The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	57854	116715	4105573	portal,plate,holin,capsid,integrase,tail,terminase,tRNA,head	Cronobacter_phage(60.0%)	62	67269:67286	111117:111134
WP_004245894.1|57854_58889_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_004245893.1|59321_60386_+	Abi family protein	NA	NA	NA	NA	NA
WP_004245892.1|60548_61886_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	29.6	1.3e-29
WP_004245891.1|62329_63445_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
WP_004250112.1|63428_64289_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_004245888.1|64285_65065_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_036907214.1|65181_66225_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_004245886.1|66357_66675_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
WP_004250113.1|66701_67775_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
67269:67286	attL	TTTATCTGTCACCACAAA	NA	NA	NA	NA
WP_004245882.1|67774_68293_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036907220.1|69762_70794_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	62.7	1.8e-124
WP_036907222.1|70798_71221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052124619.1|71235_71826_-	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	34.3	1.6e-27
WP_036907225.1|71975_72200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907228.1|72229_72739_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	50.3	1.0e-38
WP_036907232.1|72898_73414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052124620.1|73425_73773_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	42.7	1.5e-17
WP_036907235.1|73849_74101_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_052124621.1|74102_76304_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	56.4	1.1e-206
WP_036907238.1|76290_76491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146037939.1|76496_76988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907243.1|77079_77262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907246.1|77263_77572_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	60.4	2.1e-28
WP_036907248.1|77571_78603_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	64.1	2.1e-128
WP_036907251.1|78602_80390_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	65.8	2.6e-227
WP_036907254.1|80551_81388_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	42.5	5.1e-48
WP_036907256.1|81398_82430_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	69.9	1.7e-130
WP_036907259.1|82435_83140_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.9	1.3e-65
WP_036907264.1|83474_83927_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	53.3	2.4e-36
WP_103388839.1|83923_84400_+|tail	phage tail protein	tail	Q1I0Z6	Pasteurella_virus	25.5	2.9e-08
WP_036907267.1|84396_85095_+	phage protein	NA	F1BUL6	Cronobacter_phage	59.3	5.5e-64
WP_036907270.1|85109_86228_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	64.9	2.4e-133
WP_036907273.1|86227_86680_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	62.6	1.2e-48
WP_036907276.1|86694_86988_+|holin	phage holin family protein	holin	S4TP56	Salmonella_phage	51.2	1.1e-16
WP_036907278.1|86984_87317_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	72.3	1.4e-36
WP_036907280.1|87316_87691_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.2	9.6e-23
WP_036907284.1|87799_88069_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	49.4	1.3e-16
WP_165544879.1|88113_88257_+	hypothetical protein	NA	A5X9I8	Aeromonas_virus	60.9	3.9e-09
WP_052124622.1|88256_90773_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	43.1	6.7e-128
WP_036907286.1|90783_91119_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.0	1.6e-32
WP_036907287.1|91108_92293_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	65.6	4.5e-151
WP_052124623.1|92285_92834_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	64.1	1.6e-66
WP_052124624.1|92843_95054_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	59.3	4.7e-109
WP_036907289.1|95053_95674_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	48.1	4.2e-31
WP_036907292.1|95670_96393_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	32.8	2.3e-36
WP_036908741.1|96403_96964_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.6	8.1e-42
WP_036907295.1|96950_98597_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	55.2	1.5e-147
WP_036907298.1|100536_101214_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004245878.1|101312_101873_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004245877.1|102742_103678_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_004250120.1|103866_105141_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.0e-19
WP_004245875.1|105571_106165_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004249178.1|106185_107046_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_004245872.1|107045_107564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249182.1|108138_108417_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004245870.1|108437_108722_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004245869.1|108736_109015_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004249183.1|109082_110735_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_004245867.1|110761_111025_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_004245865.1|111032_112181_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
111117:111134	attR	TTTGTGGTGACAGATAAA	NA	NA	NA	NA
WP_004249184.1|112232_115661_+|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
WP_004249185.1|115764_116715_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
>prophage 2
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	392115	400965	4105573		Caulobacter_phage(50.0%)	9	NA	NA
WP_017827550.1|392115_393261_-	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
WP_004245609.1|393653_394238_+	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_036907412.1|394238_395381_+	TerD family protein	NA	NA	NA	NA	NA
WP_004245607.1|395405_395861_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004245605.1|395895_396921_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004249446.1|396988_397567_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245603.1|397643_398219_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004245602.1|398315_398996_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245601.1|399396_400965_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
>prophage 3
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	660959	677214	4105573	integrase	Morganella_phage(72.73%)	22	660909:660928	683787:683806
660909:660928	attL	GGGGGCATAATTGGGGGCAT	NA	NA	NA	NA
WP_036900290.1|660959_662171_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
WP_036907497.1|662383_663169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052124626.1|663161_663932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907500.1|664056_664275_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	6.6e-08
WP_036900286.1|664274_664670_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.8	7.3e-29
WP_036907503.1|664684_665278_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	76.1	1.5e-81
WP_080749553.1|665298_666303_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	49.2	9.1e-68
WP_072021534.1|666295_666469_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_036900280.1|666471_666729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907506.1|666725_666905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907509.1|666901_667111_+	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_036907513.1|667660_667849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162837557.1|667845_668019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907515.1|668018_668204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052124628.1|668203_668800_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	4.9e-29
