The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	387609	458301	4077315	protease,head,portal,lysis,tail,holin,capsid,tRNA,integrase,terminase	Morganella_phage(22.22%)	82	386821:386837	424257:424273
386821:386837	attL	TACCAGAAAATAAAGTA	NA	NA	NA	NA
WP_036904864.1|387609_388644_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_036904867.1|388740_389829_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	80.6	2.5e-172
WP_167392493.1|389847_389997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036904870.1|390146_390560_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_036904873.1|390689_391046_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036904876.1|391517_391763_-	pyocin activator PrtN family protein	NA	A0A1W6JP35	Morganella_phage	72.2	3.3e-24
WP_080749328.1|391823_392261_-	SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	76.9	2.5e-62
WP_036904882.1|392280_392502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036904883.1|392504_393191_-	hypothetical protein	NA	R9VWB9	Serratia_phage	54.4	4.9e-65
WP_052124532.1|393192_393648_-	hypothetical protein	NA	A0A248SL53	Klebsiella_phage	38.6	3.5e-27
WP_036904885.1|393656_394157_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	58.3	1.2e-49
WP_036904887.1|394215_395043_-	YfdQ family protein	NA	U5P439	Shigella_phage	54.3	7.2e-79
WP_036904889.1|395108_395483_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	6.0e-41
WP_036904891.1|395819_396023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052124533.1|396375_397038_-	helix-turn-helix domain-containing protein	NA	A0A1R3Y604	Salmonella_virus	54.4	3.3e-18
WP_036904893.1|397078_397291_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	65.2	6.6e-21
WP_036900998.1|397359_397818_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
WP_036904895.1|397906_398116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904897.1|398105_398285_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	8.1e-12
WP_036904900.1|398294_399413_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	57.2	6.8e-48
WP_036904902.1|399412_400894_+	phage N-6-adenine-methyltransferase	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	49.0	1.1e-88
WP_036904905.1|400890_401283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023582529.1|401282_401453_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_036904907.1|401515_401899_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	53.7	1.7e-27
WP_036904909.1|401917_402721_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	63.1	9.7e-89
WP_036904911.1|402717_403743_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	2.2e-85
WP_036904913.1|403770_404556_+	antitermination protein	NA	F1C595	Cronobacter_phage	45.9	3.6e-64
WP_036904915.1|404604_404949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904917.1|405144_405339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904919.1|405411_406434_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	77.5	1.2e-131
WP_036904921.1|406497_407295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036904922.1|407472_407796_+	negative regulator GrlR	NA	NA	NA	NA	NA
WP_036904926.1|408155_408425_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	47.7	5.7e-17
WP_036904929.1|408424_408895_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.9	5.2e-50
WP_190306334.1|408876_409035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036904932.1|409037_409520_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	83.5	1.4e-42
WP_036904935.1|409759_409963_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_036904942.1|410903_411251_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	94.7	1.3e-58
WP_036904945.1|411413_411887_+|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	97.5	2.1e-83
WP_036904948.1|411890_413624_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	97.0	0.0e+00
WP_023582514.1|413812_415042_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.4	1.7e-177
WP_170832166.1|415019_415664_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	79.9	3.6e-94
WP_036904960.1|415677_416886_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	65.2	7.7e-146
WP_036901048.1|416979_417285_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	56.2	1.9e-24
WP_036904963.1|417284_417611_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	43.9	9.0e-17
WP_036904966.1|417597_417987_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	2.2e-30
WP_190306338.1|417986_418388_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	56.9	1.2e-31
WP_006533916.1|418399_418873_+	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	70.1	8.1e-59
WP_036904969.1|418872_419223_+|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	42.2	1.3e-16
WP_036904971.1|419481_422790_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	39.7	1.0e-168
WP_036904973.1|422790_423390_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	56.0	4.7e-56
WP_036904975.1|423386_423968_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-49
WP_036904977.1|423991_424600_+	hypothetical protein	NA	NA	NA	NA	NA
424257:424273	attR	TACCAGAAAATAAAGTA	NA	NA	NA	NA
WP_036904980.1|424656_425055_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	48.5	1.1e-32
WP_036904984.1|425055_427977_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.3	7.0e-185
WP_036904987.1|427979_428711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052124534.1|429062_430442_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	65.4	4.3e-145
WP_036904992.1|430517_431114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245892.1|431801_433139_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	29.6	1.3e-29
WP_004245891.1|433582_434698_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	5.8e-31
