The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	0	5760	4079669	tRNA	uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_003247145.1|1052_1937_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_038428251.1|1958_2549_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_038428252.1|2870_4148_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	5.9e-96
WP_038428253.1|4486_5140_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.5	2.9e-22
WP_003226790.1|5136_5760_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	24.3	9.1e-10
>prophage 2
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	8804	10496	4079669		Bacteriophage(100.0%)	1	NA	NA
WP_014475560.1|8804_10496_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	34.4	8.7e-55
>prophage 3
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	18390	31856	4079669	tRNA	Streptococcus_phage(42.86%)	15	NA	NA
WP_038428258.1|18390_19551_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	30.7	2.1e-36
WP_038428260.1|19632_21075_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_038428261.1|21071_21710_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.4	4.1e-58
WP_003242755.1|21783_22113_+	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_009966249.1|22125_22566_+	YaaR family protein	NA	NA	NA	NA	NA
WP_003226770.1|22577_23567_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.1	1.1e-33
WP_003226767.1|23569_24397_+	competence/sporulation regulator complex protein RicT	NA	NA	NA	NA	NA
WP_003218308.1|24411_24771_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003244526.1|24829_25573_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003242983.1|25559_25859_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_038428262.1|25833_26712_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.9	3.9e-67
WP_003226760.1|26760_27051_-	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	54.3	8.0e-17
WP_003226758.1|27545_29540_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	4.0e-99
WP_014475570.1|29619_30387_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_038428263.1|30542_31856_+	DUF348 domain-containing protein	NA	A0A217ER34	Bacillus_phage	71.3	3.7e-29
>prophage 4
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	38266	40613	4079669		Tupanvirus(100.0%)	2	NA	NA
WP_015382564.1|38266_39637_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	3.8e-32
WP_003218353.1|39659_40613_+	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.9	5.1e-44
>prophage 5
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	46014	46551	4079669		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003218365.1|46014_46551_+	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 6
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	58899	66790	4079669	protease	Micromonas_pusilla_virus(25.0%)	7	NA	NA
WP_038428271.1|58899_60813_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.1	8.5e-115
WP_010886388.1|61007_61784_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_003226695.1|61795_62671_+	redox-regulated molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003226693.1|62717_63611_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003218399.1|63686_64613_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.2	5.2e-110
WP_033884635.1|64779_66192_+	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	31.5	2.9e-35
WP_017696363.1|66205_66790_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.1	3.2e-65
>prophage 7
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	70642	72142	4079669	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003226674.1|70642_72142_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.4	6.2e-97
>prophage 8
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	79810	82243	4079669	protease	Klebsiella_phage(100.0%)	1	NA	NA
WP_003235011.1|79810_82243_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	40.1	1.5e-132
>prophage 9
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	89688	91089	4079669	tRNA	Catovirus(100.0%)	1	NA	NA
WP_029317181.1|89688_91089_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	4.7e-62
>prophage 10
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	94128	94662	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_003225764.1|94128_94662_+	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	9.2e-11
>prophage 11
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	98157	109001	4079669		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_009966326.1|98157_101739_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.7	1.2e-48
WP_004399688.1|101800_105400_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	2.8e-66
WP_003225778.1|105578_105827_+	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_003225781.1|105940_106357_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003225784.1|106398_106869_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003235056.1|106922_109001_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	7.4e-64
>prophage 12
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	126680	128371	4079669		Planktothrix_phage(50.0%)	2	NA	NA
WP_004399689.1|126680_127526_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.2e-20
WP_003235106.1|127501_128371_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	4.0e-11
>prophage 13
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	132846	133560	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_038428278.1|132846_133560_+	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N6W8I1	Bacillus_phage	30.5	3.7e-15
>prophage 14
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	142868	144305	4079669		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038428280.1|142868_144305_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.7	3.6e-142
>prophage 15
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	166062	170678	4079669		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_015252962.1|166062_167865_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.8	3.1e-103
WP_154231159.1|167911_168052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428287.1|168332_169244_-	DNA-3-methyladenine glycosidase II	NA	NA	NA	NA	NA
WP_038428288.1|169516_170152_+	bifunctional transcriptional activator/DNA repair enzyme AdaA	NA	NA	NA	NA	NA
