The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026051	Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome	3955473	32668	102026	3955473	lysis,portal,terminase,integrase,protease,capsid,tail,transposase,head,tRNA	Morganella_phage(19.51%)	87	34942:34956	70806:70820
WP_004247117.1|32668_33772_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_036918198.1|33877_34330_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|34322_34952_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
34942:34956	attL	TGATTTGCCATAGCT	NA	NA	NA	NA
WP_004247120.1|35090_36344_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_036918202.1|36464_37592_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	60.9	9.7e-127
WP_036894694.1|37572_37815_-	excisionase	NA	NA	NA	NA	NA
WP_036894695.1|37876_38407_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.0	2.8e-52
WP_036894696.1|38463_39291_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	1.9e-79
WP_004247126.1|39356_39731_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_049206439.1|40189_40657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894697.1|40676_40880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918203.1|41022_41910_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_036894708.1|41892_42576_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	43.4	1.6e-44
WP_049206440.1|42700_42964_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	42.9	1.4e-07
WP_036894710.1|43015_43474_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	7.9e-27
WP_036894712.1|43563_43773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894714.1|43762_43933_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_004247133.1|43945_45037_+	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_004247134.1|45208_45916_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247135.1|45915_46941_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247136.1|46968_47367_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247137.1|47709_47922_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|48323_48845_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|49168_49504_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_017827436.1|49607_50534_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_036908073.1|50950_51379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|51531_51783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|52226_52496_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036900946.1|52495_52966_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_162837602.1|52947_53106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905787.1|53108_53570_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_001967215.1|54466_54805_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905782.1|54807_55020_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_006537822.1|55144_55612_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_036918204.1|55565_57299_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.3	1.2e-147
WP_012367784.1|57298_58567_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_004251596.1|58584_59253_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_004251594.1|59256_60423_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
WP_004251590.1|60461_60761_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_004251588.1|60760_61090_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_004251585.1|61079_61553_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_004251583.1|61558_61900_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251580.1|61909_62575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036918205.1|62639_63056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894769.1|63052_63331_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|63355_63547_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_036918206.1|63673_66961_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.9	1.3e-54
WP_036918208.1|66961_67558_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	1.2e-51
WP_006537803.1|67557_68139_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	3.1e-52
WP_004251562.1|68150_68456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251558.1|68487_68886_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
WP_052124557.1|68885_72611_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	51.5	5.7e-200
70806:70820	attR	AGCTATGGCAAATCA	NA	NA	NA	NA
WP_004245936.1|72604_72973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|72974_73589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|73638_73899_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_012367647.1|74607_74913_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080749526.1|76498_76663_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.0e-21
WP_036918210.1|76831_76990_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036918213.1|77308_78514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628184.1|79798_80923_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004247907.1|81362_81575_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
WP_004242516.1|81906_82365_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_004247908.1|82855_83317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036920088.1|83440_83815_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104985344.1|83904_84753_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_072021446.1|84993_85191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251489.1|85214_85757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242524.1|86597_86912_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247912.1|87555_88197_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_036918215.1|88209_89436_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	1.6e-61
WP_049208187.1|89993_90656_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004242530.1|91218_91575_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_004242531.1|91777_91948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036918216.1|92232_93228_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_004247917.1|93444_93621_+	hypothetical protein	NA	A0A1W6JNZ9	Morganella_phage	60.0	9.1e-08
WP_004242534.1|94113_94335_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004242536.1|94760_95042_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_004242537.1|95410_95824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251481.1|95851_96094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247920.1|96156_96717_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004242542.1|97092_97290_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_036918218.1|97307_98084_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242548.1|98318_98702_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004242549.1|98844_99708_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004247923.1|99834_100266_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_036918219.1|100384_100795_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	61.3	1.2e-42
WP_036918220.1|100817_102026_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	1.6e-188
>prophage 2
NZ_CP026051	Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome	3955473	864270	881197	3955473	lysis,holin,plate,tail	Burkholderia_phage(30.77%)	22	NA	NA
WP_004243611.1|864270_865047_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004250729.1|865162_865705_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	1.6e-18
