The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006910	Streptococcus agalactiae CNCTC 10/84 chromosome, complete genome	2013842	40879	48991	2013842		Synechococcus_phage(33.33%)	7	NA	NA
WP_000220673.1|40879_42334_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	2.2e-54
WP_001291330.1|42361_43384_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.4	5.2e-63
WP_000686112.1|43551_44100_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	6.1e-26
WP_000780024.1|44122_44875_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000166555.1|44894_46442_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.5	1.3e-78
WP_001045908.1|46634_47534_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783421.1|47680_48991_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	1.7e-05
>prophage 2
NZ_CP006910	Streptococcus agalactiae CNCTC 10/84 chromosome, complete genome	2013842	530408	633476	2013842	head,holin,tail,integrase,protease,tRNA,capsid,portal,terminase,transposase	Streptococcus_phage(59.38%)	111	550675:550734	591557:591637
WP_000768156.1|530408_533201_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.7	2.4e-86
WP_001237035.1|533317_533620_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_000184290.1|533683_534139_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000882547.1|534324_536586_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.4	5.7e-126
WP_000443582.1|536883_537114_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_001011647.1|537254_537947_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000230128.1|537939_538674_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.8	1.1e-35
WP_001106851.1|538959_540654_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.9	2.5e-126
WP_000137498.1|540792_541647_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	40.2	1.5e-39
WP_000634979.1|541643_542480_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_001286948.1|542605_543946_+	exodeoxyribonuclease VII large subunit	NA	L7RDW5	Acanthamoeba_polyphaga_moumouvirus	31.7	1.5e-38
WP_001280898.1|543923_544139_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000256279.1|544138_545011_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_001041037.1|545003_545831_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_000747940.1|545817_546291_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000923615.1|546302_547961_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_000034835.1|548073_548910_+	DegV family protein	NA	NA	NA	NA	NA
WP_001035227.1|548902_549742_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_000806954.1|549716_550319_+	YpmS family protein	NA	NA	NA	NA	NA
WP_001284634.1|550421_550697_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.2e-25
550675:550734	attL	CTCTTAAAGACGCTGTTAAATAATTCGTCTAGAAAAACCTTGTCATATCAATGTTTATTG	NA	NA	NA	NA
WP_000269474.1|550784_551927_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	82.9	1.1e-183
WP_000353929.1|552041_552593_-	hypothetical protein	NA	A7J267	Streptococcus_phage	64.8	1.7e-60
WP_000151183.1|552610_552997_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	57.6	3.0e-35
WP_000493080.1|553000_553348_-	helix-turn-helix transcriptional regulator	NA	A0A126GGQ7	Streptococcus_phage	75.2	2.3e-42
WP_000739595.1|553644_553890_+	hypothetical protein	NA	X2L066	Streptococcus_phage	55.8	7.4e-08
WP_000092751.1|553840_554629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001112862.1|554679_554871_+	hypothetical protein	NA	A0A141DZR9	Streptococcus_phage	69.8	4.7e-18
WP_001123483.1|554950_555262_+	hypothetical protein	NA	M1Q0Y6	Streptococcus_phage	89.2	3.4e-50
WP_000910901.1|555409_555637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000573548.1|555629_555860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156423.1|555843_557163_+	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	63.2	3.3e-150
WP_001167562.1|557177_558272_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	55.1	5.9e-105
WP_000361801.1|558311_558734_+	hypothetical protein	NA	M1I9V9	Streptococcus_phage	59.2	2.3e-33
WP_001293486.1|558735_559470_+	hypothetical protein	NA	Q0R597	Streptococcus_phage	60.1	3.6e-74
WP_038406062.1|559490_560096_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	48.2	3.2e-36
WP_001876771.1|560095_560704_+	hypothetical protein	NA	D2XPY9	Bacillus_virus	45.0	2.3e-42
WP_032457631.1|560709_562293_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	78.0	4.4e-234
WP_000427885.1|562301_562499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114109.1|562491_562743_-	hypothetical protein	NA	A0A097BY83	Enterococcus_phage	52.8	1.3e-20
WP_000829573.1|562813_565093_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	62.7	4.6e-277
WP_000388746.1|565454_565673_+	hypothetical protein	NA	A0A1S5SEA6	Streptococcus_phage	68.1	1.7e-19
WP_000569002.1|565665_566061_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	60.3	9.8e-42
WP_000687319.1|566057_566273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145465.1|566269_566506_+	DUF3310 domain-containing protein	NA	A0A097PAQ7	Streptococcus_pyogenes_phage	93.6	2.3e-38
WP_000041037.1|566812_567226_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	62.0	1.3e-41
WP_001075092.1|567400_568153_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_038406064.1|568206_568638_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	81.8	6.9e-57
WP_000208744.1|568627_569908_+|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	93.9	1.8e-233
WP_000462947.1|569922_571452_+|portal	phage portal protein	portal	A7J292	Streptococcus_phage	84.0	1.8e-248
WP_000358741.1|571417_572860_+|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	78.2	2.0e-225
WP_025194292.1|572887_573076_+	hypothetical protein	NA	A7J294	Streptococcus_phage	77.4	3.7e-15
WP_001042286.1|573080_573284_+	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	53.4	1.3e-13
WP_000797011.1|573426_573996_+	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	89.9	1.5e-72
WP_000818573.1|574014_574911_+	hypothetical protein	NA	A7J297	Streptococcus_phage	94.6	2.4e-152
WP_000356704.1|574916_575273_+|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	61.9	1.2e-33
WP_000639436.1|575283_575562_+	hypothetical protein	NA	A7J299	Streptococcus_phage	97.8	1.2e-46