WP_029726931.1|170138_170678_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.7	5.3e-22
>prophage 16
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	180750	183480	4079669		Bacillus_phage(50.0%)	4	NA	NA
WP_015252948.1|180750_181422_+	two-component system response regulator YbdK	NA	W8CYM9	Bacillus_phage	32.1	1.1e-24
WP_082098087.1|181442_182405_+	two-component system sensor histidine kinase YbdK	NA	NA	NA	NA	NA
WP_088325232.1|182470_182725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015715158.1|182709_183480_-	protein kinase	NA	A0A2I2L4H4	Orpheovirus	32.7	1.9e-09
>prophage 17
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	192502	193384	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038428300.1|192502_193384_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	39.3	1.7e-41
>prophage 18
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	213396	215292	4079669		Vibrio_phage(100.0%)	1	NA	NA
WP_015252925.1|213396_215292_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	42.3	9.0e-08
>prophage 19
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	236869	239502	4079669		Bacillus_phage(66.67%)	3	NA	NA
WP_009966453.1|236869_237550_+	two-component system response regulator YcbL	NA	W8CYM9	Bacillus_phage	33.2	2.1e-31
WP_038427309.1|237551_238487_+	two-component system sensor histidine kinase YcbM	NA	W8CYF6	Bacillus_phage	25.9	1.5e-24
WP_003246292.1|238578_239502_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	7.9e-42
>prophage 20
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	244540	245269	4079669		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_014475692.1|244540_245269_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.0	5.8e-16
>prophage 21
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	254921	255662	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015252894.1|254921_255662_+	sodium ABC transporter ATP-binding protein NatA	NA	A0A2H4PQG7	Staphylococcus_phage	31.5	5.4e-25
>prophage 22
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	262298	264046	4079669		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_017695036.1|262298_262802_-	peptidoglycan L-alanyl-D-glutamate endopeptidase CwlK	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	50.8	3.8e-30
WP_015715201.1|262924_264046_+	response regulator aspartate phosphatase RapJ	NA	A0A1P8CWN8	Bacillus_phage	32.5	6.0e-52
>prophage 23
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	267840	273293	4079669		Caulobacter_phage(60.0%)	7	NA	NA
WP_014475714.1|267840_268536_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.1	3.5e-18
WP_003246340.1|268493_269336_+	zinc ABC transporter permease ZnuB	NA	NA	NA	NA	NA
WP_032722885.1|269373_270369_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003234725.1|270652_271252_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.0	4.1e-23
WP_003234723.1|271273_271855_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.7	6.7e-31
WP_003241242.1|271889_272468_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.8	1.3e-29
WP_003234719.1|272519_273293_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	64.6	8.5e-82
>prophage 24
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	279537	280794	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_038428328.1|279537_280794_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	2.4e-33
>prophage 25
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	296831	297650	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_003246440.1|296831_297650_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	61.1	1.6e-91
>prophage 26
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	302122	304006	4079669		Pseudomonas_phage(50.0%)	2	NA	NA
WP_003246492.1|302122_302905_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.9	9.9e-46
WP_072173922.1|303094_304006_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	42.6	1.6e-66
>prophage 27
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	311402	312413	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_038428333.1|311402_312413_+	ferredoxin--NADP(+) reductase	NA	G3MA85	Bacillus_virus	26.1	1.6e-16
>prophage 28
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	316846	318979	4079669		Escherichia_phage(100.0%)	1	NA	NA
WP_038428335.1|316846_318979_-	assimilatory nitrate reductase catalytic subunit	NA	A0A077SK27	Escherichia_phage	22.9	3.1e-17
>prophage 29
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	328800	360902	4079669		Tupanvirus(50.0%)	10	NA	NA
WP_038428341.1|328800_330234_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	30.6	2.9e-51
WP_017696126.1|330270_330669_-	DNA-entry nuclease inhibitor	NA	NA	NA	NA	NA
WP_017696127.1|330695_331145_-	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	67.8	2.9e-42
WP_038428342.1|331312_333034_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	3.6e-16
WP_038428343.1|333144_333702_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003246452.1|333707_334340_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_003246265.1|334573_334936_+	transcriptional activator HxlR	NA	NA	NA	NA	NA
WP_038428344.1|335510_346274_+	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	26.9	1.2e-165
WP_038428345.1|346286_357038_+	surfactin non-ribosomal peptide synthetase SrfAB	NA	A0A2K9KZV5	Tupanvirus	27.4	1.3e-167
WP_038428346.1|357074_360902_+	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.4	6.5e-90
>prophage 30
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	364672	368492	4079669		Streptococcus_phage(50.0%)	4	NA	NA
WP_038428349.1|364672_366007_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	39.9	1.7e-66
WP_032726545.1|366001_366676_-	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_014475783.1|366780_367428_-	YitT family protein	NA	NA	NA	NA	NA
WP_003246629.1|367748_368492_-	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	37.7	5.4e-33
>prophage 31
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	374777	378290	4079669		Acinetobacter_phage(50.0%)	2	NA	NA
WP_015252830.1|374777_376256_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.2	6.2e-81
WP_015252829.1|376535_378290_+	hypothetical protein	NA	U5PSS0	Bacillus_phage	42.4	3.3e-121
>prophage 32
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	385118	393557	4079669		Bacillus_phage(60.0%)	10	NA	NA