WP_017628013.1|866273_866453_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_080749531.1|866608_866995_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049218810.1|867177_867594_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_036918579.1|867616_868957_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.7e-14
WP_017628011.1|868962_869619_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_036918580.1|869615_870803_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.4	5.5e-72
WP_004243617.1|870795_871140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918584.1|871136_871829_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	2.0e-29
WP_004243622.1|871831_872644_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_036918587.1|872612_872933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|872945_873434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918590.1|873436_875740_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	2.0e-14
WP_004243627.1|875822_876281_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|876340_876793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918594.1|876803_878291_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
WP_004248364.1|878299_878812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918597.1|878848_879298_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|879294_879699_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|879701_880001_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_036918599.1|880381_881197_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.3	2.1e-54
>prophage 3
NZ_CP026051	Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome	3955473	1384979	1401832	3955473	integrase	Morganella_phage(50.0%)	20	1378667:1378686	1400559:1400578
1378667:1378686	attL	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_052124568.1|1384979_1388210_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	41.8	4.0e-101
WP_036918873.1|1388226_1388568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|1388567_1388741_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918875.1|1388912_1389425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918877.1|1390409_1393130_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
WP_036918880.1|1393126_1393471_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	70.2	7.0e-44
WP_052124569.1|1393485_1394082_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	2.9e-29
WP_036900272.1|1394081_1394276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165469419.1|1394275_1394449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052124570.1|1394445_1395057_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	44.6	1.9e-20
WP_036907509.1|1395053_1395263_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_036918882.1|1395259_1395439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036918884.1|1395435_1395693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072021451.1|1395695_1395869_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_080749542.1|1395861_1396836_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	48.3	4.2e-62
WP_036918887.1|1396840_1397530_-	Rha family transcriptional regulator	NA	A0A0S2SYC0	Pseudomonas_phage	38.0	2.7e-10
WP_036918890.1|1397542_1397938_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_036918892.1|1397937_1398135_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.3	2.3e-07
WP_036918895.1|1399315_1400527_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	8.5e-129
WP_004244243.1|1400959_1401832_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
1400559:1400578	attR	ATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
>prophage 4
NZ_CP026051	Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome	3955473	1663346	1672214	3955473		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|1663346_1664915_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_004245602.1|1665315_1665996_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|1666092_1666668_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|1666744_1667323_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004249445.1|1667390_1668416_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|1668450_1668906_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_036919012.1|1668930_1670091_-	TerD family protein	NA	NA	NA	NA	NA
WP_004245609.1|1670091_1670676_-	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017827550.1|1671068_1672214_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 5
NZ_CP026051	Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome	3955473	3483561	3492096	3955473		Mycobacterium_phage(28.57%)	9	NA	NA
WP_004247426.1|3483561_3484761_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|3485370_3486339_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004252248.1|3486364_3488491_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|3488519_3488924_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|3488935_3489160_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|3489441_3489915_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|3490112_3490322_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246061.1|3490624_3491113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|3491721_3492096_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 6
NZ_CP026051	Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome	3955473	3531702	3576483	3955473	lysis,capsid,integrase,tail	Morganella_phage(51.22%)	63	3531616:3531634	3583388:3583406
3531616:3531634	attL	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
WP_026164649.1|3531702_3532704_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.3	1.9e-70
WP_004246013.1|3532660_3532906_-	excisionase	NA	NA	NA	NA	NA
WP_017827453.1|3534056_3534752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827452.1|3534823_3535333_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	57.3	4.9e-54
WP_017827451.1|3535332_3535944_-	ERF family protein	NA	A0A1W6JP21	Morganella_phage	69.2	1.1e-73
WP_017628824.1|3535945_3536266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628823.1|3536262_3536415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919938.1|3536411_3536675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165439118.1|3536682_3536838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036919939.1|3536891_3537152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628819.1|3537351_3537849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|3537870_3538188_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_036908285.1|3538642_3539008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908283.1|3539004_3539784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908281.1|3539818_3540463_-	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
WP_004247477.1|3540568_3540778_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
WP_036919940.1|3540923_3541271_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	1.8e-36
WP_004247479.1|3541365_3541539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895070.1|3541535_3542303_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_036919941.1|3542302_3543688_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.9	6.1e-115
WP_026090523.1|3543715_3544045_+	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_036919942.1|3544112_3544562_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|3544640_3544931_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|3544927_3545284_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_036919943.1|3545283_3545916_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	33.8	1.6e-22