WP_004250112.1|434681_435542_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.7	5.7e-10
WP_004245888.1|435538_436318_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_004245887.1|436434_437478_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_004245886.1|437610_437928_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	51.6	2.5e-08
WP_004250113.1|437954_439028_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004245882.1|439027_439546_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004249176.1|439545_442077_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_004250115.1|442113_442791_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_004245878.1|442889_443450_-	fimbrial protein	NA	NA	NA	NA	NA
WP_004245877.1|444319_445255_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_004250120.1|445443_446718_+	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	28.4	2.0e-19
WP_004245875.1|447148_447742_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004249178.1|447762_448623_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_004245872.1|448622_449141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249182.1|449724_450003_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004245870.1|450023_450308_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004245869.1|450322_450601_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_004249183.1|450668_452321_+	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_004245867.1|452347_452611_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_004245865.1|452618_453767_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_004249184.1|453818_457247_+|holin	choline trimethylamine-lyase	holin	NA	NA	NA	NA
WP_004249185.1|457350_458301_+|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
>prophage 2
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	637005	645879	4077315		Caulobacter_phage(50.0%)	9	NA	NA
WP_004250200.1|637005_638151_-	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	3.5e-31
WP_004250201.1|638543_639128_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_036905057.1|639128_640295_+	TerD family protein	NA	NA	NA	NA	NA
WP_004245607.1|640319_640775_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_004245605.1|640809_641835_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004249446.1|641902_642481_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245603.1|642557_643133_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004245602.1|643229_643910_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004250203.1|644310_645879_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
>prophage 3
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	1169040	1236265	4077315	protease,head,portal,lysis,tail,capsid,transposase,tRNA,integrase,terminase	Morganella_phage(20.0%)	85	1175552:1175583	1215501:1215532
WP_101495341.1|1169040_1170190_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.2	5.7e-50
WP_052124537.1|1170544_1172053_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_170832156.1|1172817_1172994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905192.1|1173190_1173394_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_036905194.1|1173766_1174189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905196.1|1174148_1175039_-	hypothetical protein	NA	NA	NA	NA	NA
1175552:1175583	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCC	NA	NA	NA	NA
WP_036900974.1|1175673_1176846_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	65.6	4.4e-146
WP_036905202.1|1177067_1177466_-	hypothetical protein	NA	S4TTI6	Salmonella_phage	53.2	3.4e-26
WP_036905205.1|1177465_1178071_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.6	3.5e-38
WP_036905208.1|1178100_1178394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905211.1|1178435_1178933_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	73.2	2.0e-44
WP_036905213.1|1178925_1179459_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	1.5e-53
WP_036905215.1|1179515_1180343_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	57.3	1.3e-80
WP_036905218.1|1180408_1180783_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	69.7	6.0e-41
WP_036905221.1|1181171_1181375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905224.1|1181470_1182103_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.8	3.9e-40
WP_036905227.1|1182205_1182397_+	cell division protein	NA	NA	NA	NA	NA
WP_036905230.1|1182448_1183111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036900998.1|1183126_1183585_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
WP_004251659.1|1183673_1183847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247132.1|1183843_1184023_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_036905234.1|1184035_1185097_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	54.4	5.1e-29
WP_036905236.1|1185096_1185735_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	64.6	1.8e-82
WP_036901008.1|1185731_1186127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036901010.1|1186199_1186583_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	52.9	2.3e-27
WP_036901013.1|1186601_1187405_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	63.1	3.3e-89
WP_036905239.1|1187401_1188427_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.7	4.4e-86
WP_036905242.1|1188454_1189234_+	antitermination protein	NA	F1C595	Cronobacter_phage	47.5	3.2e-68
WP_036901019.1|1189447_1189642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905245.1|1189715_1190738_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	70.1	6.9e-132
WP_036905247.1|1190924_1191248_+	negative regulator GrlR	NA	NA	NA	NA	NA
WP_004250558.1|1191606_1191876_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_004247861.1|1191875_1192346_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	58.2	2.2e-48