WP_015482792.1|385118_385802_+	two-component system response regulator YclJ	NA	W8CYM9	Bacillus_phage	40.4	3.6e-44
WP_082098066.1|385788_387210_+	two-component system sensor histidine kinase YclK	NA	W8CYF6	Bacillus_phage	35.0	1.6e-41
WP_003246686.1|387373_388522_+	response regulator aspartate phosphatase RapC	NA	A0A1P8CWN8	Bacillus_phage	44.6	5.9e-79
WP_003224994.1|388505_388628_+	phosphatase RapC inhibitor PhrC	NA	NA	NA	NA	NA
WP_015482794.1|388727_388817_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003234495.1|388898_389012_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_038428355.1|389165_390530_-	aspartate kinase	NA	NA	NA	NA	NA
WP_038428356.1|390914_391865_+	petrobactin ABC transporter permease YclN	NA	A0A2H4IY97	uncultured_Caudovirales_phage	54.5	5.3e-94
WP_003246705.1|391857_392805_+	petrobactin ABC transporter permease YclO	NA	NA	NA	NA	NA
WP_003234487.1|392798_393557_+	petrobactin ABC transporter ATP-binding protein YclP	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.6	3.4e-19
>prophage 33
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	400113	404672	4079669		Klosneuvirus(50.0%)	4	NA	NA
WP_038428361.1|400113_401424_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.5	5.2e-23
WP_038429981.1|401492_402881_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003234455.1|403003_403867_+	glucose uptake protein GlcU	NA	NA	NA	NA	NA
WP_003246720.1|403886_404672_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	6.3e-24
>prophage 34
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	427965	431108	4079669		Staphylococcus_phage(50.0%)	3	NA	NA
WP_038428367.1|427965_429477_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	9.9e-42
WP_082098089.1|429496_430042_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_038428370.1|430247_431108_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.6	2.3e-56
>prophage 35
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	435099	437283	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_003246684.1|435099_437283_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.0	1.6e-40
>prophage 36
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	446852	449093	4079669		Burkholderia_virus(50.0%)	2	NA	NA
WP_038428376.1|446852_447302_+	8-oxo-dGTP diphosphatase MutT	NA	Q6UJ14	Burkholderia_virus	36.4	1.3e-05
WP_038428377.1|447368_449093_+	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	25.8	2.1e-35
>prophage 37
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	461442	462369	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038428381.1|461442_462369_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	1.0e-36
>prophage 38
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	466289	466610	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038428382.1|466289_466610_-	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	33.3	6.3e-07
>prophage 39
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	469693	471178	4079669		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003246685.1|469693_471178_+	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.3	7.6e-63
>prophage 40
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	477422	477773	4079669		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003156187.1|477422_477773_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 41
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	481342	482131	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_003246715.1|481342_482131_+	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.2	2.2e-24
>prophage 42
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	485515	485968	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_003234309.1|485515_485968_+	SprT family protein	NA	U5J9G1	Bacillus_phage	29.8	3.8e-05
>prophage 43
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	489190	494344	4079669		Bacillus_phage(33.33%)	5	NA	NA
WP_038428389.1|489190_490912_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	57.6	1.4e-137
WP_003240464.1|491392_491626_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033883540.1|491622_491976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428390.1|492407_493436_-	fatty acid desaturase	NA	A0A1V0SAL5	Catovirus	28.1	4.1e-31
WP_003234247.1|494143_494344_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.8	9.6e-22
>prophage 44
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	506476	508236	4079669		Bacillus_phage(100.0%)	2	NA	NA
WP_038428397.1|506476_507163_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.6	1.8e-43
WP_038428398.1|507159_508236_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	5.1e-24
>prophage 45
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	514879	515752	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_029725818.1|514879_515752_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.0	8.2e-33
>prophage 46
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	520102	521410	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015252728.1|520102_521410_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	66.8	8.3e-154
>prophage 47
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	544966	546613	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_038428420.1|544966_546613_-	ABC-F type ribosomal protection protein VmlR	NA	Q6DMX7	Streptococcus_phage	31.7	7.2e-54
>prophage 48
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	552425	553055	4079669		Clostridioides_phage(100.0%)	1	NA	NA
WP_015252704.1|552425_553055_-	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	53.1	6.2e-06
>prophage 49
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	558330	559518	4079669		Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_015715326.1|558330_559518_+	glycosyltransferase	NA	A0A0E3URP0	Lambdina_fiscellaria_nucleopolyhedrovirus	29.1	2.3e-09
>prophage 50
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	568867	570265	4079669		Pandoravirus(100.0%)	1	NA	NA
WP_038428436.1|568867_570265_+	6-phospho-beta-glucosidase GmuD	NA	A0A0B5JD41	Pandoravirus	29.1	6.5e-48
>prophage 51
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	582064	635138	4079669	tail,holin,portal,terminase,tRNA,integrase,protease,capsid,head	uncultured_Caudovirales_phage(34.09%)	78	592453:592472	635342:635361