WP_004247148.1|3546227_3546749_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247488.1|3546907_3547330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247489.1|3547383_3547653_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_017628809.1|3547652_3548123_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_012367623.1|3548104_3548263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919945.1|3548265_3548727_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.8	1.1e-23
WP_004247494.1|3549074_3549659_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245978.1|3549858_3550017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628804.1|3550050_3550653_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.1e-64
WP_036919947.1|3550655_3552140_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.9	2.7e-270
WP_017628802.1|3552141_3553518_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	9.1e-212
WP_036919948.1|3553526_3554591_+|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.1	1.2e-102
WP_036919950.1|3554665_3555352_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_017827430.1|3555357_3556308_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
WP_017628798.1|3556350_3556728_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_017628797.1|3556729_3557071_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	1.2e-51
WP_036919952.1|3557073_3557442_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	85.2	3.0e-53
WP_017827427.1|3557438_3557810_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	3.3e-47
WP_036895037.1|3557883_3558129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919954.1|3558179_3558935_+	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	78.9	1.3e-106
WP_036919955.1|3558984_3559677_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	72.4	1.8e-91
WP_036919956.1|3559836_3560304_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	43.5	4.0e-26
WP_052124583.1|3560310_3560715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919957.1|3560722_3561208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827423.1|3561386_3562160_-	LexA family transcriptional regulator	NA	A2I308	Vibrio_virus	30.8	2.3e-10
WP_017827422.1|3562262_3562433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919958.1|3563203_3563929_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.3	8.0e-66
WP_060556273.1|3564051_3564774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036919959.1|3564841_3567991_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	53.0	3.3e-100
WP_026090519.1|3568148_3568622_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	46.5	1.8e-29
WP_017628783.1|3568799_3569129_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_036919960.1|3569125_3569824_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	82.8	4.5e-114
WP_017628781.1|3569827_3570547_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	2.8e-111
WP_017628780.1|3570483_3571050_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
WP_036919962.1|3571049_3575195_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
WP_004245936.1|3575188_3575557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247523.1|3575558_3576173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|3576222_3576483_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
3583388:3583406	attR	CTGCTTATTGGATTATAGT	NA	NA	NA	NA
>prophage 7
NZ_CP026051	Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome	3955473	3750099	3828712	3955473	tRNA,plate,protease	Bacillus_phage(17.65%)	57	NA	NA
WP_004244558.1|3750099_3750414_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|3750444_3752739_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|3752858_3753077_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|3753396_3754089_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|3754090_3755842_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_036920024.1|3755844_3757614_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004252032.1|3757755_3758715_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
WP_004244566.1|3759257_3759752_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_036920026.1|3759879_3763713_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|3763825_3764431_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|3764441_3765791_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|3765924_3767214_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|3767382_3767715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247622.1|3768114_3769164_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|3769236_3770142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|3770499_3771240_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|3771347_3773630_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|3773684_3774539_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036920028.1|3775209_3776967_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|3777194_3778232_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_036920029.1|3778306_3779572_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004247627.1|3779708_3781139_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.6	2.0e-07
WP_004244582.1|3781275_3782364_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004247629.1|3782560_3783847_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|3784135_3784813_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036920030.1|3784994_3786668_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|3786732_3787020_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_036920031.1|3787504_3789874_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	2.7e-22
WP_004244589.1|3789910_3791656_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_004244590.1|3791652_3792654_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|3793149_3793365_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|3793779_3793959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|3793963_3794725_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_036920032.1|3794848_3795679_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|3796058_3796832_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|3796841_3798164_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_036920034.1|3798144_3798876_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_017827041.1|3798872_3803330_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_036920036.1|3803612_3804266_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.4	1.2e-100
WP_004247637.1|3804671_3805385_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_036920038.1|3805727_3807443_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|3807774_3808323_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|3808376_3809027_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|3809119_3809593_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|3809683_3811420_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_036920039.1|3811412_3812768_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244610.1|3812805_3816354_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_036920041.1|3816356_3817820_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|3817825_3818476_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|3818477_3819266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894552.1|3819269_3821993_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|3822001_3822757_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004247647.1|3822749_3824108_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|3824109_3824661_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|3824662_3825931_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|3825935_3826973_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_017628432.1|3826936_3828712_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
