The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026055	Aeromonas caviae strain FDAARGOS_72 chromosome, complete genome	4518310	136405	188983	4518310	transposase,plate	uncultured_Caudovirales_phage(28.57%)	40	NA	NA
WP_017787123.1|136405_137422_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
WP_103254830.1|137505_138195_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_146042854.1|138270_138882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042863678.1|139149_140190_-	carotenoid 1,2-hydratase	NA	NA	NA	NA	NA
WP_103254831.1|140363_142799_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_103254832.1|142820_143501_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	2.1e-31
WP_010674381.1|143653_144127_+	DUF4357 domain-containing protein	NA	NA	NA	NA	NA
WP_042863679.1|144261_145686_+	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_042863680.1|145719_146286_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_010674385.1|146345_147542_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.6	6.4e-20
WP_042863681.1|147594_149283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042865269.1|149352_150615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042863682.1|150815_151376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042863683.1|151523_152948_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042863684.1|153023_153863_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_042863685.1|153862_156823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041212878.1|156827_157277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010674393.1|157395_157881_-	YqhA family protein	NA	NA	NA	NA	NA
WP_042863686.1|157963_158665_-	peptidase	NA	NA	NA	NA	NA
WP_042863687.1|158696_159497_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_010674396.1|159493_160420_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_103254833.1|160413_161850_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_042863688.1|162208_163921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103254834.1|164780_166517_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.9	1.1e-28
WP_042015720.1|167777_168296_+	type VI secretion system effector Hcp1	NA	NA	NA	NA	NA
WP_103254835.1|168579_170625_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	5.1e-33
WP_103254836.1|170614_171343_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_103254837.1|171339_176208_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	4.2e-33
WP_146042856.1|176210_176567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042863690.1|176861_177911_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	41.4	7.8e-70
WP_146042857.1|178003_178471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042863691.1|178587_179973_+	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_041215379.1|180635_181139_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_042015701.1|181175_182654_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_042015698.1|182660_183092_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_042863692.1|183095_184862_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_042865270.1|184825_185824_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_103254838.1|185880_187131_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_041215374.1|187130_187646_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_042863693.1|187648_188983_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NZ_CP026055	Aeromonas caviae strain FDAARGOS_72 chromosome, complete genome	4518310	1009497	1017153	4518310		Mycoplasma_phage(33.33%)	8	NA	NA
WP_103254924.1|1009497_1010781_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.4	3.3e-30
WP_042863979.1|1010777_1012079_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.2	9.1e-36
WP_005299781.1|1012236_1012575_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_042863980.1|1012576_1014424_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.2	9.1e-106
WP_042863981.1|1014452_1014971_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_010675058.1|1015161_1015485_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	43.9	1.2e-21
WP_010675059.1|1015500_1015884_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	2.8e-54
WP_010675060.1|1015938_1017153_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.3	3.0e-33
>prophage 3
NZ_CP026055	Aeromonas caviae strain FDAARGOS_72 chromosome, complete genome	4518310	1235405	1285079	4518310	tail,tRNA,integrase,capsid,terminase	Ralstonia_phage(14.29%)	49	1243261:1243308	1289820:1289867
WP_042864061.1|1235405_1236782_-|tRNA	cysteine--tRNA ligase	tRNA	H2EDD6	Moumouvirus	29.7	6.0e-46
WP_039041198.1|1236973_1237471_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_042864062.1|1237460_1238147_+	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_042864063.1|1238160_1238886_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_010675223.1|1239014_1239263_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_039041196.1|1239420_1240056_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042864064.1|1240109_1241093_+	oxidoreductase	NA	NA	NA	NA	NA
WP_042864065.1|1241654_1242944_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.4	4.1e-12
1243261:1243308	attL	ATGGAGGCACGTTCCGGAGTCGAACCGGACTAAACGGATTTGCAATCC	NA	NA	NA	NA
WP_103254947.1|1243413_1244412_-|integrase	site-specific integrase	integrase	A0A2R2ZGC4	Ralstonia_phage	32.8	1.7e-34
WP_042865324.1|1244408_1244636_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103254948.1|1245695_1246082_-	hypothetical protein	NA	H6UK24	Aeromonas_phage	45.9	3.7e-17