WP_015382920.1|582064_582541_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003234078.1|582521_583211_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003243019.1|583220_583676_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_038428442.1|583668_584709_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.6	4.4e-65
WP_015482882.1|584939_586868_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-56
WP_003243499.1|586993_587506_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003234073.1|587502_588150_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003234072.1|588171_588345_+	sec-independent protein translocase protein TatAY	NA	NA	NA	NA	NA
WP_072174264.1|588351_589116_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	1.5e-22
WP_003225680.1|589347_589539_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003234069.1|589535_590270_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003155970.1|590508_590793_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_021481338.1|590839_592471_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	2.8e-159
592453:592472	attL	TATGGGTGGTATGATGTAAT	NA	NA	NA	NA
WP_038428444.1|592560_593760_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	46.3	7.0e-83
WP_038428445.1|593776_594283_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	68.7	1.4e-61
WP_038429990.1|594355_595309_-	DUF4429 domain-containing protein	NA	A0A1S5S992	Streptococcus_phage	40.0	2.2e-15
WP_038428446.1|595577_595949_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	48.7	1.3e-16
WP_038428447.1|596111_596339_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017697379.1|596351_596666_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	44.2	2.7e-10
WP_015715350.1|596662_597388_+	phage regulatory protein	NA	A0A2H4J4N4	uncultured_Caudovirales_phage	62.9	1.9e-83
WP_015715351.1|597444_598014_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	51.6	7.7e-56
WP_015715352.1|598010_598268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428448.1|598397_598595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024713915.1|598696_599047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428449.1|599046_599238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428450.1|599234_600152_+	hypothetical protein	NA	A0A0A7RUE9	Clostridium_phage	62.5	8.0e-87
WP_082200923.1|600171_600909_+	hypothetical protein	NA	A0A0A7RUC1	Clostridium_phage	48.1	6.7e-60
WP_038428451.1|601097_601811_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	50.0	6.3e-07
WP_038428452.1|601731_602547_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.5	2.3e-61
WP_038428454.1|602828_603185_+	hypothetical protein	NA	A0A1B1P7V7	Bacillus_phage	40.3	1.3e-13
WP_038428455.1|603171_603630_+	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	80.7	1.3e-58
WP_080031113.1|604057_604498_+	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	34.8	2.2e-10
WP_017697395.1|604572_604779_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	78.9	8.4e-21
WP_038428456.1|605388_605637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428457.1|605761_605980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428458.1|605976_606534_+	dUTPase	NA	R9TQ23	Paenibacillus_phage	51.5	3.1e-41
WP_082200924.1|606533_607013_+	hypothetical protein	NA	F8WQ59	Bacillus_phage	51.6	2.3e-21
WP_038428459.1|607009_607393_+	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	38.8	5.8e-15
WP_038428461.1|607574_607787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428463.1|607911_608094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154231160.1|608280_608436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033884289.1|608910_609042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428465.1|609057_609243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428466.1|609263_609725_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.7	2.4e-23
WP_038428467.1|609851_610196_+	hypothetical protein	NA	Q38578	Bacillus_phage	60.0	1.1e-09
WP_038428468.1|610195_610378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428469.1|610552_611260_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	56.7	1.6e-66
WP_038428470.1|611259_612534_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	64.1	8.9e-161
WP_038428471.1|612530_613934_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	60.0	3.0e-154
WP_038428472.1|613920_614844_+|head	head protein	head	A0A1Q1PVS0	Bacillus_phage	46.5	5.2e-70
WP_154231161.1|614840_615113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428473.1|615127_615367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428475.1|615464_616046_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	54.7	3.6e-53
WP_038428476.1|616060_616978_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	67.6	2.6e-114
WP_038428477.1|616982_617318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428478.1|617319_617571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428479.1|617579_617879_+	protein Gp15 of bacteriophage Spp1	NA	NA	NA	NA	NA
WP_033884271.1|617875_618220_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_038428480.1|618206_618623_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	52.2	1.1e-32
WP_038428481.1|618641_619040_+	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	45.4	3.8e-25
WP_038428482.1|619053_619566_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_063124207.1|619507_619822_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	74.1	6.0e-26
WP_080333463.1|619841_620081_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_038428483.1|620135_620648_+	phage protein	NA	NA	NA	NA	NA
WP_038429999.1|620695_621004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428484.1|621008_625724_+	membrane protein	NA	A0A1W6JQL3	Staphylococcus_phage	28.9	1.2e-32
WP_038428485.1|625720_626485_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_038428486.1|626497_629881_+	phage SPP1 structural protein	NA	Q5YA57	Bacillus_phage	45.8	3.2e-133
WP_038428488.1|629895_630282_+	hypothetical protein	NA	O48465	Bacillus_phage	54.8	8.4e-30
WP_154231162.1|630421_630589_+	XkdX family protein	NA	NA	NA	NA	NA
WP_038428489.1|630602_630830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080348108.1|630902_631172_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	71.9	1.0e-26