WP_000060407.1|575558_575903_+	hypothetical protein	NA	A7J2A0	Streptococcus_phage	94.7	6.3e-53
WP_000331817.1|575910_576270_+	hypothetical protein	NA	A7J2A1	Streptococcus_phage	70.3	2.6e-41
WP_000450518.1|576281_576914_+|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	68.9	8.8e-61
WP_000424191.1|576964_577420_+	hypothetical protein	NA	A7J2A3	Streptococcus_phage	70.2	6.8e-55
WP_000398752.1|577494_577725_+	hypothetical protein	NA	A7J2A4	Streptococcus_phage	59.2	2.2e-14
WP_000929199.1|577753_581980_+	tape measure protein	NA	A7J2A5	Streptococcus_phage	46.6	1.4e-21
WP_000365119.1|581992_582835_+	hypothetical protein	NA	A7J2A6	Streptococcus_phage	48.6	3.4e-76
WP_001870768.1|586845_587262_+	DUF1366 domain-containing protein	NA	NA	NA	NA	NA
WP_000564986.1|587495_587786_+	hypothetical protein	NA	J7KH30	Streptococcus_phage	90.5	1.8e-40
WP_000611525.1|587787_588039_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	95.2	2.5e-35
WP_000143381.1|588158_589352_+	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	81.2	9.1e-192
WP_000837684.1|589717_590233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000076712.1|590359_590560_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	100.0	2.9e-26
WP_000965651.1|591190_591370_+	hypothetical protein	NA	J7KIW4	Streptococcus_phage	86.4	2.1e-20
WP_001290370.1|591775_591973_+	hypothetical protein	NA	NA	NA	NA	NA
591557:591637	attR	CTCTTAAAGACGCTGTTAAATAATTCGTCTAGAAAAACCTTGTCATATCAATGTTTATTGATAGCGACAAGGTTCTTTTTT	NA	NA	NA	NA
WP_000254064.1|592016_592949_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.7	6.7e-65
WP_001185382.1|593134_594370_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000285509.1|594388_595600_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000527084.1|595612_596848_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_000200665.1|596832_597645_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_001003536.1|597715_599032_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.6	8.1e-24
WP_001209460.1|599095_599494_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_000910750.1|599837_602522_+	calcium-translocating P-type ATPase, PMCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.3	1.1e-70
WP_000163480.1|602566_603427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064632.1|603578_605510_+	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_000351633.1|605599_606724_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011324939.1|606792_607890_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_001173889.1|607909_608602_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-28
WP_000236202.1|608585_609515_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001022572.1|609567_610278_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001115859.1|610274_610973_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	64.9	1.5e-82
WP_000048144.1|611140_611905_+	(S)-acetoin forming diacetyl reductase	NA	V5L4T3	Hirudovirus	31.8	9.8e-06
WP_000458616.1|612012_614520_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	50.5	2.2e-219
WP_038406066.1|614605_615799_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000038476.1|615819_617166_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	2.8e-56
WP_000167489.1|617205_617763_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001031102.1|617759_618743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000965180.1|618987_619401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278845.1|619554_620445_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.1	7.4e-05
WP_001231100.1|620441_621416_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	78.8	7.5e-144
WP_000011319.1|621412_622324_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	65.7	1.8e-107
WP_000752446.1|622338_623736_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_001227406.1|623877_625398_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_000710757.1|625509_625770_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000583235.1|625878_626814_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_000189645.1|627079_628102_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_001162136.1|628160_628604_+	flavodoxin	NA	NA	NA	NA	NA
WP_000418127.1|628680_628956_+	chorismate mutase	NA	NA	NA	NA	NA
WP_000595706.1|628948_630145_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	3.6e-103
WP_001068667.1|630728_631076_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001872365.1|631826_632093_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|632092_632497_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122305.1|632658_632859_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001865698.1|632880_633141_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001867107.1|633266_633476_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
>prophage 3
NZ_CP006910	Streptococcus agalactiae CNCTC 10/84 chromosome, complete genome	2013842	1502908	1513641	2013842		Streptococcus_phage(84.62%)	14	NA	NA
WP_000767486.1|1502908_1503736_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	1.1e-124
WP_000287943.1|1503777_1504134_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	72.6	5.2e-42
WP_000966772.1|1504135_1504612_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.9	7.1e-39
WP_000232150.1|1504667_1505849_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.6	5.3e-168
WP_001167085.1|1505911_1506460_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000158395.1|1506527_1507619_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	78.0	2.3e-165
WP_038406093.1|1507751_1508387_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000425860.1|1508655_1509525_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.7	3.7e-110
WP_000358198.1|1509524_1509851_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364569.1|1509881_1510745_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.7	1.2e-73
WP_000715591.1|1510764_1511400_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	4.9e-67
WP_001144244.1|1511488_1512148_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	56.0	6.2e-65
WP_000178149.1|1512166_1512877_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
WP_001185985.1|1512876_1513641_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.4	4.9e-13