WP_042864068.1|1246175_1246691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190285544.1|1246767_1247343_-	antirestriction protein ArdA	NA	S0A5R5	Cellulophaga_phage	28.1	1.3e-07
WP_042864069.1|1248231_1248528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103254950.1|1249114_1250764_-|terminase	phage terminase large subunit	terminase	L7TLX3	Rhizobium_phage	58.1	2.0e-181
WP_042864070.1|1250760_1250997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042864071.1|1250986_1251226_-	HNH endonuclease	NA	M1PRE7	Prochlorococcus_phage	60.3	2.0e-10
WP_146042871.1|1251326_1251656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042864072.1|1251720_1252212_-	hypothetical protein	NA	E1A187	Aeromonas_phage	71.7	5.5e-10
WP_042864073.1|1252198_1256305_-|tail	tail fiber domain-containing protein	tail	I6X7P4	Aeromonas_phage	25.5	5.6e-31
WP_103254951.1|1256313_1258629_-	hypothetical protein	NA	Q6WYC3	Enterobacteria_phage	30.1	8.4e-08
WP_042864074.1|1258631_1261841_-	hypothetical protein	NA	A0A1L5C085	Aquamicrobium_phage	21.2	1.8e-08
WP_042864075.1|1261837_1263559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146042872.1|1263568_1264015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042864077.1|1264044_1264494_-	DUF2833 domain-containing protein	NA	NA	NA	NA	NA
WP_042864078.1|1264487_1267106_-	hypothetical protein	NA	A0A1B1IY37	Phage_MedPE-SWcel-C56	24.3	4.1e-35
WP_103254952.1|1267093_1267732_-|tail	phage tail protein	tail	A0A2D2W5E6	Ralstonia_phage	44.3	2.3e-32
WP_103254953.1|1267873_1268998_-|capsid	capsid protein	capsid	A0A1B1IWN1	uncultured_Mediterranean_phage	31.7	1.0e-35
WP_103254954.1|1269129_1269858_-	hypothetical protein	NA	D6PH06	uncultured_phage	38.1	1.5e-11
WP_042864079.1|1269871_1270117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103254955.1|1270119_1271607_-|tail	phage tail protein	tail	L7TJ79	Rhizobium_phage	44.0	4.6e-108
WP_042864081.1|1272018_1272510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042865334.1|1272506_1272947_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	E5DI79	Enterobacter_phage	57.2	1.8e-44
WP_103254956.1|1272943_1274788_-	anaerobic ribonucleoside-triphosphate reductase	NA	Q6WID9	Vibrio_phage	65.2	4.6e-235
WP_103254957.1|1274735_1275065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042864083.1|1275057_1275729_-	FAD-dependent thymidylate synthase	NA	A0A2H5BQD0	Pseudomonas_phage	57.4	2.6e-63
WP_042864084.1|1275716_1276055_-	hypothetical protein	NA	A0A2D0PEE3	Yersinia_phage	42.0	2.6e-11
WP_042865336.1|1276080_1276395_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A2R4ALG3	Vibrio_phage	43.8	5.6e-16
WP_042864085.1|1276444_1276660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042864086.1|1276659_1277259_-	DUF3310 domain-containing protein	NA	A0A172JFZ9	Citrobacter_phage	42.3	1.1e-07
WP_042864087.1|1277255_1278095_-	exonuclease	NA	E5RV13	Ralstonia_phage	45.8	2.6e-60
WP_042864088.1|1278209_1279151_-	hypothetical protein	NA	I7LEE3	Yersinia_phage	50.5	3.6e-50
WP_042864089.1|1279178_1279358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042864090.1|1279381_1279603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042864091.1|1279645_1281649_-	DNA polymerase	NA	A0A2R2ZGG6	Ralstonia_phage	45.0	1.9e-157
WP_042864092.1|1281658_1282123_-	hypothetical protein	NA	A0A0F6PKJ5	Escherichia_phage	46.1	2.2e-29
WP_042864093.1|1282124_1283747_-	toprim domain-containing protein	NA	L7TLT7	Rhizobium_phage	53.8	3.1e-142
WP_103254959.1|1283749_1284442_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_103254960.1|1284431_1285079_-	hypothetical protein	NA	A0A192Y9Z1	Morganella_phage	31.8	7.8e-12
1289820:1289867	attR	ATGGAGGCACGTTCCGGAGTCGAACCGGACTAAACGGATTTGCAATCC	NA	NA	NA	NA
>prophage 4
NZ_CP026055	Aeromonas caviae strain FDAARGOS_72 chromosome, complete genome	4518310	1407542	1414391	4518310		Enterobacteria_phage(50.0%)	7	NA	NA
WP_103254972.1|1407542_1408223_-	chloramphenicol acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	37.6	1.8e-19
WP_042864137.1|1408239_1409355_-	dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	26.0	1.6e-17
WP_042864138.1|1409381_1410809_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_042864139.1|1410808_1411357_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.3	2.3e-49
WP_042864140.1|1411419_1412298_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	6.2e-105
WP_042864141.1|1412382_1413270_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.4	1.8e-27
WP_042864142.1|1413269_1414391_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.6	2.4e-93
>prophage 5
NZ_CP026055	Aeromonas caviae strain FDAARGOS_72 chromosome, complete genome	4518310	3664432	3676086	4518310	tRNA	uncultured_Mediterranean_phage(22.22%)	11	NA	NA
WP_042864948.1|3664432_3665194_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	3.3e-70
WP_010675623.1|3665198_3665816_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.4	5.3e-34
WP_010675622.1|3665812_3666394_+	DedA family protein	NA	NA	NA	NA	NA
WP_042864949.1|3666403_3667474_+	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	34.9	1.7e-11
WP_010675620.1|3667520_3668504_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	3.8e-34
WP_042864950.1|3668577_3669591_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.0	2.6e-107
WP_005309452.1|3669770_3669986_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010675618.1|3670001_3670445_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.9	1.3e-26
WP_042864951.1|3670534_3672322_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	1.2e-73
WP_080560569.1|3672535_3674401_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
WP_042864952.1|3674916_3676086_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	29.2	5.0e-09