WP_038428491.1|631187_631451_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	3.2e-25
WP_038428493.1|631503_632325_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.9	1.5e-65
WP_038428494.1|632974_633205_+	DNA-binding protein	NA	A0A2H4JDR0	uncultured_Caudovirales_phage	48.7	9.4e-13
WP_038428495.1|633463_634165_+	hypothetical protein	NA	Q0H269	Geobacillus_phage	52.3	1.2e-61
WP_038428497.1|634170_634920_+	DUF4065 domain-containing protein	NA	Q0H268	Geobacillus_phage	64.5	1.8e-92
WP_038428499.1|634949_635138_-	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	60.0	4.1e-14
635342:635361	attR	TATGGGTGGTATGATGTAAT	NA	NA	NA	NA
>prophage 52
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	653903	654725	4079669		Mycobacterium_phage(100.0%)	1	NA	NA
WP_038428511.1|653903_654725_-	alpha/beta hydrolase	NA	H9NCP0	Mycobacterium_phage	30.6	2.4e-10
>prophage 53
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	665104	682497	4079669		Synechococcus_phage(30.0%)	17	NA	NA
WP_024571783.1|665104_666646_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	1.7e-20
WP_038428518.1|667026_668349_+	hypoxanthine/guanine permease PbuG	NA	A0A0R6PHV4	Moraxella_phage	29.9	2.6e-38
WP_014479057.1|668559_669363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003244066.1|669521_669689_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_015482896.1|669902_670457_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003219403.1|670456_670654_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_003244134.1|670976_671465_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	8.7e-24
WP_038428520.1|671457_672600_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_014476028.1|672596_673892_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.4	1.7e-18
WP_038428521.1|673965_674691_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	4.1e-46
WP_003219409.1|674683_674938_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_038428522.1|674934_675618_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_038428523.1|675601_677830_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.9	6.5e-159
WP_003233947.1|677805_679236_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003233945.1|679337_680378_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_015252651.1|680374_680962_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
WP_038428524.1|680958_682497_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	6.7e-78
>prophage 54
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	691736	699100	4079669		Bacillus_phage(33.33%)	5	NA	NA
WP_038428532.1|691736_693956_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.9	3.2e-134
WP_015252641.1|693979_695986_+	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.1	2.7e-127
WP_003242795.1|696001_697192_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_082200925.1|697353_698364_+	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_010886431.1|698401_699100_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.7e-18
>prophage 55
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	705323	724988	4079669		Liberibacter_phage(28.57%)	12	NA	NA
WP_038428537.1|705323_708482_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	5.0e-64
WP_003233894.1|708805_709717_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
WP_038428538.1|709972_711352_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.4	7.7e-110
WP_038428539.1|712340_714353_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.5	5.0e-25
WP_051047173.1|714349_715696_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_038428541.1|715711_718702_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.5	1.9e-20
WP_038428542.1|718792_719431_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_052124595.1|719551_719968_-	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_038428543.1|719981_720467_-	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_038428544.1|720471_722481_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	56.8	2.4e-144
WP_038428546.1|722692_723715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428548.1|723857_724988_+	response regulator aspartate phosphatase RapH	NA	A0A1P8CWN8	Bacillus_phage	46.2	3.4e-87
>prophage 56
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	731609	733343	4079669		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038427503.1|731609_733343_+	two-component system sensor histidine kinase YesM	NA	Q9EYF3	Enterobacteria_phage	27.9	6.9e-23
>prophage 57
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	764890	772418	4079669		Mycobacterium_phage(33.33%)	4	NA	NA
WP_038428584.1|764890_768076_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.7	1.7e-80
WP_003243930.1|768522_770442_+	Lipoteichoic acid synthase 1	NA	W6LM83	Streptococcus_phage	43.5	1.0e-128
WP_014479136.1|770678_771443_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003244102.1|771449_772418_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-30
>prophage 58
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	780773	791944	4079669		uncultured_Caudovirales_phage(20.0%)	10	NA	NA
WP_003233767.1|780773_781634_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.0	2.2e-09
WP_038428586.1|781767_783657_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	31.9	6.1e-41
WP_038428587.1|783779_784226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479143.1|784350_784773_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003233759.1|784838_786029_+	MFS transporter	NA	NA	NA	NA	NA
WP_038428590.1|786593_788150_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.5e-56
WP_038428592.1|788322_789453_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.6	4.0e-40
WP_038428593.1|789520_789967_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033883243.1|790019_791039_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003233737.1|791143_791944_-	Fe(3+)-citrate ABC transporter ATP-binding protein YfmF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.4e-16
>prophage 59
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	807023	807161	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_003239885.1|807023_807161_-	YflJ family protein	NA	G3MBD1	Bacillus_virus	58.1	1.1e-05
>prophage 60
