The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026059	Proteus mirabilis strain FDAARGOS_80 chromosome, complete genome	3973559	925322	933526	3973559		Mycobacterium_phage(28.57%)	9	NA	NA
WP_004246075.1|925322_926522_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|927130_928099_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_036894413.1|928124_930251_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	3.4e-205
WP_004246072.1|930279_930684_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|930695_930920_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|931201_931675_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|931872_932082_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246065.1|932266_932407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|933151_933526_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 2
NZ_CP026059	Proteus mirabilis strain FDAARGOS_80 chromosome, complete genome	3973559	1136842	1215374	3973559	tRNA,plate,protease	Bacillus_phage(17.65%)	57	NA	NA
WP_004244558.1|1136842_1137157_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_036894527.1|1137187_1139482_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1139601_1139820_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|1140139_1140832_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004244562.1|1140833_1142585_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_036894531.1|1142587_1144357_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004252032.1|1144498_1145458_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
WP_004244566.1|1146000_1146495_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_036894533.1|1146622_1150426_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1150538_1151144_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1151154_1152504_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1152637_1153927_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004244572.1|1154106_1154439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012367707.1|1154838_1155888_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1155960_1156866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1157223_1157964_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1158071_1160354_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1160408_1161263_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036894537.1|1161932_1163690_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1163917_1164955_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_036894539.1|1165029_1166298_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_103429213.1|1166434_1167865_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.2	6.3e-06
WP_004244582.1|1168001_1169090_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004252010.1|1169286_1170573_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1170861_1171539_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1171720_1173394_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1173458_1173746_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_036894541.1|1174170_1176540_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.7	2.7e-22
WP_004244589.1|1176576_1178322_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_004244590.1|1178318_1179320_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1179815_1180031_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1180445_1180625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1180629_1181391_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017827043.1|1181514_1182345_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1182724_1183498_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1183507_1184830_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1184810_1185542_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|1185538_1189996_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004244601.1|1190278_1190932_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.0	1.0e-99
WP_004247637.1|1191337_1192051_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004244603.1|1192393_1194109_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1194440_1194989_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1195038_1195689_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1195781_1196255_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1196345_1198082_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244609.1|1198074_1199430_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244610.1|1199467_1203016_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004244611.1|1203018_1204482_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1204487_1205138_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1205139_1205928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894552.1|1205931_1208655_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1208663_1209419_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004247647.1|1209411_1210770_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1210771_1211323_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1211324_1212593_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_036894554.1|1212597_1213635_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_017628432.1|1213598_1215374_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP026059	Proteus mirabilis strain FDAARGOS_80 chromosome, complete genome	3973559	1380202	1468731	3973559	tRNA,transposase,head,tail,lysis,capsid,terminase,portal,integrase	Salmonella_phage(23.81%)	99	1385120:1385135	1449389:1449404
WP_004247117.1|1380202_1381306_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1381411_1381864_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247841.1|1381856_1382486_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|1382624_1383878_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_036894692.1|1384042_1385338_+	hypothetical protein	NA	NA	NA	NA	NA
1385120:1385135	attL	GATATAGATATTTATA	NA	NA	NA	NA
WP_036894693.1|1385334_1386462_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	60.9	6.7e-128
WP_036894694.1|1386442_1386685_-	excisionase	NA	NA	NA	NA	NA
WP_036894695.1|1386746_1387277_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.0	2.8e-52
WP_036894696.1|1387333_1388161_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	1.9e-79