WP_036907517.1|668814_669159_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	3.7e-45
WP_036907519.1|669155_671903_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.7	1.5e-226
WP_036907521.1|672222_672660_+	ProQ/FinO family protein	NA	A0A1W6JPI6	Morganella_phage	57.4	5.6e-14
WP_036900262.1|672734_673265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|673449_673623_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036900256.1|673622_673964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052124629.1|673980_677214_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	39.7	3.9e-96
683787:683806	attR	GGGGGCATAATTGGGGGCAT	NA	NA	NA	NA
>prophage 4
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	865052	917672	4105573	portal,protease,plate,holin,capsid,integrase,tail,terminase,lysis,tRNA,head	Salmonella_phage(28.21%)	66	874270:874294	905359:905383
WP_004248524.1|865052_866039_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_026090407.1|866299_866575_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_004244035.1|866882_867290_+	protein YgfX	NA	NA	NA	NA	NA
WP_004244033.1|867390_867909_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_004244032.1|868016_868958_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
WP_004244030.1|868991_869699_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244029.1|869708_871442_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	4.3e-65
WP_096043105.1|871613_872711_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_004244024.1|872720_874235_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
874270:874294	attL	AGCCATCGCAAGATGGCTTTTTTAT	NA	NA	NA	NA
WP_036907601.1|874403_875387_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	56.8	4.4e-99
WP_036907608.1|875453_875753_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	68.7	8.2e-33
WP_036907611.1|875856_876132_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	49.4	2.0e-17
WP_036907614.1|876140_876335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907615.1|876331_876601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907616.1|876597_876786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163773551.1|876892_877042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907618.1|877050_877446_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_036907619.1|877463_877721_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_036907622.1|877713_877935_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.0e-12
WP_036907625.1|877936_878245_+	DUF3850 domain-containing protein	NA	A0A218M496	Shigella_phage	43.2	2.9e-09
WP_036907629.1|878244_879072_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	8.8e-61
WP_036907632.1|879071_879395_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_036907635.1|879394_881773_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.6	2.0e-166
WP_036907641.1|881979_882663_+	hypothetical protein	NA	A0A1S5NQ18	Burkholderia_phage	33.3	7.2e-16
WP_146037940.1|882673_883207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907647.1|883702_884731_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.1	2.7e-136
WP_036907649.1|884730_886485_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	72.8	3.3e-259
WP_036907650.1|886657_887467_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	2.6e-65
WP_036907652.1|887482_888628_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.2	1.2e-127
WP_012368197.1|888627_889296_+|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_036907655.1|889373_889829_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.3	1.9e-28
WP_036907658.1|889828_890035_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	51.5	4.8e-16
WP_012368194.1|890054_890369_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036907661.1|890361_890766_+	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	57.4	6.1e-39
WP_052124630.1|890762_891266_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.4e-05
WP_036907663.1|891240_891678_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	49.3	3.2e-33
WP_036907665.1|891667_892303_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	4.4e-28
WP_036907668.1|892368_892995_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	60.8	4.1e-58
WP_036907670.1|892991_893330_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	49.5	8.4e-26
WP_036907672.1|893331_894240_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	1.6e-108
WP_036907674.1|894232_894844_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	1.1e-76
WP_163773550.1|894833_896786_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	33.5	1.2e-71
WP_036907677.1|896785_897406_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	47.7	7.1e-31
WP_036907681.1|897498_898671_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	71.1	1.1e-165
WP_036907684.1|898674_899190_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.7	5.0e-54
WP_052124631.1|899209_899557_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.3	6.0e-19
WP_072021537.1|899517_899691_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	49.1	1.8e-08
WP_036907687.1|899683_902518_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	39.5	4.8e-106
WP_036907694.1|902517_902982_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_036907697.1|902981_904079_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	55.4	3.5e-113
WP_012368178.1|904131_904350_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
WP_012368177.1|904381_905089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|905920_906130_-	hypothetical protein	NA	NA	NA	NA	NA
905359:905383	attR	AGCCATCGCAAGATGGCTTTTTTAT	NA	NA	NA	NA
WP_004244005.1|906437_906647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244004.1|907147_907696_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244003.1|908158_908611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017627941.1|908616_911232_+	sugar transporter	NA	NA	NA	NA	NA
WP_036907701.1|911289_912150_-	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_004244000.1|912216_913053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004243999.1|914140_914827_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_036907704.1|914901_915462_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004248514.1|915439_915787_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_012368173.1|915971_916217_+	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
WP_004248513.1|916329_916569_-	YecH family protein	NA	NA	NA	NA	NA
WP_004243991.1|916713_916929_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004243990.1|917180_917672_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 5
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	1195417	1214215	4105573	holin,lysis,plate	Burkholderia_phage(26.67%)	22	NA	NA
WP_004248368.1|1195417_1196233_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	3.5e-54
WP_004248367.1|1196614_1196914_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243635.1|1196916_1197321_+	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	3.8e-25
WP_036907811.1|1197317_1197767_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004248364.1|1197803_1198316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907813.1|1198324_1199812_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	3.2e-77
WP_012368088.1|1199822_1200275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243627.1|1200334_1200793_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_036907815.1|1200875_1203179_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	5.4e-15