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	810287	812237	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_003233694.1|810287_812237_-	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	43.2	2.2e-134
>prophage 61
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	841572	842973	4079669		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_015252551.1|841572_842973_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	39.6	2.2e-88
>prophage 62
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	853382	853712	4079669		uncultured_virus(100.0%)	1	NA	NA
WP_010886445.1|853382_853712_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	41.5	1.6e-13
>prophage 63
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	860882	864412	4079669		Bacillus_phage(100.0%)	2	NA	NA
WP_038428633.1|860882_862604_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	7.0e-52
WP_038428634.1|862597_864412_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	2.2e-56
>prophage 64
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	867966	868902	4079669		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_024572985.1|867966_868902_+	linearmycin resistance ATP-binding protein LnrL	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.2	8.3e-31
>prophage 65
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	891877	893959	4079669		Mycobacterium_phage(50.0%)	2	NA	NA
WP_014479220.1|891877_892738_+	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	27.4	5.0e-06
WP_003244113.1|892969_893959_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	42.4	1.5e-59
>prophage 66
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	901500	903243	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_038428652.1|901500_903243_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	2.6e-46
>prophage 67
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	919853	924309	4079669		Pandoravirus(33.33%)	4	NA	NA
WP_038428654.1|919853_921209_-	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	39.5	2.7e-43
WP_003245192.1|921459_921657_+	transcriptional regulator SenS	NA	NA	NA	NA	NA
WP_014476225.1|921683_923135_-	catalase	NA	A0A2K9L0T1	Tupanvirus	41.3	9.0e-109
WP_021479704.1|923541_924309_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	4.2e-33
>prophage 68
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	935303	938557	4079669		Thermus_phage(50.0%)	2	NA	NA
WP_003239626.1|935303_937199_+	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.5	1.4e-101
WP_003233432.1|937378_938557_+	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	45.3	6.5e-25
>prophage 69
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	943751	948961	4079669		Staphylococcus_phage(50.0%)	6	NA	NA
WP_015252494.1|943751_944450_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.0e-22
WP_032721217.1|944466_945384_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	1.2e-39
WP_003233421.1|945376_946318_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003224086.1|946409_946613_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.5	1.2e-16
WP_003245726.1|947048_947879_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015252491.1|947881_948961_-	diguanylate cyclase DgcK	NA	A0A127AWB9	Bacillus_phage	37.0	1.3e-19
>prophage 70
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	957762	960526	4079669		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_003233404.1|957762_958671_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.8	8.1e-07
WP_003233401.1|958781_959177_+	YhcU family protein	NA	NA	NA	NA	NA
WP_003245462.1|959314_959737_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	35.0	4.6e-13
WP_032730435.1|959863_960526_+	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	26.1	7.7e-07
>prophage 71
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	964637	965462	4079669		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003233386.1|964637_965462_+	glycerol uptake facilitator protein GlpF	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.1e-31
>prophage 72
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	968908	970654	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_038428672.1|968908_970654_+	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	49.5	5.5e-161
>prophage 73
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	973929	975396	4079669		Clostridioides_phage(100.0%)	1	NA	NA
WP_038428676.1|973929_975396_-	peptidoglycan endopeptidase LytF	NA	A0A1V0DZX6	Clostridioides_phage	41.7	3.8e-14
>prophage 74
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	981136	985239	4079669		Bacillus_virus(50.0%)	4	NA	NA
WP_021479670.1|981136_982141_+	peptidoglycan endopeptidase LytE	NA	M1HNA7	Bacillus_virus	43.8	3.4e-14
WP_038428683.1|982211_983087_-	transcriptional regulator CitR	NA	NA	NA	NA	NA
WP_024573277.1|983195_984296_+	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_003244867.1|984369_985239_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.1	5.6e-58
>prophage 75
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	999703	1003234	4079669		Staphylococcus_phage(33.33%)	5	NA	NA
WP_038428691.1|999703_1000099_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	8.9e-11
WP_014479309.1|1000085_1000817_-	hypothetical protein	NA	A0A0S2MYI4	Enterococcus_phage	29.5	5.9e-16
WP_009966908.1|1001050_1001158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015383218.1|1001305_1002421_+	small-conductance mechanosensitive channel protein MscY	NA	NA	NA	NA	NA
WP_038428692.1|1002490_1003234_+	sirtuin NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	31.2	1.8e-20
>prophage 76
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1007714	1012632	4079669		Bacillus_phage(66.67%)	5	NA	NA
WP_038428697.1|1007714_1009472_+	multidrug ABC transporter ATP-binding protein BmrC	NA	W8CYL7	Bacillus_phage	29.9	1.5e-54
WP_038428698.1|1009468_1011490_+	multidrug resistance ABC transporter ATP-binding protein/permease BmrD	NA	A0A076FI99	Aureococcus_anophage	25.8	1.4e-30
WP_038428699.1|1011539_1012160_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_082200935.1|1012228_1012324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003233287.1|1012428_1012632_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	76.6	4.5e-19
>prophage 77
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1017141	1017495	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_003224239.1|1017141_1017495_+	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	27.9	4.5e-06