WP_168725612.1|1192327_1192486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905252.1|1192488_1192950_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	5.0e-13
WP_036905255.1|1193009_1193390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905258.1|1193578_1193929_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.0	1.3e-58
WP_017827279.1|1193925_1194123_+	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	86.2	4.1e-25
WP_017827278.1|1194263_1194722_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	55.4	2.1e-27
WP_017827277.1|1194724_1196455_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	61.0	2.1e-205
WP_017827276.1|1196451_1196613_+	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	62.3	1.6e-11
WP_036905261.1|1196602_1197832_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.8	4.8e-212
WP_036905264.1|1197821_1198427_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	5.3e-87
WP_036905997.1|1198442_1199672_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.0	3.8e-185
WP_026164628.1|1199757_1200060_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	70.0	6.8e-35
WP_080749322.1|1200066_1200393_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	44.5	2.6e-16
WP_036905269.1|1200379_1200769_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	2.2e-30
WP_026164627.1|1200777_1201170_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	57.9	1.2e-31
WP_017827268.1|1201192_1201669_+|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	75.5	6.9e-58
WP_036905272.1|1201668_1202019_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	1.4e-15
WP_036905274.1|1202275_1205557_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	46.1	2.8e-206
WP_036905277.1|1205557_1206157_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	56.0	6.2e-56
WP_036905280.1|1206153_1206735_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	49.5	4.2e-49
WP_036905285.1|1206709_1207366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905289.1|1207425_1207824_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	8.3e-33
WP_036905292.1|1207824_1210821_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.5	7.6e-187
WP_036905294.1|1210823_1211864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052124539.1|1211907_1213239_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	56.8	7.0e-116
WP_036905296.1|1213254_1213923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905298.1|1213994_1214291_-	hypothetical protein	NA	A0A1P8DTI0	Proteus_phage	86.0	1.3e-11
WP_036905300.1|1214516_1215143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905304.1|1215926_1216409_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.7	4.7e-30
1215501:1215532	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCC	NA	NA	NA	NA
WP_004250489.1|1216565_1217000_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004250491.1|1216992_1217286_+	RnfH family protein	NA	NA	NA	NA	NA
WP_004243912.1|1217418_1217781_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004250492.1|1217894_1219556_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004243910.1|1219641_1220541_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004243909.1|1220642_1221254_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_012368143.1|1221345_1222026_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.2	1.7e-57
WP_004248459.1|1222360_1222744_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
WP_036905309.1|1222894_1224250_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.1	1.8e-42
WP_004243900.1|1224518_1225277_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004243899.1|1225577_1226156_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_004243897.1|1226157_1226817_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004243896.1|1226865_1227837_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_004243895.1|1227849_1228314_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_036905312.1|1228634_1230431_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
WP_036905315.1|1230445_1231417_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004248457.1|1231612_1232293_+	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_004243892.1|1232289_1233198_+	GTPase Era	NA	NA	NA	NA	NA
WP_036905317.1|1233210_1233951_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004243888.1|1234020_1234752_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004243887.1|1234751_1235132_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004243886.1|1235161_1235422_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
WP_004248453.1|1235734_1236265_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
>prophage 4
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	1321504	1369761	4077315	lysis,tail,holin,capsid,integrase,terminase	Salmonella_phage(24.49%)	76	1321286:1321345	1369929:1370009
1321286:1321345	attL	TTATATCCATTTAACTAAGGGAACATTTTGCGAGAGGGTGCTTAACTGTTTCTCAGTGTC	NA	NA	NA	NA
WP_036905339.1|1321504_1322680_+|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	76.3	1.3e-182
WP_036905342.1|1322657_1322849_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_036905348.1|1323060_1323663_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.6	2.1e-59
WP_036905351.1|1323649_1324018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167652470.1|1324010_1324184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905353.1|1324341_1324833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905357.1|1324825_1325119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905359.1|1325189_1325444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905361.1|1325506_1325962_-	ASCH domain-containing protein	NA	M1F3E2	Salmonella_phage	26.8	1.9e-12