WP_004243624.1|1203181_1203670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243623.1|1203682_1204003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243622.1|1203971_1204784_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243621.1|1204786_1205479_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243617.1|1205475_1205820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907817.1|1205812_1207000_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	8.5e-73
WP_004243615.1|1206996_1207653_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_036907820.1|1207658_1208864_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	3.1e-14
WP_017628013.1|1208967_1209147_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243612.1|1209715_1210258_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_004243611.1|1210373_1211150_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243609.1|1211153_1211771_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243608.1|1211782_1214215_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
>prophage 6
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	1585427	1632987	4105573	lysis,integrase,tail	Proteus_phage(21.74%)	74	1584701:1584716	1586425:1586440
1584701:1584716	attL	TTTAATGGAGAAAATT	NA	NA	NA	NA
WP_036895086.1|1585427_1586423_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.9	9.3e-73
WP_012367595.1|1586379_1586625_-	excisionase	NA	NA	NA	NA	NA
1586425:1586440	attR	AATTTTCTCCATTAAA	NA	NA	NA	NA
WP_036907939.1|1586621_1586942_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	51.9	1.3e-15
WP_162837621.1|1586934_1587111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907940.1|1587268_1587544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907941.1|1587536_1587764_-	hypothetical protein	NA	A0A1P8DTI8	Proteus_phage	71.2	5.3e-24
WP_036907942.1|1587816_1588401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907943.1|1588472_1588769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907944.1|1588833_1589514_-	hypothetical protein	NA	R9VWB9	Serratia_phage	54.8	9.8e-66
WP_185687740.1|1589516_1589690_-	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	94.7	5.6e-26
WP_036907945.1|1589757_1590186_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	74.6	7.3e-51
WP_036907946.1|1590175_1590982_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	94.3	3.9e-138
WP_036907947.1|1590974_1591793_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	96.3	3.8e-157
WP_004245998.1|1591789_1592044_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	7.2e-38
WP_036907948.1|1592171_1592354_-	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	83.3	9.7e-21
WP_087726527.1|1592431_1592596_-	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	57.4	1.8e-13
WP_036907949.1|1592630_1592906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247469.1|1593070_1593256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247470.1|1593252_1593405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049237116.1|1593590_1593806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907950.1|1593802_1594018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907951.1|1594026_1594338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907952.1|1594816_1595233_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_065424672.1|1595237_1595897_-	hypothetical protein	NA	A0A0P0ZCT8	Stx2-converting_phage	66.4	4.6e-44
WP_036907953.1|1595893_1596181_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	58.9	1.8e-29
WP_036907954.1|1596280_1597006_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	42.0	8.9e-41
WP_036907955.1|1597111_1597339_+	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
WP_036907956.1|1597481_1597829_+	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	2.6e-06
WP_172409601.1|1597925_1598099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895070.1|1598095_1598863_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_036907957.1|1598862_1600248_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_036907958.1|1600273_1600723_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	31.6	7.0e-12
WP_036908779.1|1600753_1601395_+	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	72.4	1.5e-84
WP_036907960.1|1601444_1601840_+	antitermination protein	NA	S5M7R9	Escherichia_phage	55.6	1.2e-31
WP_036907962.1|1601993_1602227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907964.1|1602367_1602562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907966.1|1602635_1603658_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	77.5	6.9e-132
WP_036907967.1|1603721_1604519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036904922.1|1604696_1605020_+	negative regulator GrlR	NA	NA	NA	NA	NA
WP_004247488.1|1605370_1605793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|1605846_1606116_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_017628809.1|1606115_1606586_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_012367623.1|1606567_1606726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907970.1|1606728_1607190_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	5.7e-25
WP_017628807.1|1607478_1607904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628806.1|1608026_1608266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628805.1|1608583_1609135_-	YfbU family protein	NA	NA	NA	NA	NA
WP_017628804.1|1609199_1609802_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.1e-64
WP_036907973.1|1609804_1611292_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	89.0	3.5e-265
WP_036907975.1|1611291_1612662_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.6	2.6e-118
WP_012367629.1|1612658_1613780_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	6.7e-104
WP_036907977.1|1613891_1614653_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
WP_012367631.1|1614666_1615620_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.2	5.3e-126
WP_107033975.1|1615622_1615907_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_012367632.1|1615946_1616426_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	3.8e-32
WP_004245967.1|1616428_1616779_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	3.8e-21
WP_004245966.1|1616780_1617362_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	51.6	1.0e-47
WP_036907978.1|1617358_1617760_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_036907980.1|1617805_1618462_+|tail	major tail protein	tail	G8C7Q3	Escherichia_phage	56.3	1.2e-57
WP_004245960.1|1618513_1618819_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
WP_052124632.1|1618833_1619121_+	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	47.9	2.6e-12
WP_036907982.1|1619149_1619356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247509.1|1619508_1619880_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	65.7	4.4e-36
WP_004247510.1|1619893_1620076_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	76.3	3.7e-20
WP_036907983.1|1620428_1621577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133177090.1|1621548_1622112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036907985.1|1622283_1622694_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	71.1	2.5e-48
WP_036907987.1|1622756_1625687_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	35.5	3.1e-132
WP_004245945.1|1625698_1625989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247516.1|1626351_1626693_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_004247517.1|1626689_1627433_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	58.6	7.1e-86
WP_004247518.1|1627429_1628140_+	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	62.0	8.9e-86