>prophage 78
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1024987	1025884	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032725309.1|1024987_1025884_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	2.2e-25
>prophage 79
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1037682	1040577	4079669		Streptococcus_phage(50.0%)	3	NA	NA
WP_038428710.1|1037682_1038762_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.7	1.1e-82
WP_003233231.1|1038908_1039346_-	HIT family protein	NA	NA	NA	NA	NA
WP_038428711.1|1039833_1040577_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.6e-24
>prophage 80
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1063377	1067966	4079669		Staphylococcus_phage(50.0%)	4	NA	NA
WP_038428737.1|1063377_1064919_+	long-chain-fatty-acid--CoA ligase LcfB	NA	A0A2H4PQM9	Staphylococcus_phage	28.2	7.4e-45
WP_003245187.1|1064957_1065353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038428738.1|1065501_1066782_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_015715621.1|1066820_1067966_-	subtilisin AprE	NA	A0A217EQY2	Bacillus_phage	46.3	8.2e-49
>prophage 81
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1072876	1081031	4079669		Trichoplusia_ni_ascovirus(50.0%)	8	NA	NA
WP_038428743.1|1072876_1074316_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.2e-23
WP_052124598.1|1074322_1074883_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003245216.1|1075017_1076316_-	heme-based aerotactic transducer HemAT	NA	A0A2H4J162	uncultured_Caudovirales_phage	66.7	2.6e-06
WP_038428744.1|1076454_1077984_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003245662.1|1078095_1078953_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.6	3.5e-52
WP_003233142.1|1078980_1079214_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_029317573.1|1079506_1080085_+	competence transcription factor ComK	NA	NA	NA	NA	NA
WP_003245421.1|1080131_1081031_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	51.6	3.0e-70
>prophage 82
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1090673	1091999	4079669		Tupanvirus(100.0%)	1	NA	NA
WP_038428749.1|1090673_1091999_-	3-dehydro-glucose-6-phosphate--glutamate transaminase	NA	A0A2K9L0G1	Tupanvirus	27.8	3.3e-25
>prophage 83
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1102194	1110529	4079669		Clostridium_botulinum_C_phage(50.0%)	3	NA	NA
WP_038428757.1|1102194_1105893_+	helicase-exonuclease AddAB subunit AddA	NA	Q331U3	Clostridium_botulinum_C_phage	23.6	4.6e-16
WP_038428758.1|1105964_1107140_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_038428760.1|1107136_1110529_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.1	1.5e-10
>prophage 84
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1116175	1121462	4079669	protease	Bacillus_phage(50.0%)	3	NA	NA
WP_038428763.1|1116175_1118860_+|protease	cell wall-associated protease WprA	protease	A0A217EQY2	Bacillus_phage	37.0	8.2e-31
WP_082201000.1|1118890_1119472_-	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_033883622.1|1119617_1121462_+	asparagine synthase (glutamine-hydrolyzing)	NA	E3T4J5	Cafeteria_roenbergensis_virus	24.6	5.4e-34
>prophage 85
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1131415	1134015	4079669		Mycobacterium_phage(33.33%)	3	NA	NA
WP_038428767.1|1131415_1132222_+	alpha/beta hydrolase	NA	A0A0A1ELD0	Mycobacterium_phage	26.9	2.5e-12
WP_038428768.1|1132249_1132849_-	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	40.2	3.0e-10
WP_038428769.1|1132845_1134015_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	32.4	1.1e-48
>prophage 86
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1150073	1150925	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038428774.1|1150073_1150925_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.1	6.0e-12
>prophage 87
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1155001	1156663	4079669		Bacteriophage(50.0%)	2	NA	NA
WP_003232996.1|1155001_1155172_+	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	60.0	9.4e-10
WP_038428776.1|1155232_1156663_+	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	29.6	1.9e-50
>prophage 88
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1160472	1162762	4079669		Klosneuvirus(50.0%)	2	NA	NA
WP_038428779.1|1160472_1161630_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	9.6e-29
WP_038428780.1|1161700_1162762_+	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	40.1	2.1e-62
>prophage 89
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1165834	1166794	4079669		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_038428782.1|1165834_1166794_+	ornithine carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	28.3	6.1e-21
>prophage 90
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1170190	1221985	4079669	tRNA,coat	Bacillus_phage(30.0%)	60	NA	NA
WP_003232972.1|1170190_1170430_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1170594_1171533_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1171555_1172797_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_038428784.1|1172872_1173658_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|1173849_1174836_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_014476428.1|1174832_1175822_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	8.8e-07
WP_029317612.1|1175909_1177541_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_014476430.1|1177615_1178566_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_038428785.1|1178582_1179494_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|1179699_1180452_+	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_038430004.1|1180486_1181479_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015252360.1|1182222_1183860_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|1183967_1184903_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_015252359.1|1184906_1185824_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_072173823.1|1185828_1186905_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1186906_1187824_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_010886478.1|1187930_1189148_+	MFS transporter	NA	NA	NA	NA	NA
