3488376	369959	380356	3488376		uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_039379840.1|369959_371444_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.3	4.2e-21
WP_052246439.1|371465_372383_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039385624.1|372689_373679_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.5	2.5e-09
WP_039379842.1|374010_376566_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	27.0	4.3e-29
WP_039330767.1|376624_377617_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.6e-32
WP_039379844.1|377668_378808_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	1.9e-05
WP_039379847.1|378974_379601_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.6	2.4e-34
WP_039385625.1|379597_380356_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	1.6e-64
>prophage 3
NZ_CP009880	Pantoea sp. PSNIH1 chromosome, complete genome	3488376	592196	726316	3488376	plate,integrase,tail,terminase,portal,coat,head,capsid,tRNA,lysis	Erwinia_phage(56.82%)	149	605017:605033	707233:707249
WP_039380159.1|592196_592766_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_082032669.1|592855_593296_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_039380162.1|593318_594008_+	molecular chaperone	NA	NA	NA	NA	NA
WP_039380164.1|594007_596440_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_039380166.1|596432_597395_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_039380169.1|597434_598757_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	1.3e-58
WP_039380171.1|598959_599382_-	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_039380174.1|599387_600134_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_039380176.1|600362_601553_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_039380178.1|601650_602313_+	DedA family protein	NA	NA	NA	NA	NA
WP_039380180.1|602316_603234_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_039380182.1|603426_604254_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	43.8	1.7e-59
WP_039380184.1|604300_605728_-	cell division protein FtsP	NA	NA	NA	NA	NA
605017:605033	attL	GCAGGCGCAGGCGCACC	NA	NA	NA	NA
WP_039380186.1|605833_606571_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_039380189.1|606609_608880_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.6	1.7e-85
WP_039380192.1|609093_609858_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039380195.1|610019_610601_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039380197.1|610632_610941_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_039385639.1|610994_611894_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039380200.1|611923_613819_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.7	5.1e-96
WP_039380202.1|613864_614446_-	esterase YqiA	NA	NA	NA	NA	NA
WP_039380205.1|614449_615277_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_039380208.1|615319_615745_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_039380210.1|615741_616377_-	ADP-ribose diphosphatase	NA	NA	NA	NA	NA
WP_039380213.1|616590_618060_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_039380215.1|618199_618874_+	DUF1190 family protein	NA	A0A173GD21	Erwinia_phage	49.8	9.5e-45
WP_039380217.1|618881_620045_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.3	1.6e-87
WP_039385640.1|620097_620862_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_039380219.1|621073_621841_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_039380221.1|621880_622537_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.4	4.3e-42
WP_034828368.1|622966_623272_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_039380223.1|623311_624736_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.2	4.2e-34
WP_039380225.1|624817_627667_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_039380227.1|627696_629007_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_039380229.1|629211_629835_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_039380231.1|629972_631205_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.5	3.0e-81
WP_039380233.1|631223_632042_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_039380236.1|632232_632592_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_039380238.1|632699_633302_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_039385641.1|633333_634347_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	2.6e-107
WP_001144069.1|634627_634843_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_039380239.1|634963_636709_+	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	31.6	1.9e-44
WP_039380242.1|636958_638806_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	27.2	5.4e-34
WP_039380244.1|638847_639375_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_158448514.1|639760_639907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882898.1|639949_640177_-	transcriptional regulator	NA	F1BUT0	Erwinia_phage	74.7	2.5e-26
WP_039380247.1|640265_641417_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	64.9	2.4e-141
WP_039380249.1|641413_641941_-|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	75.3	1.2e-63
WP_039380250.1|641944_644425_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	70.4	1.7e-224
WP_082032642.1|644414_644558_-|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	64.3	1.0e-09
WP_144380234.1|644572_644857_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	73.9	8.6e-32
WP_039380255.1|644911_645421_-|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	84.1	4.7e-81
WP_039380257.1|645433_646603_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	87.7	5.1e-195
WP_052246448.1|646704_646938_-	hypothetical protein	NA	A0A0F7LDZ0	Escherichia_phage	46.2	3.6e-12
WP_082032670.1|646937_648245_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	61.7	1.2e-128
WP_039380259.1|648241_648850_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	78.0	4.6e-91