WP_004247126.1|1388226_1388601_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_049206439.1|1389059_1389527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894697.1|1389546_1389750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894706.1|1389892_1390780_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_036894708.1|1390762_1391446_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	43.4	1.6e-44
WP_049206440.1|1391570_1391834_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	42.9	1.4e-07
WP_036894710.1|1391885_1392344_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	7.9e-27
WP_036894714.1|1392632_1392803_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_036894715.1|1392815_1393907_+	hypothetical protein	NA	K4NZ18	Pseudomonas_phage	48.2	1.1e-29
WP_004247134.1|1394078_1394786_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_036894718.1|1394785_1395811_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	2.6e-86
WP_036894721.1|1395838_1396237_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	53.5	7.8e-31
WP_036894724.1|1396451_1397171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894726.1|1397180_1398293_+	XRE family transcriptional regulator	NA	B6SBZ6	Clostridium_virus	30.9	5.8e-39
WP_036894729.1|1398477_1399140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251632.1|1399829_1400165_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_017827436.1|1400268_1401195_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_036894733.1|1401610_1402039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|1402191_1402443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894740.1|1402886_1403156_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	51.2	1.1e-17
WP_036894746.1|1403155_1403626_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	1.5e-49
WP_162837602.1|1403607_1403766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894748.1|1403768_1404230_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	4.4e-25
WP_036894750.1|1405237_1405534_+	HNH endonuclease	NA	A0A1V0SEA1	Indivirus	40.3	1.2e-07
WP_036894753.1|1405670_1406270_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	34.0	1.2e-19
WP_036894755.1|1406273_1407935_+|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	76.1	1.3e-260
WP_004244737.1|1407971_1409915_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	60.0	2.2e-211
WP_004244738.1|1409970_1410192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251722.1|1410239_1411556_+|portal	phage portal protein	portal	A0A0P0ZCX8	Stx2-converting_phage	56.9	1.6e-125
WP_049220616.1|1411552_1412839_+	hypothetical protein	NA	S4TNN1	Salmonella_phage	54.5	1.2e-40
WP_004244743.1|1412835_1413162_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	35.2	2.3e-12
WP_036894757.1|1413169_1413514_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_036894760.1|1413497_1413971_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	32.1	1.6e-11
WP_036894762.1|1413976_1414318_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_036894764.1|1414327_1414993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894767.1|1415056_1415473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894769.1|1415469_1415748_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036894770.1|1415788_1419040_+|tail	phage tail tape measure protein	tail	A0A220VZA0	Acinetobacter_phage	43.1	3.3e-02
WP_036894772.1|1419040_1419637_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	51.8	3.0e-50
WP_036894775.1|1419636_1420218_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	3.1e-52
WP_004251562.1|1420229_1420535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251558.1|1420566_1420965_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
WP_052124749.1|1420964_1424690_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	52.1	2.3e-201
WP_004245936.1|1424683_1425052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012367646.1|1425053_1425668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247524.1|1425717_1425978_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_012367647.1|1426686_1426992_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017628485.1|1427092_1428175_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_036894778.1|1428184_1430719_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_026090491.1|1430728_1431454_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004247004.1|1431519_1432062_-	uroepithelial cell adherence major pilin UcaA	NA	NA	NA	NA	NA
WP_102086658.1|1433960_1435193_+	DUF3440 domain-containing protein	NA	L0P6Z6	Lactobacillus_phage	34.0	3.5e-61
WP_036894780.1|1435205_1435847_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	46.8	2.4e-50
WP_036894781.1|1436133_1436652_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_127645612.1|1437151_1437592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894784.1|1437592_1437820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247902.1|1438001_1438166_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
WP_190306344.1|1438972_1439842_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_052124751.1|1440782_1442057_+	RelA/SpoT domain-containing protein	NA	NA	NA	NA	NA
WP_004251516.1|1442342_1442747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004242508.1|1443523_1443682_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004251511.1|1444000_1445206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247906.1|1446490_1447615_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004247907.1|1448054_1448267_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	78.6	2.0e-25
WP_004242516.1|1448599_1449058_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_004247908.1|1449548_1450010_+	hypothetical protein	NA	NA	NA	NA	NA
1449389:1449404	attR	GATATAGATATTTATA	NA	NA	NA	NA
WP_004247909.1|1450133_1450508_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004242519.1|1450597_1451446_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004242521.1|1451686_1451884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251489.1|1451907_1452450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026090443.1|1453290_1453605_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247912.1|1454249_1454891_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	47.8	2.4e-50