WP_036905363.1|1325964_1326144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905365.1|1326171_1326372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905367.1|1326476_1327061_-	hypothetical protein	NA	G9L666	Escherichia_phage	56.5	4.8e-53
WP_036905369.1|1327057_1327738_-	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	63.3	2.8e-81
WP_036905372.1|1327744_1328413_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.4	8.8e-19
WP_036905375.1|1328414_1328735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_190306336.1|1328731_1328884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905999.1|1328883_1329336_-	methyltransferase	NA	A0A1W6JP48	Morganella_phage	73.2	1.2e-64
WP_036905378.1|1329350_1329614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170110775.1|1329621_1329777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905381.1|1329830_1330091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905384.1|1330182_1330428_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	45.1	1.9e-11
WP_036905388.1|1330446_1330635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905390.1|1330659_1330902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905393.1|1331025_1332381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905396.1|1332414_1332669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072021437.1|1333021_1333741_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	54.2	3.1e-62
WP_036905398.1|1333847_1334060_+	helix-turn-helix domain-containing protein	NA	A0A2D1GLN0	Escherichia_phage	68.1	1.1e-18
WP_036905401.1|1334251_1334599_+	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	35.4	3.4e-06
WP_036905404.1|1334688_1335375_+	phage antirepressor KilAC domain-containing protein	NA	A0A1P8DTE1	Proteus_phage	67.2	1.1e-75
WP_052124540.1|1335371_1335734_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	36.6	7.4e-12
WP_052124555.1|1336439_1337114_+	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	86.2	6.4e-110
WP_036905413.1|1337131_1337362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146038556.1|1338028_1338256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905425.1|1338463_1338652_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_052124556.1|1338665_1338866_+	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	59.1	4.8e-13
WP_004916478.1|1338867_1339314_+	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	56.7	8.2e-37
WP_036905436.1|1339334_1339694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905439.1|1339967_1340588_+	recombination protein NinG	NA	A0A2I7RAC0	Vibrio_phage	53.6	5.1e-45
WP_036905441.1|1340587_1340803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905444.1|1340799_1341303_+	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	87.4	1.5e-79
WP_036905447.1|1342052_1342820_+	KilA-N domain-containing protein	NA	G9BW66	Planktothrix_phage	35.0	1.3e-18
WP_036906009.1|1342972_1343269_+|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_036905450.1|1343265_1343670_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.0	1.3e-25
WP_036905454.1|1343666_1344122_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	64.3	3.1e-39
WP_036905457.1|1344563_1345346_+	KilA-N domain-containing protein	NA	K7PH51	Enterobacterial_phage	43.4	4.2e-52
WP_036905461.1|1345326_1345686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172409597.1|1345716_1345875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905463.1|1345864_1346050_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	70.5	4.9e-20
WP_036905466.1|1346066_1346492_+	DNA-packaging protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
WP_036905469.1|1346475_1347792_+|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	84.6	1.3e-223
WP_036905471.1|1347791_1349147_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	62.0	5.2e-159
WP_036905473.1|1349097_1350027_+|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	55.7	1.3e-89
WP_036905475.1|1350030_1351305_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	64.2	2.6e-152
WP_036905477.1|1351304_1351754_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	68.5	5.7e-46
WP_004247762.1|1351766_1352861_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.9	2.0e-145
WP_004247764.1|1352870_1353044_+	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_036905480.1|1353100_1353499_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.8	2.0e-55
WP_036905483.1|1353498_1353840_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	52.4	1.2e-24
WP_036905486.1|1353841_1354213_+	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	65.0	5.6e-39
WP_036905489.1|1354209_1354578_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	28.7	2.0e-09
WP_036905492.1|1354642_1355398_+	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	80.1	1.5e-107
WP_036905495.1|1355447_1356140_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	4.0e-91
WP_052124543.1|1356204_1357101_-	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	45.7	5.4e-56
WP_017628788.1|1357090_1357267_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	67.3	4.2e-13
WP_036905498.1|1357373_1357718_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	30.8	6.4e-05
WP_146038557.1|1357850_1358258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905504.1|1358329_1361497_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.2e-102
WP_036905507.1|1361512_1361722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905509.1|1361689_1362007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905512.1|1362152_1362482_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	70.6	2.8e-42
WP_036905514.1|1362478_1363177_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.2	2.0e-114
WP_036906013.1|1363180_1363900_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.5	6.2e-111
WP_036905516.1|1363836_1364403_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	5.3e-49