WP_039380261.1|648842_649751_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	81.5	3.4e-130
WP_039380266.1|649755_650106_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	76.7	4.4e-46
WP_039380269.1|650102_650687_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	80.9	7.1e-89
WP_039380272.1|650757_651207_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	70.9	7.7e-51
WP_039380274.1|651203_651671_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	73.0	4.2e-60
WP_039380277.1|651745_652195_-|lysis	phage lysis regulatory protein, LysB family	lysis	F1BUQ1	Erwinia_phage	70.1	6.1e-48
WP_039380279.1|652191_652704_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.9	1.8e-72
WP_144380319.1|652684_652894_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	52.2	1.4e-15
WP_039380282.1|652908_653115_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	75.8	6.2e-24
WP_039380285.1|653111_653579_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	76.8	1.9e-60
WP_039380288.1|653670_654339_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	77.0	1.0e-91
WP_039380291.1|654342_655425_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	81.4	5.6e-164
WP_039380294.1|655456_656305_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	70.7	1.9e-103
WP_039380297.1|656450_658214_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	93.5	0.0e+00
WP_039380300.1|658213_659245_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	86.0	1.8e-172
WP_039380302.1|659697_660429_-	hypothetical protein	NA	Q37850	Escherichia_phage	53.5	2.9e-71
WP_039380306.1|660589_660823_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	75.3	3.4e-26
WP_039380310.1|660835_661024_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	77.0	8.5e-20
WP_039380315.1|661213_663622_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	81.9	0.0e+00
WP_039380317.1|663579_664422_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	60.6	2.7e-89
WP_039380320.1|664418_664646_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	57.3	2.5e-18
WP_039380322.1|664645_664876_-	DUF2732 domain-containing protein	NA	NA	NA	NA	NA
WP_039380325.1|664939_665278_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	54.0	6.4e-26
WP_071882901.1|665241_665418_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	46.4	3.5e-07
WP_039380326.1|665428_665938_-	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	68.0	6.6e-59
WP_039380327.1|665972_666209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039380328.1|666299_666920_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	34.8	1.1e-34
WP_039380329.1|666925_667942_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.4	2.2e-114
WP_071882902.1|668270_668489_-	transcriptional regulator	NA	F1BUT0	Erwinia_phage	77.8	1.8e-29
WP_039380330.1|668575_669727_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	63.5	3.6e-137
WP_039380331.1|669723_670251_-|tail	phage tail protein	tail	F1BUT6	Erwinia_phage	79.5	1.1e-64
WP_039380332.1|670254_672735_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	71.5	1.5e-236
WP_052246449.1|672724_672850_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	60.0	5.1e-05
WP_039380333.1|672882_673161_-|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	70.8	8.7e-29
WP_039380336.1|673226_673736_-|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	80.0	3.2e-77
WP_039380338.1|673748_674918_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	88.4	3.7e-198
WP_052246450.1|674959_675577_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	74.1	3.5e-70
WP_052246451.1|676003_676240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039380343.1|676390_676981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039380345.1|677223_677544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039380347.1|677544_677967_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	42.1	2.0e-21
WP_039380350.1|677998_678394_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	45.6	1.2e-18
WP_039380353.1|678390_679578_-|tail	tail protein	tail	F1BUP1	Erwinia_phage	71.5	3.3e-133
WP_039380356.1|679574_680183_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	77.7	9.3e-92
WP_039380359.1|680175_681084_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	84.8	2.7e-135
WP_039380361.1|681088_681439_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	79.3	8.9e-47
WP_039380364.1|681435_682020_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	79.4	6.2e-85
WP_039380366.1|682092_682539_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	73.6	4.5e-51
WP_039380369.1|682535_683003_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	72.3	1.5e-57
WP_039380371.1|683110_683527_-|lysis	phage lysis regulatory protein, LysB family	lysis	F1BUQ1	Erwinia_phage	68.8	3.2e-43
WP_039380376.1|683523_684036_-	lysozyme	NA	E5G6N1	Salmonella_phage	76.9	2.8e-73
WP_039380379.1|684016_684235_-	membrane protein	NA	E5G6N0	Salmonella_phage	50.7	3.6e-14
WP_039380381.1|684237_684441_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	82.1	2.7e-27
WP_039380384.1|684440_684911_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	75.3	3.7e-56
WP_039380387.1|685003_685672_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	81.1	6.2e-97
WP_039380390.1|686820_687666_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	76.6	4.1e-114
WP_039380393.1|687816_689580_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	93.5	0.0e+00
WP_039380396.1|689579_690620_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	92.2	2.4e-188
WP_039380402.1|690965_691229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144380236.1|691280_691472_-	hypothetical protein	NA	F1BUR9	Erwinia_phage	79.4	4.3e-19
WP_039380409.1|691674_693924_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	79.4	0.0e+00