WP_004251487.1|1454903_1456130_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	33.2	2.0e-61
WP_004247914.1|1456687_1457350_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004242530.1|1457912_1458269_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_004242531.1|1458471_1458642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894800.1|1458926_1459922_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_004247917.1|1460138_1460315_+	hypothetical protein	NA	A0A1W6JNZ9	Morganella_phage	60.0	9.1e-08
WP_004242534.1|1460806_1461028_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004242536.1|1461453_1461735_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_004242537.1|1462103_1462517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247919.1|1462544_1462787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242541.1|1462849_1463410_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	50.6	1.9e-19
WP_004242542.1|1463785_1463983_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_004242544.1|1464000_1464777_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004242548.1|1465011_1465395_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	47.8	2.3e-24
WP_004242549.1|1465537_1466401_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_004247923.1|1466526_1466958_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	38.1	1.8e-20
WP_036894804.1|1467083_1467500_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	7.6e-45
WP_036894806.1|1467522_1468731_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	2.0e-186
>prophage 4
NZ_CP026059	Proteus mirabilis strain FDAARGOS_80 chromosome, complete genome	3973559	1828826	1911498	3973559	tRNA,transposase,tail,lysis,capsid,bacteriocin	Morganella_phage(43.48%)	104	NA	NA
WP_004243086.1|1828826_1829747_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	89.5	1.2e-130
WP_103429221.1|1830061_1831045_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_017628085.1|1831409_1831742_+	DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_036894981.1|1832034_1832595_+	porin family protein	NA	NA	NA	NA	NA
WP_004251029.1|1832950_1834570_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004243092.1|1834795_1835299_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_036894984.1|1835398_1836964_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_004243094.1|1837100_1837523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036894985.1|1837984_1839031_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_103429222.1|1839027_1840422_-	YcjX family protein	NA	NA	NA	NA	NA
WP_004243098.1|1840402_1840660_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004243099.1|1840744_1841101_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_004243100.1|1841100_1841331_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_017628083.1|1841367_1842036_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_004248148.1|1842252_1843257_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_036894987.1|1843537_1845229_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_004251015.1|1845225_1846191_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_004243108.1|1846177_1847071_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004248150.1|1847070_1848072_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.1	5.8e-06
WP_004243110.1|1848061_1848871_+	peptide ABC transporter ATP-binding protein SapF	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
WP_012367980.1|1849079_1849868_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_036894989.1|1850086_1850698_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_004248153.1|1850775_1851645_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_004248155.1|1851765_1853040_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.8	3.6e-85
WP_004243118.1|1853170_1853824_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_004243120.1|1853867_1854980_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_004243121.1|1855200_1855668_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_004243123.1|1856012_1856441_-	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_004243130.1|1856910_1857150_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_012367981.1|1857330_1857738_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004243132.1|1857833_1858472_+	ribonuclease T	NA	NA	NA	NA	NA
WP_036896105.1|1858542_1859751_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.5	8.6e-190
WP_036894992.1|1859773_1860190_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.5	2.2e-44
WP_004243134.1|1860341_1860680_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_036894993.1|1860957_1861188_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	90.8	4.5e-31
WP_049206383.1|1861456_1861801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894997.1|1862253_1862511_-	cloacin	NA	NA	NA	NA	NA
WP_036894998.1|1862732_1862990_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_049206695.1|1862992_1864855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895000.1|1865287_1865902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245936.1|1865903_1866272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895003.1|1866265_1870414_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	70.1	0.0e+00
WP_036895006.1|1870413_1870980_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_036895008.1|1870916_1871636_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.5	1.1e-110
WP_036895011.1|1871639_1872338_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	84.1	6.2e-116
WP_017628783.1|1872334_1872664_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_049206411.1|1872805_1873336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895012.1|1873383_1873662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895014.1|1873677_1877010_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	44.9	1.4e-197
WP_036895017.1|1877074_1878217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895020.1|1878384_1878573_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_036895022.1|1878637_1879045_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_036895024.1|1879208_1879988_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	46.4	1.1e-47
WP_080741352.1|1880063_1880633_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	61.1	2.0e-32