WP_052124544.1|1364402_1368125_+|tail	phage tail protein	tail	A0A1W6JNW2	Morganella_phage	63.9	0.0e+00
WP_052124545.1|1368140_1369526_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	67.6	4.5e-150
WP_036905518.1|1369530_1369761_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	94.7	1.8e-32
1369929:1370009	attR	TTATATCCATTTAACTAAGGGAACATTTTGCGAGAGGGTGCTTAACTGTTTCTCAGTGTCCGTATAGTACCGTTTTTGTGG	NA	NA	NA	NA
>prophage 5
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	1474198	1490647	4077315	holin,lysis,plate	Burkholderia_phage(28.57%)	21	NA	NA
WP_004248368.1|1474198_1475014_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	3.5e-54
WP_004248367.1|1475394_1475694_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004250708.1|1475696_1476101_+	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	47.9	2.2e-25
WP_004250710.1|1476097_1476547_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004250712.1|1476583_1477096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250714.1|1477104_1478592_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	5.4e-77
WP_004243628.1|1478602_1479055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243627.1|1479114_1479573_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004250717.1|1479655_1481959_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
WP_004250719.1|1481961_1482450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243623.1|1482461_1482782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004243622.1|1482750_1483563_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004250721.1|1483565_1484258_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243617.1|1484254_1484599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905567.1|1484591_1485779_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243615.1|1485775_1486432_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_004250727.1|1486437_1487730_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.6e-14
WP_017628013.1|1487843_1488023_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004250729.1|1488591_1489134_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	1.6e-18
WP_004243611.1|1489249_1490026_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243609.1|1490029_1490647_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
>prophage 6
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	1678634	1723818	4077315	holin,tail,integrase,terminase	Escherichia_phage(25.71%)	50	1681676:1681691	1690389:1690404
WP_004250843.1|1678634_1680101_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
WP_004250844.1|1680185_1681763_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1681676:1681691	attL	TAACCGCATTATCAAT	NA	NA	NA	NA
WP_036900167.1|1681983_1683180_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.9	3.6e-140
WP_004250848.1|1683187_1683376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250849.1|1683375_1683573_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	3.4e-19
WP_004250852.1|1683575_1684223_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	61.6	5.1e-72
WP_004250853.1|1684272_1684992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250855.1|1685077_1685611_-	hypothetical protein	NA	J9Q748	Salmonella_phage	45.7	5.2e-38
WP_004250857.1|1685610_1686105_-	ASCH domain-containing protein	NA	A0A077KCB2	Edwardsiella_phage	27.2	2.4e-13
WP_004250859.1|1686104_1686386_-	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	92.5	8.5e-48
WP_004250861.1|1686422_1686617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250862.1|1686670_1686928_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004250863.1|1686971_1688012_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.4	9.3e-100
WP_004250864.1|1688057_1689782_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	48.0	1.2e-112
WP_004243375.1|1689768_1689930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|1690178_1690787_-	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
1690389:1690404	attR	ATTGATAATGCGGTTA	NA	NA	NA	NA
WP_036900165.1|1690897_1691143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250866.1|1691284_1691506_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	48.3	8.5e-11
WP_004250867.1|1691507_1692443_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	57.6	1.8e-70
WP_004250868.1|1692411_1692894_+	replication protein	NA	NA	NA	NA	NA
WP_004250869.1|1693116_1693530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250870.1|1693526_1693922_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	8.9e-35
WP_004250871.1|1694042_1694222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250872.1|1694285_1694624_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.3	1.3e-29
WP_004250873.1|1694663_1696514_+	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	39.1	8.5e-120
WP_036900160.1|1696573_1697143_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.0e-43
WP_004243357.1|1697142_1698627_+	hypothetical protein	NA	G9L6B8	Escherichia_phage	77.8	9.5e-231
WP_004243356.1|1698812_1699025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250875.1|1699034_1700699_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	65.2	1.8e-198
WP_004243354.1|1700695_1701010_+	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_004250876.1|1701027_1701705_+	hypothetical protein	NA	T1SAP9	Salmonella_phage	64.3	6.8e-43
WP_004243350.1|1701720_1702701_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
WP_004250877.1|1702759_1703191_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	53.4	9.4e-30
WP_004250878.1|1703199_1703541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250879.1|1703594_1704200_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.2	1.8e-66
WP_004250880.1|1704199_1706662_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.1	0.0e+00