WP_004247519.1|1628136_1628742_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	56.8	1.9e-52
WP_036907990.1|1628793_1632987_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.4	8.4e-301
>prophage 7
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2019653	2090425	4105573	portal,protease,capsid,transposase,integrase,tail,terminase,lysis,tRNA,head	Morganella_phage(23.81%)	85	2049479:2049495	2096302:2096318
WP_036908061.1|2019653_2020862_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	1.1e-187
WP_036908062.1|2020884_2021301_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	3.8e-44
WP_004247923.1|2021419_2021851_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_004247922.1|2021961_2022825_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004242548.1|2022967_2023351_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004242544.1|2023585_2024362_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242542.1|2024379_2024577_-	ParD-like family protein	NA	NA	NA	NA	NA
WP_004242541.1|2024952_2025513_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004251481.1|2025575_2025818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242537.1|2025845_2026259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242536.1|2026627_2026909_-	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_004242534.1|2027253_2027475_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004247917.1|2027966_2028143_-	hypothetical protein	NA	A0A1W6JNZ9	Morganella_phage	60.0	9.1e-08
WP_036908063.1|2028359_2029355_-	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_004242531.1|2029639_2029810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367822.1|2030012_2030369_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_004247914.1|2030931_2031594_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004251487.1|2032152_2033379_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	2.0e-61
WP_004247912.1|2033391_2034033_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_004242524.1|2034676_2034991_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004251489.1|2035829_2036372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242521.1|2036395_2036593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367816.1|2036833_2037682_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004247909.1|2037771_2038146_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004242517.1|2038268_2038730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242516.1|2039220_2039679_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_004247907.1|2040010_2040223_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
WP_017628184.1|2040662_2041787_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072271826.1|2042981_2043134_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.0	2.0e-19
WP_036908064.1|2043549_2043924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908065.1|2044285_2044999_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_155641748.1|2045173_2045311_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	83.7	6.0e-15
WP_004247902.1|2045704_2045869_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
WP_052124634.1|2046309_2047377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157673314.1|2047397_2048678_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
2049479:2049495	attL	TTATCATTTGATAAATA	NA	NA	NA	NA
WP_036905765.1|2049767_2050073_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004245934.1|2050773_2051034_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.4	2.5e-17
WP_004247523.1|2051083_2051698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245936.1|2051699_2052068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052124635.1|2052061_2055787_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	51.8	3.4e-200
WP_004251558.1|2055786_2056185_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
WP_004251562.1|2056216_2056522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251564.1|2056533_2057115_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
WP_004251569.1|2057114_2057711_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	4.6e-51
WP_036908067.1|2057711_2060987_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	4.9e-54
WP_004242485.1|2061113_2061305_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_036908069.1|2061329_2061608_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004251577.1|2061604_2062021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251580.1|2062085_2062751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251583.1|2062760_2063102_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251585.1|2063107_2063581_-	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_004251588.1|2063570_2063900_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_004251590.1|2063899_2064199_-|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_004251594.1|2064237_2065404_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
WP_004251596.1|2065407_2066076_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_012367784.1|2066093_2067362_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_036908071.1|2067361_2069095_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.3	2.0e-147
WP_036905779.1|2069048_2069516_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_001967215.1|2069853_2070192_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905787.1|2071088_2071550_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_162837602.1|2071552_2071711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900946.1|2071692_2072163_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_036905789.1|2072162_2072432_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036894738.1|2072875_2073127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908073.1|2073279_2073708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908075.1|2074123_2075050_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|2075153_2075489_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004247148.1|2075812_2076334_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247137.1|2076735_2076948_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_036908076.1|2077287_2077686_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	3.5e-31
WP_036908077.1|2078189_2079269_-	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	39.6	1.4e-50
WP_036908078.1|2079568_2080594_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	3.0e-82
WP_036908080.1|2080590_2081397_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	1.2e-89
WP_052124643.1|2081418_2081934_-	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	4.6e-23
WP_036908081.1|2082491_2082671_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
WP_036908083.1|2082932_2083409_-	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
WP_006537203.1|2083446_2083653_-	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_017628378.1|2083753_2084386_+	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_036908086.1|2084670_2085195_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	60.5	1.1e-53
WP_017628380.1|2085280_2085532_+	excisionase	NA	NA	NA	NA	NA
WP_036908088.1|2085506_2086640_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	6.5e-155
WP_004251822.1|2086749_2088003_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_004247119.1|2088141_2088771_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247118.1|2088763_2089216_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_036908090.1|2089321_2090425_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2096302:2096318	attR	TTATCATTTGATAAATA	NA	NA	NA	NA
>prophage 8