WP_080741348.1|1880706_1880880_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_036895027.1|1881004_1881403_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_036895028.1|1881547_1882069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895031.1|1882070_1883441_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_036895034.1|1883633_1884320_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	70.2	2.2e-89
WP_036895035.1|1884369_1885125_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	78.5	4.5e-104
WP_036895037.1|1885175_1885421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895039.1|1885492_1885864_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	71.5	5.0e-48
WP_036895041.1|1885860_1886229_-	HK97 gp10 family phage protein	NA	A0A1W6JNX7	Morganella_phage	81.1	9.1e-50
WP_049206412.1|1886231_1886573_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	80.5	3.1e-52
WP_049206413.1|1886574_1886952_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	72.0	3.4e-44
WP_036895043.1|1886994_1887945_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.8	7.8e-154
WP_036895046.1|1887950_1888637_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	80.6	8.9e-75
WP_036895047.1|1888711_1889776_-|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.4	5.4e-103
WP_036895048.1|1889784_1891161_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.4	2.0e-211
WP_036895049.1|1891162_1892647_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.7	3.6e-270
WP_036895051.1|1892649_1893252_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.3e-65
WP_017628805.1|1893316_1893868_+	YfbU family protein	NA	NA	NA	NA	NA
WP_017628806.1|1894185_1894425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628807.1|1894547_1894973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895055.1|1895261_1895723_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	4.4e-25
WP_012367623.1|1895725_1895884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628809.1|1895865_1896336_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_036895056.1|1896335_1896605_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.1e-19
WP_036895058.1|1896658_1897081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895059.1|1897555_1898509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895061.1|1898684_1899143_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_036895063.1|1899382_1900015_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	1.2e-22
WP_036895065.1|1900014_1900371_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	4.2e-44
WP_004245984.1|1900367_1900658_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_036895067.1|1900736_1901186_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	1.7e-13
WP_026090523.1|1901253_1901583_-	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
WP_036895068.1|1901610_1902996_-	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	6.8e-114
WP_036895070.1|1902995_1903763_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
WP_167652502.1|1903759_1903933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895073.1|1904028_1904391_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	51.6	2.6e-17
WP_036895075.1|1904522_1904708_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_036895077.1|1904803_1905514_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	60.9	2.8e-79
WP_036895079.1|1905589_1906618_+	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	65.9	2.2e-130
WP_036895081.1|1906604_1907153_+	hypothetical protein	NA	A0A0P0ZCX2	Stx2-converting_phage	35.8	5.2e-17
WP_036895083.1|1907671_1907950_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	84.6	1.5e-33
WP_161799388.1|1907946_1908117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895085.1|1908523_1909066_+	hypothetical protein	NA	A0A1B1W2E3	Salmonella_phage	38.5	1.8e-33
WP_004247466.1|1909176_1909404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164484711.1|1909492_1909648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628822.1|1909655_1909910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628823.1|1909906_1910059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628824.1|1910055_1910376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827451.1|1910377_1910989_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	69.2	1.1e-73
WP_017827452.1|1910988_1911498_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	57.3	4.9e-54
>prophage 5
NZ_CP026059	Proteus mirabilis strain FDAARGOS_80 chromosome, complete genome	3973559	2272534	2291404	3973559	plate,holin,lysis	Burkholderia_phage(26.67%)	22	NA	NA
WP_012368081.1|2272534_2274973_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2274984_2275602_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2275605_2276382_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2276497_2277040_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2277608_2277788_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_103429226.1|2277927_2279163_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	46.9	3.2e-14
WP_017628011.1|2279168_2279825_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_004243616.1|2279821_2281009_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2281001_2281346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368086.1|2281342_2282035_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
WP_004243622.1|2282037_2282850_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2282818_2283139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895252.1|2283151_2283640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895254.1|2283642_2285946_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	24.9	6.8e-18
WP_004243627.1|2286028_2286487_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2286546_2286999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248362.1|2287009_2288497_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
WP_004248364.1|2288505_2289018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895256.1|2289054_2289504_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_036895257.1|2289500_2289905_-	structural protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.0	4.2e-24
WP_004248367.1|2289907_2290207_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2290588_2291404_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 6