WP_036900158.1|1706645_1707134_+	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.2	5.1e-48
WP_004250882.1|1707133_1707682_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	59.6	5.9e-45
WP_004250883.1|1707684_1710768_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.2	1.0e-162
WP_036900155.1|1710767_1714151_+	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.4	3.1e-184
WP_004250885.1|1714237_1715305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250886.1|1715329_1715581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250887.1|1715754_1717908_+	hypothetical protein	NA	G9L6E4	Escherichia_phage	56.6	8.2e-66
WP_004250889.1|1717972_1719826_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	40.6	1.8e-114
WP_004250891.1|1720012_1720384_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	5.1e-16
WP_004243326.1|1720380_1720653_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_004250892.1|1720655_1721114_+	hypothetical protein	NA	A0A0D4DAE2	Escherichia_phage	50.4	4.0e-31
WP_004250894.1|1721129_1721624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905599.1|1722002_1722782_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.7	4.8e-32
WP_004243319.1|1722765_1723818_+	nucleotidyltransferase domain-containing protein	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
>prophage 7
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2061723	2071715	4077315		Escherichia_phage(66.67%)	8	NA	NA
WP_036905686.1|2061723_2064168_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.1	3.1e-218
WP_004242892.1|2064179_2064797_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_004242891.1|2064798_2065659_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_036905689.1|2065798_2066410_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.5	8.1e-27
WP_004242888.1|2066462_2066924_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242887.1|2066923_2067610_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242886.1|2067945_2069646_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004251244.1|2069657_2071715_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
>prophage 8
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2305239	2337341	4077315	protease,head,portal,lysis,tail,capsid,transposase,terminase	Proteus_phage(10.53%)	36	NA	NA
WP_004242508.1|2305239_2305398_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004251516.1|2306166_2306571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905761.1|2306853_2307840_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_004251525.1|2308246_2309149_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	40.3	1.2e-58
WP_004247902.1|2310336_2310501_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
WP_072021439.1|2310941_2312021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157673314.1|2312041_2313322_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_036905765.1|2314411_2314717_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247524.1|2315421_2315682_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_036905768.1|2315698_2315965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|2315961_2316648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627865.1|2316647_2316980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251558.1|2320694_2321093_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
WP_004251562.1|2321124_2321430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251564.1|2321441_2322023_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
WP_004251569.1|2322022_2322619_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	4.6e-51
WP_036905771.1|2322619_2325895_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	6.4e-54
WP_004242485.1|2326021_2326213_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_036894769.1|2326237_2326516_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004251577.1|2326512_2326929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905773.1|2326993_2327659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251583.1|2327668_2328010_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251585.1|2328015_2328489_-	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_004251588.1|2328478_2328808_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_004251590.1|2328807_2329107_-|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_036905774.1|2329145_2330312_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	2.8e-169
WP_004251596.1|2330315_2330984_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_012367784.1|2331001_2332270_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_036905776.1|2332266_2334003_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
WP_036905779.1|2333956_2334424_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_036905782.1|2334547_2334760_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_001967215.1|2334762_2335101_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905787.1|2335997_2336459_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_162837602.1|2336461_2336620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900946.1|2336601_2337072_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_036905789.1|2337071_2337341_-	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
>prophage 9
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2341645	2352760	4077315	integrase	Morganella_phage(28.57%)	16	2336868:2336881	2352353:2352366
2336868:2336881	attL	TTTGTAATAACGCA	NA	NA	NA	NA
WP_004247137.1|2341645_2341858_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247136.1|2342200_2342599_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247135.1|2342626_2343652_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247134.1|2343651_2344359_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247133.1|2344530_2345622_-	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_004247132.1|2345634_2345814_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