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2166822	2205867	4105573	plate,holin,integrase,terminase,lysis,head	Burkholderia_phage(27.03%)	49	2171766:2171781	2206239:2206254
WP_036908115.1|2166822_2167608_+	glycosyltransferase family 25 protein	NA	A0A2P1EMF9	Moumouvirus	30.0	1.3e-08
WP_036908117.1|2168987_2169644_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.9	3.4e-39
WP_036908118.1|2169640_2170828_-|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	40.3	2.0e-69
WP_036908119.1|2170820_2171165_-	phage related-protein	NA	NA	NA	NA	NA
WP_036908120.1|2171161_2171854_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
2171766:2171781	attL	TCTGTATTCATCATCA	NA	NA	NA	NA
WP_036908121.1|2171856_2172672_-	hypothetical protein	NA	A1Z005	Burkholderia_virus	24.9	1.4e-10
WP_004250595.1|2172637_2172955_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	7.4e-08
WP_036908123.1|2172954_2173482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908125.1|2173478_2175773_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.7	1.5e-17
WP_004250588.1|2175856_2176315_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_004250586.1|2176355_2176808_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_036908126.1|2176818_2178306_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.7	1.1e-82
WP_036908128.1|2178816_2179188_-	phage protein	NA	NA	NA	NA	NA
WP_036908129.1|2179187_2179646_-	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	38.6	5.5e-12
WP_080726878.1|2179645_2180077_-	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.0	3.3e-11
WP_036908133.1|2180079_2180421_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	33.6	6.1e-08
WP_036908134.1|2180490_2181558_-	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	38.9	2.6e-52
WP_036908136.1|2181557_2182055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908138.1|2182054_2183317_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	54.3	9.4e-46
WP_036908814.1|2183313_2184027_-|head	head protein	head	Q6IWU3	Burkholderia_phage	40.0	1.5e-37
WP_036908140.1|2184064_2185567_-	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	44.2	5.5e-101
WP_036908142.1|2185571_2187176_-	bacteriophage TerL protein	NA	A9YWZ6	Burkholderia_phage	63.9	6.1e-199
WP_036908144.1|2187383_2188394_-|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.6	2.1e-35
WP_036908146.1|2188455_2189112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908148.1|2189112_2189556_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	38.2	3.7e-13
WP_049199495.1|2189561_2189915_-	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	78.7	2.5e-41
WP_036908815.1|2189946_2190252_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_180949078.1|2190315_2191368_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	72.2	1.6e-144
WP_036908152.1|2191510_2191708_-	TrmB family transcriptional regulator	NA	A0A0P0ZDH6	Stx2-converting_phage	63.5	5.4e-09
WP_036908154.1|2191870_2192404_-	antiterminator	NA	M1FPN0	Enterobacteria_phage	50.6	8.8e-38
WP_036908156.1|2192391_2192703_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	67.7	1.0e-33
WP_036908158.1|2192714_2193308_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.7	1.1e-57
WP_036908160.1|2193382_2194594_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_036908161.1|2194607_2195276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101495146.1|2195469_2196846_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_036908163.1|2196835_2197429_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.1e-44
WP_036908165.1|2197421_2198249_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	47.4	1.2e-36
WP_036908167.1|2198250_2198475_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.8e-16
WP_020945464.1|2198492_2198948_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	9.9e-30
WP_036908169.1|2198988_2199246_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004250527.1|2199350_2200109_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
WP_036908171.1|2200565_2200898_+	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	2.1e-05
WP_004250523.1|2200897_2201158_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_036908173.1|2201170_2203138_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.0	3.4e-119
WP_036908175.1|2203137_2203638_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	57.0	2.8e-41
WP_036908177.1|2203685_2203865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167649896.1|2203892_2204063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908181.1|2204477_2204690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908183.1|2204691_2205867_+|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	31.9	2.1e-31
2206239:2206254	attR	TCTGTATTCATCATCA	NA	NA	NA	NA
>prophage 9
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2236783	2311304	4105573	protease,tRNA,plate	Tupanvirus(14.29%)	58	NA	NA
WP_036894620.1|2236783_2238526_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_004244680.1|2238609_2239128_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_036896038.1|2239443_2239614_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_004244678.1|2240102_2240507_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_036908199.1|2240594_2241167_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_004244676.1|2241166_2242819_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_046335287.1|2242811_2244116_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_004244674.1|2244193_2246125_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
WP_004247681.1|2246131_2248246_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_036908201.1|2248355_2249498_+	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_004244671.1|2249764_2250316_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_004251935.1|2250530_2251541_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004247678.1|2251897_2252929_+	DUF1016 family protein	NA	NA	NA	NA	NA
WP_036908203.1|2253090_2255706_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.8	7.5e-21
WP_004244666.1|2256047_2257262_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
WP_017827340.1|2257276_2257468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908204.1|2257541_2258942_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.4	5.3e-82
WP_134940130.1|2259286_2260420_+	porin	NA	Q1MVN1	Enterobacteria_phage	54.0	2.0e-103
WP_012367734.1|2260772_2261963_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_156868377.1|2262094_2262250_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_036908206.1|2262387_2263350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908207.1|2263385_2263988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908208.1|2264065_2264380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894580.1|2264936_2265413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894578.1|2265412_2265643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908209.1|2265704_2266622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827666.1|2267026_2267461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827667.1|2267856_2268405_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_036894576.1|2269197_2269554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894568.1|2270449_2270806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894566.1|2271668_2272136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195080.1|2272362_2272974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894563.1|2274057_2274513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244651.1|2274515_2274869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244649.1|2275385_2275604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155115351.1|2275642_2275810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244647.1|2275884_2276307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894559.1|2279370_2279934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908211.1|2279930_2284631_-	AHH domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	6.6e-28