WP_039380413.1|693920_694742_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	61.5	2.3e-85
WP_039380418.1|694738_695101_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_039380422.1|695084_695300_-	hypothetical protein	NA	F1BUS2	Erwinia_phage	56.7	4.0e-13
WP_039380424.1|695299_695530_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	47.9	3.4e-10
WP_039385648.1|695598_695937_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	56.6	1.8e-28
WP_071882903.1|695900_696077_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	54.5	3.5e-07
WP_039380428.1|696088_696598_-	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	66.9	1.5e-58
WP_039380431.1|696628_696850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052246453.1|696951_697548_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	38.6	4.2e-28
WP_039380433.1|697549_698587_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.5	3.0e-122
WP_039380435.1|699087_700443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039380437.1|700547_700973_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_039380439.1|700972_701512_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_039380441.1|701486_702584_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_039380443.1|702538_704302_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_144380238.1|704319_704637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139239688.1|704684_706268_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_039380450.1|706264_709660_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
707233:707249	attR	GCAGGCGCAGGCGCACC	NA	NA	NA	NA
WP_039380452.1|709646_710801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882920.1|710804_711071_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_039380456.1|711752_712400_-	DUF2931 family protein	NA	NA	NA	NA	NA
WP_039380458.1|712484_713132_-	DUF2931 family protein	NA	NA	NA	NA	NA
WP_039380460.1|713128_714712_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_039380462.1|714714_717255_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.6	2.1e-12
WP_139239687.1|717371_717608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144380240.1|717641_718181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039380464.1|719072_721676_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.6	8.6e-94
WP_039380466.1|721811_722120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039380468.1|722174_722666_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_071882922.1|722631_724230_-	OmpA family protein	NA	NA	NA	NA	NA
WP_039380470.1|724331_724982_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_039380472.1|724978_726316_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 4
NZ_CP009880	Pantoea sp. PSNIH1 chromosome, complete genome	3488376	1632019	1645357	3488376	transposase,integrase	Enterobacteria_phage(50.0%)	14	1628840:1628870	1652038:1652068
1628840:1628870	attL	CCGTAGGGGCGCCATTTATGGCGCCCTGGCC	NA	NA	NA	NA
WP_039382360.1|1632019_1633279_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	45.0	2.3e-84
WP_039382363.1|1633275_1633953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039382366.1|1634231_1636550_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	58.4	5.2e-252
WP_158448523.1|1636559_1637003_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_039382372.1|1636896_1637163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882905.1|1637159_1637687_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	58.4	2.9e-25
WP_039382378.1|1637700_1637949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039382380.1|1637945_1638203_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	58.1	5.4e-17
WP_039382382.1|1638724_1639435_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	30.1	3.1e-14
WP_039382385.1|1639431_1639683_+	transcriptional regulator	NA	F1BUT0	Erwinia_phage	67.3	8.4e-15
WP_039385690.1|1640062_1641325_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	1.3e-47
WP_082032646.1|1641360_1642179_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_071882906.1|1642165_1642477_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144380260.1|1644152_1645357_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	72.9	3.9e-118
1652038:1652068	attR	GGCCAGGGCGCCATAAATGGCGCCCCTACGG	NA	NA	NA	NA
>prophage 5
NZ_CP009880	Pantoea sp. PSNIH1 chromosome, complete genome	3488376	1910186	1918901	3488376		Streptococcus_phage(28.57%)	9	NA	NA
WP_039382879.1|1910186_1911281_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.0	7.7e-113
WP_039382881.1|1911525_1912629_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.3e-59
WP_071668491.1|1912585_1913893_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.0	5.1e-87
WP_039382885.1|1914245_1914977_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	38.3	4.9e-47
WP_071668492.1|1915390_1915669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039382888.1|1915845_1916313_+	glycoside hydrolase family protein	NA	A0A2I7S0L3	Vibrio_phage	33.1	6.2e-19
WP_039382891.1|1916309_1916660_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.5	5.5e-20
WP_039382893.1|1916656_1916950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039382897.1|1917155_1918901_+	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	46.4	3.5e-152
>prophage 6
NZ_CP009880	Pantoea sp. PSNIH1 chromosome, complete genome	3488376	3151809	3163155	3488376	lysis	uncultured_Caudovirales_phage(41.67%)	16	NA	NA
WP_039384996.1|3151809_3152043_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	54.5	9.9e-18
WP_052246500.1|3152116_3152311_-	hypothetical protein	NA	A0A2H4J1N5	uncultured_Caudovirales_phage	60.3	1.9e-14
WP_071667925.1|3152325_3152499_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_039385001.1|3153091_3153292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039385003.1|3153895_3155716_-	amylovoran biosynthesis protein AmsF	NA	A0A1S6L3G8	Erwinia_phage	43.6	1.6e-139