WP_004247131.1|2345803_2346013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247130.1|2346102_2346561_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_004247129.1|2346645_2346885_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247128.1|2346988_2347471_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247126.1|2348119_2348494_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247125.1|2348559_2349387_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247124.1|2349443_2349974_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004251672.1|2350035_2350278_+	excisionase	NA	NA	NA	NA	NA
WP_004251675.1|2350258_2351386_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	60.6	3.7e-126
WP_004247120.1|2351506_2352760_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
2352353:2352366	attR	TTTGTAATAACGCA	NA	NA	NA	NA
>prophage 10
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2459870	2520439	4077315	tRNA,protease,plate	Tupanvirus(16.67%)	42	NA	NA
WP_004251931.1|2459870_2461613_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_004244680.1|2461696_2462215_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_004244679.1|2462522_2462693_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_004244678.1|2463181_2463586_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_004251932.1|2463673_2464246_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_004244676.1|2464245_2465898_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_046335287.1|2465890_2467195_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_004244674.1|2467272_2469204_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
WP_036905818.1|2469210_2471325_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_004244672.1|2471434_2472577_+	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_004244671.1|2472843_2473395_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_004251935.1|2473609_2474620_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004247678.1|2474976_2476008_+	DUF1016 family protein	NA	NA	NA	NA	NA
WP_004251937.1|2476169_2478785_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.4	6.3e-20
WP_004244666.1|2479126_2480341_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
WP_017827340.1|2480355_2480547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244664.1|2480620_2482021_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.4	1.5e-81
WP_121909311.1|2482365_2483478_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	1.3e-96
WP_004251941.1|2483830_2485021_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_157672301.1|2485152_2485308_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004247672.1|2485445_2486408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004247670.1|2487123_2487438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244643.1|2488627_2489038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004251951.1|2493856_2494276_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_004251952.1|2494287_2496480_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004246976.1|2496563_2497082_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004247653.1|2498978_2499479_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004247652.1|2499499_2500978_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004244624.1|2500983_2501415_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004251972.1|2501422_2503198_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004251976.1|2503161_2504199_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004251978.1|2504203_2505472_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244619.1|2505473_2506025_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247647.1|2506026_2507385_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244617.1|2507377_2508133_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004251982.1|2508141_2510853_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
WP_004244614.1|2510856_2511645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244612.1|2511646_2512297_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_012367720.1|2512302_2513766_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_036905819.1|2513768_2517317_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_036900839.1|2517354_2518710_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244608.1|2518702_2520439_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 11
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2754486	2801842	4077315	lysis,capsid,tail,integrase	Morganella_phage(55.56%)	62	2747571:2747589	2801911:2801929
2747571:2747589	attL	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
WP_004247524.1|2754486_2754747_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
WP_036905825.1|2754763_2755030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627864.1|2755026_2755713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017627865.1|2755712_2756045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052124551.1|2756034_2760180_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.5	0.0e+00
WP_017628780.1|2760179_2760746_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	76.7	3.1e-49
WP_017827412.1|2760682_2761402_-	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.5	1.4e-110
WP_017827413.1|2761405_2762104_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	82.8	2.6e-114
WP_017628783.1|2762100_2762430_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	71.6	9.6e-43