WP_004251951.1|2284695_2285115_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_036908212.1|2285140_2287333_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004246976.1|2287416_2287935_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247653.1|2289831_2290332_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004247652.1|2290352_2291831_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004244624.1|2291836_2292268_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_017628432.1|2292275_2294051_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244621.1|2294014_2295052_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004247648.1|2295056_2296325_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244619.1|2296326_2296878_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247647.1|2296879_2298238_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244617.1|2298230_2298986_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_036894552.1|2298994_2301718_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244614.1|2301721_2302510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244612.1|2302511_2303162_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_012367720.1|2303167_2304631_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_036908213.1|2304633_2308182_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004244609.1|2308219_2309575_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244608.1|2309567_2311304_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2530017	2576328	4105573	capsid,lysis,integrase,tail	Morganella_phage(46.51%)	67	2523098:2523116	2576397:2576415
2523098:2523116	attL	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
WP_036908260.1|2530017_2530317_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	55.3	1.3e-17
WP_004247523.1|2530366_2530981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245936.1|2530982_2531351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908261.1|2531344_2535490_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
WP_017628780.1|2535489_2536056_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
WP_017628781.1|2535992_2536712_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	2.8e-111
WP_036908262.1|2536715_2537414_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	3.1e-115
WP_017628783.1|2537410_2537740_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_036908263.1|2537884_2538094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908264.1|2538083_2538308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908266.1|2538323_2541473_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	53.0	3.3e-100
WP_060556273.1|2541540_2542263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908824.1|2542385_2543180_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	42.7	8.0e-43
WP_017827422.1|2543951_2544122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971544.1|2544224_2545040_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	26.5	4.0e-13
WP_036908270.1|2545660_2546236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908272.1|2546261_2547197_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_036908273.1|2547479_2548172_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	70.6	4.9e-89
WP_036908275.1|2548221_2548977_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	79.7	5.7e-107
WP_017628795.1|2549041_2549413_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	1.5e-47
WP_017628796.1|2549409_2549778_-	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	83.6	3.3e-52
WP_017628797.1|2549780_2550122_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	1.2e-51
WP_017628798.1|2550123_2550501_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_017827430.1|2550543_2551494_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
WP_017628800.1|2551499_2552186_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_017628801.1|2552260_2553325_-|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.4	9.2e-103
WP_017628802.1|2553333_2554710_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	9.1e-212
WP_017628803.1|2554711_2556196_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.7	4.7e-270
WP_004247495.1|2556198_2556801_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.3e-65
WP_004245978.1|2556834_2556993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247494.1|2557192_2557777_-	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004250565.1|2558124_2558586_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
WP_004250562.1|2558588_2558747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908277.1|2558728_2559199_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.8	1.4e-47
WP_004247489.1|2559198_2559468_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_004247488.1|2559521_2559944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247148.1|2560102_2560624_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004245982.1|2560935_2561568_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004245983.1|2561567_2561924_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245984.1|2561920_2562211_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_036908279.1|2562289_2562739_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	31.6	7.0e-12
WP_036907957.1|2562764_2564150_-	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_036895070.1|2564149_2564917_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_172409601.1|2564913_2565087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907956.1|2565183_2565531_-	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	2.6e-06
WP_004247477.1|2565676_2565886_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_036908281.1|2565991_2566636_+	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
WP_036908283.1|2566670_2567450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908285.1|2567446_2567812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|2568266_2568584_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_036908287.1|2568598_2568835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220847.1|2568806_2569088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908289.1|2569254_2569530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726527.1|2569564_2569729_+	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	57.4	1.8e-13
WP_072021536.1|2569806_2569989_+	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	81.7	6.3e-20
WP_036908291.1|2570116_2570371_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	96.4	4.2e-38
WP_036908293.1|2570367_2571186_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	97.8	1.8e-159
WP_036908295.1|2571178_2571985_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	98.9	1.9e-145
WP_012367602.1|2572499_2572676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367601.1|2572715_2572910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367600.1|2572937_2573117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908297.1|2573126_2573660_+	hypothetical protein	NA	J9Q748	Salmonella_phage	46.8	8.8e-38
WP_012367598.1|2573688_2574414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367596.1|2574620_2574797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247455.1|2574789_2575128_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
WP_012367595.1|2575124_2575370_+	excisionase	NA	NA	NA	NA	NA