WP_052246518.1|3155826_3156072_-	hypothetical protein	NA	Q8SBD8	Shigella_phage	45.2	8.0e-10
WP_039385005.1|3156341_3156854_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	68.9	6.9e-64
WP_039385006.1|3156855_3157086_-|lysis	lysis protein	lysis	A0A2H4JCI1	uncultured_Caudovirales_phage	59.2	6.3e-17
WP_039385009.1|3157258_3157627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039385011.1|3157847_3158603_-	antitermination protein	NA	E5AGG3	Erwinia_phage	52.9	2.2e-66
WP_039385013.1|3158697_3159399_-	DNA replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	58.3	2.4e-67
WP_039385015.1|3159395_3160265_-	replication protein	NA	A0A2H4J2W5	uncultured_Caudovirales_phage	68.5	4.0e-112
WP_039385017.1|3160412_3161102_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	87.8	2.1e-108
WP_039385019.1|3161562_3161775_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	40.3	9.9e-09
WP_039385021.1|3161854_3162217_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_039385023.1|3162366_3163155_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.7	6.0e-91
>prophage 7
NZ_CP009880	Pantoea sp. PSNIH1 chromosome, complete genome	3488376	3203220	3211638	3488376		uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_082032664.1|3203220_3203607_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.5	1.3e-11
WP_006785998.1|3203603_3204836_+	MFS transporter	NA	NA	NA	NA	NA
WP_006785996.1|3204884_3205220_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023202699.1|3205225_3205939_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	1.2e-95
WP_006785993.1|3205995_3206424_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	6.2e-50
WP_006785992.1|3206473_3207757_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.1	2.9e-175
WP_006785991.1|3207853_3208207_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.3	2.2e-21
WP_006785990.1|3208469_3208928_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_039385104.1|3209187_3211638_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.4	1.2e-134
>prophage 8
NZ_CP009880	Pantoea sp. PSNIH1 chromosome, complete genome	3488376	3340341	3350380	3488376		Enterobacteria_phage(42.86%)	9	NA	NA
WP_039385357.1|3340341_3340896_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.4	1.7e-47
WP_039385360.1|3340900_3341776_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.8	1.9e-106
WP_039385362.1|3341822_3342710_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	33.0	1.6e-23
WP_039385365.1|3342709_3343795_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	5.9e-97
WP_039385367.1|3344224_3345238_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	41.9	2.3e-71
WP_039385370.1|3345282_3346179_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.6	2.3e-46
WP_039385372.1|3346559_3347783_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_039385374.1|3347786_3347981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039385376.1|3348169_3350380_-	amylovoran biosynthesis protein AmsF	NA	W8CZM5	Erwinia_phage	40.1	1.0e-119
>prophage 1
NZ_CP009881	Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence	50272	0	9073	50272	transposase,integrase	Burkholderia_phage(50.0%)	7	2606:2623	9790:9807
WP_001749988.1|2132_2702_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
2606:2623	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_000845048.1|3094_4108_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|4263_4737_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|4957_5224_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|5366_6131_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|6391_7606_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|7639_9073_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
9790:9807	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP009881	Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence	50272	22119	22653	50272		Wolbachia_phage(100.0%)	1	NA	NA
WP_000792636.1|22119_22653_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
>prophage 3
NZ_CP009881	Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence	50272	26670	34524	50272	transposase	Staphylococcus_prophage(25.0%)	5	NA	NA
WP_004152397.1|26670_27990_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|28239_29121_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_001067855.1|29645_30350_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012561167.1|30922_31288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561166.1|31287_34524_-	conjugative relaxase	NA	U5J9B0	Bacillus_phage	27.3	2.4e-05
>prophage 4
NZ_CP009881	Pantoea sp. PSNIH1 plasmid pKPC-1c5, complete sequence	50272	46238	46679	50272		Morganella_phage(100.0%)	1	NA	NA
WP_000861760.1|46238_46679_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
>prophage 1
NZ_CP009882	Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence	87166	4246	63122	87166	plate,terminase,tail,protease,integrase	Escherichia_phage(80.0%)	52	856:869	26800:26813
856:869	attL	ACGACGGCACGCGG	NA	NA	NA	NA
WP_071882929.1|4246_5278_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	1.8e-63
WP_040113212.1|5886_6963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113213.1|7017_8529_-|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.6	2.1e-156
WP_040113214.1|8525_9863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082032673.1|10048_11176_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_052246519.1|11178_11760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052246520.1|11780_12188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113216.1|12504_12903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113217.1|12902_13481_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_040113218.1|13484_13736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052246521.1|14451_15291_-|protease	serine protease	protease	K4F991	Cronobacter_phage	58.8	1.4e-85