WP_017827414.1|2762573_2762885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827415.1|2762886_2763087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827416.1|2763102_2766438_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	45.4	2.5e-207
WP_017827417.1|2766502_2766811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827418.1|2766913_2768062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827419.1|2768062_2769265_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017827420.1|2769501_2770227_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.8	1.4e-65
WP_017827422.1|2770997_2771168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827423.1|2771270_2772044_+	LexA family transcriptional regulator	NA	A2I308	Vibrio_virus	30.8	2.3e-10
WP_017827424.1|2772166_2773156_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	46.4	1.3e-71
WP_017827425.1|2773316_2774009_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.1	7.6e-90
WP_026164642.1|2774058_2774814_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	77.3	9.1e-105
WP_017827427.1|2774878_2775250_-	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	3.3e-47
WP_017827428.1|2775246_2775615_-	HK97 gp10 family phage protein	NA	A0A1W6JNX7	Morganella_phage	82.8	1.4e-50
WP_017827429.1|2775617_2775959_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	79.6	6.9e-52
WP_017628798.1|2775960_2776338_-	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_017827430.1|2776380_2777331_-	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.1	1.3e-153
WP_017628800.1|2777336_2778023_-	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_017827431.1|2778097_2779162_-|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.1	6.0e-102
WP_017628802.1|2779170_2780547_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.6	9.1e-212
WP_017628803.1|2780548_2782033_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.7	4.7e-270
WP_017628804.1|2782035_2782638_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	68.5	2.1e-64
WP_017827432.1|2782671_2782830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245979.1|2782826_2783033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827433.1|2783962_2784424_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.9	2.8e-24
WP_004244729.1|2784426_2784585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827434.1|2784566_2785037_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_026164644.1|2785036_2785306_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_004247488.1|2785359_2785782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827436.1|2786197_2787124_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|2787227_2787563_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_017827437.1|2788078_2788462_-	antitermination protein Q	NA	A0A088CD47	Shigella_phage	72.2	5.5e-50
WP_017827438.1|2788461_2789421_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	56.7	8.9e-105
WP_017827439.1|2789383_2791021_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	68.1	4.3e-208
WP_036905828.1|2791023_2791473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080633834.1|2791715_2792075_-	hypothetical protein	NA	A0A088C4S1	Shewanella_sp._phage	41.8	4.2e-07
WP_017827442.1|2792162_2792510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245989.1|2792673_2792883_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_017827443.1|2792965_2793649_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.7	3.0e-131
WP_017827444.1|2793850_2794819_+	P63C domain-containing protein	NA	Q8HA04	Enterobacteria_phage	34.2	8.2e-42
WP_017827445.1|2795239_2795557_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	9.3e-19
WP_017827446.1|2795565_2795772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827447.1|2795768_2795981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827448.1|2796148_2796304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827449.1|2796376_2796637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247706.1|2796857_2797133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827450.1|2797129_2797282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628824.1|2797278_2797599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827451.1|2797600_2798212_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	69.2	1.1e-73
WP_017827452.1|2798211_2798721_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	57.3	4.9e-54
WP_017827453.1|2798792_2799488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246013.1|2800638_2800884_+	excisionase	NA	NA	NA	NA	NA
WP_026164649.1|2800840_2801842_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.3	1.9e-70
2801911:2801929	attR	ACTATAATCCAATAAGCAG	NA	NA	NA	NA
>prophage 12
NZ_CP026062	Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome	4077315	2837752	2849706	4077315		Mycobacterium_phage(25.0%)	13	NA	NA
WP_004246054.1|2837752_2838964_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
WP_026090527.1|2839162_2839426_+	YbeD family protein	NA	NA	NA	NA	NA
WP_004246056.1|2839777_2840422_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_004246057.1|2840523_2841489_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246058.1|2841504_2841879_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246065.1|2842622_2842763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246068.1|2842947_2843157_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004252245.1|2843353_2843827_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246071.1|2844108_2844333_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246072.1|2844344_2844749_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004252248.1|2844777_2846904_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004252250.1|2846929_2847898_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	4.6e-133
WP_004247426.1|2848506_2849706_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