WP_036908299.1|2575326_2576328_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	43.7	1.1e-68
2576397:2576415	attR	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	2622142	2630345	4105573		Mycobacterium_phage(28.57%)	8	NA	NA
WP_004246058.1|2622142_2622517_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246068.1|2623586_2623796_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246069.1|2623993_2624467_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246071.1|2624748_2624973_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246072.1|2624984_2625389_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_036894413.1|2625417_2627544_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	3.4e-205
WP_004247427.1|2627569_2628538_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004246075.1|2629145_2630345_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 12
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	3343353	3405452	4105573	transposase,protease,tRNA,integrase	Salmonella_phage(11.11%)	60	3333699:3333714	3362285:3362300
3333699:3333714	attL	CATAAAGAATATCACT	NA	NA	NA	NA
WP_036908435.1|3343353_3344553_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.2	3.5e-183
WP_036908437.1|3344575_3344992_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	4.5e-45
WP_036894099.1|3345656_3346319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894097.1|3346349_3346613_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_180949090.1|3346758_3346929_-	hypothetical protein	NA	A0A2H4J2N9	uncultured_Caudovirales_phage	67.3	2.4e-13
WP_036894095.1|3347194_3348085_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_036894093.1|3348141_3348969_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.9	6.8e-45
WP_065423098.1|3349088_3349712_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	45.6	4.1e-26
WP_036895999.1|3351456_3352674_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_004246180.1|3352762_3353842_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_004249580.1|3353841_3354939_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_004246183.1|3355225_3356734_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	8.3e-49
WP_004246185.1|3356814_3357264_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_036894084.1|3357277_3360166_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.8	3.7e-146
WP_004249583.1|3360566_3361076_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004246189.1|3361490_3361658_+	YhfL family protein	NA	NA	NA	NA	NA
WP_004249584.1|3361966_3362836_+	pirin family protein	NA	NA	NA	NA	NA
3362285:3362300	attR	CATAAAGAATATCACT	NA	NA	NA	NA
WP_004246194.1|3362928_3363360_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_036908438.1|3363477_3364686_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	2.6e-186
WP_036908440.1|3364708_3365125_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	1.3e-44
WP_036908442.1|3365290_3366295_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_004246196.1|3366475_3366655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246197.1|3366647_3367583_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	2.9e-52
WP_004246198.1|3367596_3368055_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004246200.1|3368392_3368779_+	RidA family protein	NA	NA	NA	NA	NA
WP_004246202.1|3369124_3371263_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.8	1.6e-263
WP_036908443.1|3371267_3371732_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	59.7	1.9e-52
WP_004249586.1|3371758_3371968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246205.1|3372134_3372512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894070.1|3372520_3372961_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_004246207.1|3373076_3373328_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_036894069.1|3373614_3373896_+	GIY-YIG nuclease family protein	NA	Q06VJ4	Trichoplusia_ni_ascovirus	47.2	6.1e-14
WP_020946636.1|3373912_3374416_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004249588.1|3374409_3374943_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_004246211.1|3375158_3376154_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_004249589.1|3376168_3377047_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_036894064.1|3377144_3378311_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004246220.1|3378310_3379456_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004246221.1|3379465_3380437_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004246222.1|3380672_3382376_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	69.7	5.4e-214
WP_004246223.1|3382378_3383095_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_004246224.1|3383117_3383492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246226.1|3383672_3383918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249598.1|3384376_3385624_-	MFS transporter	NA	NA	NA	NA	NA
WP_004246229.1|3385635_3386013_-	RidA family protein	NA	NA	NA	NA	NA
WP_004249599.1|3386049_3387012_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004246231.1|3387198_3387849_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_026090516.1|3388032_3389868_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SBR7	Catovirus	34.1	7.2e-55
WP_004249600.1|3390039_3390927_-	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_004246234.1|3391041_3393171_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_004253005.1|3393440_3393710_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_004253007.1|3393832_3394789_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_004246236.1|3394788_3395190_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_004246237.1|3395497_3398248_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	2.1e-26
WP_004246238.1|3398270_3399779_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004253010.1|3399799_3400252_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_004246240.1|3400742_3401087_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_004246241.1|3401253_3402591_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_004246242.1|3402587_3403430_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	28.2	1.8e-16
WP_004246243.1|3403511_3405452_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.8	8.3e-118
>prophage 13
NZ_CP026044	Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome	4105573	3574344	3672160	4105573	portal,protease,holin,capsid,integrase,tail,terminase,head,lysis,tRNA,plate	Salmonella_phage(31.82%)	100	3626754:3626813	3658936:3658998
WP_004249698.1|3574344_3575442_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_004249699.1|3575563_3575965_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_004246383.1|3575964_3576645_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_036895971.1|3576845_3578243_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_004249700.1|3578234_3579152_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_004246386.1|3579389_3580772_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_036895969.1|3580864_3582076_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_004246388.1|3582140_3582914_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_036908474.1|3582934_3583939_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_036908476.1|3584039_3585203_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_004246391.1|3585294_3587019_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	22.5	6.2e-24
WP_004246392.1|3587583_3588405_+	DUF3100 domain-containing protein	NA	NA	NA	NA	NA
WP_004246394.1|3588401_3588851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246396.1|3588850_3590032_+	amidohydrolase	NA	NA	NA	NA	NA