WP_082032674.1|17052_17268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113220.1|17248_18325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144380335.1|18469_18769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158448524.1|18768_19068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113223.1|19323_19911_-	norphogenetic protein	NA	A0A1B0VBR8	Salmonella_phage	46.9	1.2e-38
WP_158448525.1|20048_20210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144380339.1|20401_20650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113224.1|20658_21087_-	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	64.8	3.2e-46
WP_040113225.1|21117_27987_-	helicase SNF2	NA	A0A222YYH3	Escherichia_phage	52.5	0.0e+00
26800:26813	attR	CCGCGTGCCGTCGT	NA	NA	NA	NA
WP_040113226.1|28065_29760_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	62.9	9.3e-198
WP_040113227.1|29892_30201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158448526.1|30993_31134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113229.1|31427_32432_+	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	57.7	2.4e-105
WP_040113230.1|32742_33630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113231.1|33626_34118_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	59.9	3.3e-47
WP_040113232.1|34210_34513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113233.1|37469_37859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052246522.1|37855_40012_-	hypothetical protein	NA	A0A222YWA3	Escherichia_phage	46.3	9.0e-97
WP_040113234.1|40011_40629_-	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	59.6	4.7e-43
WP_040113235.1|40615_41071_-	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	51.7	7.8e-35
WP_052246523.1|41067_41385_-	hypothetical protein	NA	A0A222YZ46	Escherichia_phage	43.0	2.1e-10
WP_052246524.1|41505_42102_-|tail	tail assembly chaperone	tail	A0A218M4J2	Erwinia_phage	32.5	5.8e-22
WP_082032677.1|42101_42686_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	42.4	1.1e-25
WP_040113236.1|45487_45931_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	52.9	4.6e-32
WP_052246525.1|45992_47084_-	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	49.5	1.5e-68
WP_040113237.1|47093_48527_-|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	55.0	6.7e-149
WP_040113238.1|48539_48899_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	53.8	6.8e-34
WP_144380341.1|48902_51956_-	hypothetical protein	NA	A0A222YXR4	Escherichia_phage	37.5	9.3e-124
WP_040113242.1|52784_53603_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	58.8	9.6e-92
WP_040113243.1|53614_54337_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	50.8	2.2e-60
WP_040113244.1|54346_54898_-	hypothetical protein	NA	Q71TN7	Escherichia_phage	57.8	2.7e-50
WP_040113245.1|54900_55392_-	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	75.5	2.6e-68
WP_040113246.1|55402_55993_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	64.2	8.8e-63
WP_040113247.1|56036_56741_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	63.4	9.2e-51
WP_040113248.1|56752_58330_-	hypothetical protein	NA	A0A222YWC8	Escherichia_phage	59.4	2.6e-178
WP_040113249.1|58376_60116_-	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	66.2	3.5e-216
WP_040113250.1|60284_60719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113251.1|60817_61408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113252.1|61543_62068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113253.1|62070_62838_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	42.7	5.5e-33
WP_040113254.1|62837_63122_-	alanine racemase	NA	Q1MVI7	Enterobacteria_phage	60.2	6.4e-27
>prophage 2
NZ_CP009882	Pantoea sp. PSNIH1 plasmid pPSP-26e, complete sequence	87166	67458	84989	87166	tail	Escherichia_phage(41.18%)	28	NA	NA
WP_040113259.1|67458_68268_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	65.8	6.3e-104
WP_040113260.1|68264_69173_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	53.0	2.4e-83
WP_052246527.1|69239_69848_-	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	66.5	6.9e-63
WP_040113261.1|69844_70837_-	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	53.8	3.4e-99
WP_040113262.1|70840_71614_-	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	46.4	4.2e-57
WP_144380349.1|71610_71856_-|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	81.2	1.3e-31
WP_040113264.1|72395_73610_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	61.7	9.4e-128
WP_040113265.1|73602_73935_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	64.5	1.0e-36
WP_040113266.1|73931_74585_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	50.9	2.1e-57
WP_040113267.1|74812_75106_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040113268.1|75105_75423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882934.1|75513_76140_-	hypothetical protein	NA	Q5QBN4	Enterobacteria_phage	45.5	3.3e-36
WP_144380351.1|76888_77665_+	protein RepA	NA	Q38416	Enterobacteria_phage	55.5	1.4e-63
WP_144380343.1|78026_78371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113270.1|78625_78841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158448527.1|78897_79038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113297.1|79235_79676_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	1.9e-33
WP_040113271.1|79659_80925_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	52.1	4.9e-119
WP_158448528.1|81110_81248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144380345.1|81415_81601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071882931.1|81647_81914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113298.1|81952_82828_+	phosphoadenosine phosphosulfate reductase family protein	NA	S4TN48	Salmonella_phage	75.8	2.3e-136