NZ_CP026059	Proteus mirabilis strain FDAARGOS_80 chromosome, complete genome	3973559	2480680	2522172	3973559	tRNA,plate,head,lysis,terminase,integrase	Burkholderia_phage(22.5%)	57	2481472:2481491	2522337:2522356
WP_004248453.1|2480680_2481211_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
2481472:2481491	attL	GTGCAAGATATAAGTTACTG	NA	NA	NA	NA
WP_036895334.1|2481761_2482007_+	DinI-like family protein	NA	NA	NA	NA	NA
WP_036895336.1|2482031_2482286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895338.1|2482364_2483417_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_036895339.1|2483447_2484821_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.6	1.2e-14
WP_036895341.1|2484826_2485483_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	5.8e-39
WP_020945492.1|2485479_2486667_-|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	40.3	2.6e-69
WP_036895342.1|2486659_2487004_-	phage related-protein	NA	NA	NA	NA	NA
WP_036895343.1|2487000_2487693_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	40.7	1.2e-29
WP_036895344.1|2487695_2488511_-	hypothetical protein	NA	I7B2Q1	Escherichia_phage	27.1	2.9e-16
WP_004250595.1|2488476_2488794_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	7.4e-08
WP_004250592.1|2488793_2489321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895346.1|2489317_2491669_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.5	7.7e-17
WP_004250588.1|2491752_2492211_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_004250586.1|2492251_2492704_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_036895348.1|2492714_2494202_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.7	2.5e-82
WP_004250583.1|2494210_2494726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250582.1|2494712_2495084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250581.1|2495083_2495542_-	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
WP_004250580.1|2495541_2495973_-	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.0	7.4e-11
WP_036895353.1|2495975_2496317_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	37.3	1.2e-08
WP_004250578.1|2496386_2497454_-	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_036895354.1|2497453_2497951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895357.1|2497950_2499213_-	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	53.7	7.2e-46
WP_036896149.1|2499209_2499923_-|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.7	1.1e-32
WP_036895360.1|2499960_2501463_-	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	41.8	5.1e-99
WP_036895362.1|2501467_2502865_-|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	7.4e-84
WP_036895365.1|2503063_2504083_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.9	1.9e-36
WP_004250565.1|2504572_2505034_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
WP_004250562.1|2505036_2505195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895367.1|2505176_2505647_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	56.2	4.1e-47
WP_036895369.1|2505646_2505916_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	7.4e-17
WP_190306340.1|2506184_2507231_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.1	2.4e-143
WP_036895371.1|2507373_2507571_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	63.5	2.4e-09
WP_036895374.1|2507736_2508267_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	52.0	2.8e-36
WP_006533535.1|2508254_2508566_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	67.7	1.3e-33
WP_036895384.1|2508577_2509171_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	55.3	6.6e-58
WP_036895386.1|2509263_2509851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036895389.1|2509882_2510224_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.1	1.9e-30
WP_052124759.1|2510234_2511038_-	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	45.7	1.0e-61
WP_036895390.1|2511034_2511268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250541.1|2511270_2511447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101495146.1|2511466_2512843_-	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_036895392.1|2512832_2513426_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.1e-44
WP_036895394.1|2513418_2514270_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.4	8.0e-33
WP_004250533.1|2514271_2514496_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_036895397.1|2514513_2514969_-|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	55.4	5.8e-30
WP_036895399.1|2515009_2515267_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004250527.1|2515371_2516130_+	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
WP_036895402.1|2516586_2516919_+	hypothetical protein	NA	H9C158	Pectobacterium_phage	38.1	4.7e-05
WP_036895405.1|2516918_2517179_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	44.0	1.3e-07
WP_036895408.1|2517191_2519147_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.6	5.8e-119
WP_036895410.1|2519158_2519659_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.4	1.6e-41
WP_036895412.1|2519706_2519886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167767281.1|2519914_2520085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036895414.1|2520499_2520775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250508.1|2520771_2522172_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2522337:2522356	attR	GTGCAAGATATAAGTTACTG	NA	NA	NA	NA
>prophage 7
NZ_CP026059	Proteus mirabilis strain FDAARGOS_80 chromosome, complete genome	3973559	3091021	3099901	3973559		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3091021_3092590_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_036895581.1|3092990_3093671_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_036895582.1|3093767_3094343_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.8	3.4e-27
WP_004249446.1|3094419_3094998_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004249445.1|3095065_3096091_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3096125_3096581_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_036895584.1|3096605_3097778_-	TerD family protein	NA	NA	NA	NA	NA
WP_004245609.1|3097778_3098363_-	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_036895585.1|3098755_3099901_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.0	2.7e-31