WP_004246397.1|3590107_3591121_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004246398.1|3591890_3593393_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	4.8e-57
WP_036908478.1|3593403_3594834_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.4	2.1e-62
WP_036908480.1|3594873_3595857_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_036908482.1|3595913_3598550_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004246404.1|3599022_3599184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246405.1|3599262_3599781_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_004249705.1|3599903_3602342_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_036908484.1|3602351_3603512_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_004246409.1|3603797_3604115_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_004246411.1|3604902_3605115_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036908486.1|3605318_3607520_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_004249710.1|3607772_3608804_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_004246415.1|3608874_3609669_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_004246416.1|3609779_3610310_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004246417.1|3610322_3611663_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
WP_036895956.1|3611761_3612679_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246419.1|3612787_3613306_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_012368679.1|3613399_3613642_-	cell division protein ZapB	NA	NA	NA	NA	NA
WP_004246421.1|3613938_3614754_+	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_004246422.1|3614796_3616329_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246423.1|3616438_3617623_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
WP_036895953.1|3617961_3618708_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_004249714.1|3618768_3619197_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_004249899.1|3619308_3619944_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_004249716.1|3620050_3620821_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017827015.1|3620916_3621921_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004246429.1|3622214_3623192_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_036895948.1|3623730_3624486_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_036908488.1|3624695_3625850_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_036908490.1|3625917_3626703_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
3626754:3626813	attL	TAAAATATAATAGATAAAAAAAAGCCCCTCTCCAGAGGGGCTGCAAAAGACAGGGATGGT	NA	NA	NA	NA
WP_036908495.1|3627011_3627719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368178.1|3628162_3628381_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
WP_036908496.1|3628433_3629531_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	56.2	3.3e-111
WP_036907694.1|3629530_3629995_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_036908497.1|3629994_3632829_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	40.3	6.2e-106
WP_072021540.1|3632821_3632995_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	49.1	2.8e-09
WP_052124640.1|3632955_3633303_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	3.5e-19
WP_036908498.1|3633322_3633838_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.1	8.5e-54
WP_036908499.1|3633841_3635014_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	71.1	6.5e-166
WP_036908501.1|3635106_3635727_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	48.5	1.4e-31
WP_080749555.1|3635726_3636443_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	47.3	6.3e-31
WP_036908502.1|3637542_3638154_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	67.9	1.2e-75
WP_036908504.1|3638146_3639055_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	66.9	7.3e-109
WP_036908505.1|3639056_3639395_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	50.0	1.1e-25
WP_036908507.1|3639391_3640018_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.8	4.5e-57
WP_052124641.1|3640137_3640524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908509.1|3640591_3641230_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	2.6e-28
WP_036908511.1|3641219_3641654_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	48.6	2.2e-31
WP_080749551.1|3641628_3642141_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	36.3	5.0e-06
WP_036908513.1|3642137_3642542_-	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	57.4	6.1e-39
WP_080749552.1|3642534_3642849_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012368195.1|3642868_3643075_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
WP_036908515.1|3643074_3643530_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	6.4e-29
WP_012368197.1|3643607_3644276_-|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_036908516.1|3644275_3645421_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.4	1.2e-127
WP_036907650.1|3645436_3646246_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	2.6e-65
WP_036908518.1|3646418_3648173_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.0	2.6e-259
WP_036908521.1|3648172_3649201_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.7	3.2e-137
WP_036908524.1|3649696_3651046_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	24.8	5.6e-20
WP_036908526.1|3651108_3651789_-	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	26.8	7.1e-16
WP_036908529.1|3651995_3654374_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.6	1.3e-165
WP_036908532.1|3654373_3654697_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_036908534.1|3654696_3655524_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	1.4e-61
WP_012368208.1|3655525_3655747_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_012368209.1|3655739_3655997_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_036908535.1|3656014_3656407_-	DUF5347 family protein	NA	NA	NA	NA	NA
WP_036908537.1|3656456_3656732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964418.1|3656741_3656894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908539.1|3656890_3657079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908542.1|3657080_3657371_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	63.5	1.1e-31
WP_036908544.1|3657475_3657781_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	49.5	8.4e-17
WP_036908546.1|3657847_3658819_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	64.4	1.6e-117
WP_004249721.1|3659095_3659662_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
3658936:3658998	attR	TAAAATATAATAGATAAAAAAAAGCCCCTCTCCAGAGGGGCTGCAAAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_004246432.1|3659845_3660544_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_004249722.1|3660555_3661947_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_036908547.1|3662344_3663601_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_036908549.1|3663608_3664700_+	EpsG family protein	NA	NA	NA	NA	NA
WP_036908551.1|3664708_3665686_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_049254996.1|3665682_3666618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049254997.1|3666601_3667450_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.7	7.0e-13
WP_080726890.1|3667485_3668325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908555.1|3668311_3669436_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_036908557.1|3669450_3670617_+	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.4	4.5e-119
WP_004249910.1|3670642_3671653_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	31.3	2.0e-38
WP_036908559.1|3671656_3672160_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