WP_040113273.1|82824_83130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113274.1|83126_83483_+	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	46.7	1.9e-12
WP_052246533.1|83592_83793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113299.1|83870_84068_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_040113276.1|84232_84415_-	hypothetical protein	NA	K4FB87	Cronobacter_phage	55.3	3.0e-06
WP_040113277.1|84431_84989_-	hypothetical protein	NA	J9Q7G7	Salmonella_phage	65.4	1.4e-57
>prophage 1
NZ_CP009883	Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence	331227	120115	159427	331227	integrase,transposase	Escherichia_phage(28.57%)	44	118413:118427	146894:146908
118413:118427	attL	AAAAAAGTTACTTTT	NA	NA	NA	NA
WP_015063151.1|120115_121297_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_022652191.1|121513_121726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063153.1|121902_122544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652192.1|122835_123909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652193.1|124436_124829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652194.1|125238_125469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063155.1|125621_126827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063157.1|127845_128253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652195.1|128285_128489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652197.1|129715_129970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610398.1|130054_130366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|131236_132313_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012561110.1|132900_133737_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_012561111.1|133801_134200_-	VOC family protein	NA	NA	NA	NA	NA
WP_017384070.1|134243_135353_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.3	4.9e-30
WP_017384071.1|135387_135663_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_023280857.1|136874_137858_+	oxidoreductase	NA	NA	NA	NA	NA
WP_023280966.1|137920_138577_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384073.1|139000_139297_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023280967.1|140155_140644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087855188.1|140688_141838_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	5.4e-48
WP_157843391.1|141963_144678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|144882_145212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652361.1|145311_146772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063025.1|146953_147448_+	hypothetical protein	NA	NA	NA	NA	NA
146894:146908	attR	AAAAGTAACTTTTTT	NA	NA	NA	NA
WP_022652360.1|147505_147730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113306.1|147835_148567_+	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	1.6e-66
WP_040113307.1|148563_148872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113339.1|148905_149430_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.7	2.1e-44
WP_040113308.1|149460_150069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103178130.1|150259_150956_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	2.8e-132
WP_022652355.1|151001_151238_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	1.1e-05
WP_022652354.1|151271_151520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063021.1|151604_151985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652352.1|152184_152496_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_040113309.1|152500_152992_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_022652350.1|153561_153765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652349.1|153814_154039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113310.1|154073_154280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652347.1|154509_154863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113311.1|155170_155452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063019.1|155688_156294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589001.1|156727_158068_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000830285.1|158266_159427_-|transposase	IS30-like element ISCfr4 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	4.6e-39
>prophage 2
NZ_CP009883	Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence	331227	208485	304554	331227	integrase,protease,transposase	Escherichia_phage(37.93%)	89	266424:266438	304671:304685
WP_040113323.1|208485_209565_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.7	2.5e-39
WP_001040062.1|209566_210340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282603.1|210332_211475_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	1.5e-29
WP_040113324.1|211484_212543_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_040113325.1|212865_213447_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	2.2e-13
WP_040113326.1|213446_214604_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|214626_215082_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|215104_216145_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|216193_216772_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_015062975.1|216840_217416_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.6	5.6e-30
WP_032610453.1|217474_218125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062974.1|218140_219382_+	terF	NA	NA	NA	NA	NA
WP_032610522.1|219529_220210_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_032610449.1|220523_221153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610521.1|221301_221655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610447.1|221928_225270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610446.1|225579_225801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016246542.1|226007_226433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610444.1|226868_227399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062966.1|227619_228081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113327.1|228089_229730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062964.1|229834_230359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077258062.1|230570_231917_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_023205302.1|231975_232767_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004862033.1|232807_233644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024146422.1|233700_234264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246546.1|234630_234924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246547.1|234944_235244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062961.1|235559_236498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062960.1|236503_237019_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.9	3.2e-08
WP_015062959.1|237241_238669_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.4	9.5e-103
WP_040113328.1|238988_240308_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_024191726.1|240321_240525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610436.1|240579_241800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062955.1|241802_242615_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_040113341.1|243115_243781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040115233.1|243818_244271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001166628.1|244846_245302_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294653.1|245373_245769_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|245784_246060_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|246087_246513_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|246551_248237_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|248254_248620_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|248616_248853_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|248836_248956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|248918_249131_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001389365.1|249368_250133_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|250639_251140_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|251267_252107_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_012579084.1|252306_252963_-	quinolone resistance pentapeptide repeat protein QnrA1	NA	NA	NA	NA	NA
WP_000050481.1|253295_254837_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|255241_256081_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|256074_256422_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|256585_257377_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001102919.1|257789_258302_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002089484.1|258420_258885_-	AAC(3)-I family aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_032488579.1|258960_259515_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000845054.1|259675_260689_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001067855.1|260830_261535_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001620097.1|262507_263596_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|263682_263943_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_011117369.1|264240_265101_+	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|265121_265883_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|266143_267046_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
266424:266438	attL	TCGTGATGGTGTCGT	NA	NA	NA	NA
WP_011117368.1|267057_268323_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	4.6e-234
WP_002210516.1|268315_268936_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_001067855.1|269647_270352_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040113331.1|270514_271537_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_023205627.1|272372_273764_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077255001.1|273862_274831_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
WP_040113342.1|275092_275890_-	(S)-acetoin forming diacetyl reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.9	5.1e-13
WP_000654811.1|276051_277020_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_040113343.1|277223_278153_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_101743360.1|279452_280433_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_001189111.1|281135_282644_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_012561117.1|284618_287270_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.1	5.4e-152
WP_022651297.1|288210_289344_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	28.8	9.7e-10
WP_022649401.1|289775_290102_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_007897903.1|291187_291847_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023279881.1|292141_292978_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023279882.1|293053_293905_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017384065.1|294011_294887_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_158002126.1|294969_295902_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023279877.1|296162_297287_+	alkene reductase	NA	NA	NA	NA	NA
WP_023314856.1|297361_297691_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384060.1|299016_299445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|299448_301566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040113334.1|301553_303320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|303306_304554_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
304671:304685	attR	ACGACACCATCACGA	NA	NA	NA	NA