WP_003224597.1|1189312_1189891_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014476435.1|1190071_1190467_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|1190509_1191166_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_119122854.1|1191335_1191476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232942.1|1191442_1192099_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_021479547.1|1192093_1192216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038428787.1|1192259_1193411_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_038428788.1|1193457_1195470_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1195507_1195675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024573348.1|1195988_1196888_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1196884_1197283_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072692654.1|1197537_1198083_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	60.4	3.7e-39
WP_014479452.1|1198286_1198859_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_038428791.1|1198983_1199352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1199380_1200016_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1200034_1200835_+	NAD kinase	NA	NA	NA	NA	NA
WP_082201001.1|1200897_1201749_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_024573345.1|1201761_1202496_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	23.3	2.5e-06
WP_029317615.1|1202730_1204575_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003232909.1|1204823_1205534_+	thiaminase II	NA	NA	NA	NA	NA
WP_038428793.1|1205508_1206126_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_038428794.1|1206109_1207219_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072173897.1|1207218_1207419_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_010886483.1|1207415_1208186_+	thiazole synthase	NA	NA	NA	NA	NA
WP_038428795.1|1208182_1209193_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_003232898.1|1209211_1210027_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1210162_1210939_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_080265338.1|1211039_1211723_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_003244982.1|1211815_1212262_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|1212389_1212878_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_003244668.1|1213029_1213548_-|coat	spore coat protein CotX	coat	NA	NA	NA	NA
WP_024572403.1|1213648_1213963_-|coat	spore coat protein CotW	coat	NA	NA	NA	NA
WP_003244871.1|1214004_1214391_-|coat	spore coat protein CotV	coat	NA	NA	NA	NA
WP_003232879.1|1214550_1214907_+	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_017695696.1|1215186_1215393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232872.1|1215474_1215624_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_003232870.1|1215756_1216011_+	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_038428796.1|1216084_1218364_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.9	3.5e-91
WP_003232866.1|1218480_1218735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014479473.1|1218807_1219230_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232861.1|1219233_1219749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029317626.1|1219785_1220508_-	esterase family protein	NA	NA	NA	NA	NA
WP_032725759.1|1220863_1221985_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
>prophage 91
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1226333	1231345	4079669		Bacillus_phage(100.0%)	4	NA	NA
WP_038428799.1|1226333_1228196_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	53.8	7.7e-121
WP_038428800.1|1228467_1229127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029317635.1|1229324_1229705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428802.1|1230181_1231345_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	29.3	7.6e-42
>prophage 92
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1255845	1259789	4079669		Leucania_separata_nucleopolyhedrovirus(33.33%)	5	NA	NA
WP_038428814.1|1255845_1257024_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.0	3.3e-08
WP_003232781.1|1257064_1257253_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
WP_015715713.1|1257426_1258239_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003232776.1|1258284_1259037_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_015715714.1|1259036_1259789_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.1e-17
>prophage 93
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1269852	1270689	4079669		Moumouvirus(100.0%)	1	NA	NA
WP_017697311.1|1269852_1270689_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
>prophage 94
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1277741	1311782	4079669	terminase,holin,portal,plate	Bacillus_phage(27.27%)	46	NA	NA
WP_038428822.1|1277741_1279013_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_010886491.1|1279157_1280294_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
WP_003245487.1|1280283_1280418_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_003232731.1|1280448_1280706_-	YciI family protein	NA	NA	NA	NA	NA
WP_003244876.1|1280826_1281780_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
WP_003245254.1|1281819_1282197_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
WP_003244789.1|1282302_1282905_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245071.1|1282981_1283818_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|1283861_1284458_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1284620_1284962_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1285139_1285319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245799.1|1285305_1286142_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_010886492.1|1286041_1286842_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245588.1|1286841_1287009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245290.1|1287093_1287444_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_109789043.1|1287447_1287642_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_003245797.1|1287762_1288272_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
WP_003244697.1|1288387_1289185_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_038428823.1|1289181_1290483_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.5	8.2e-154
WP_032725514.1|1290486_1291974_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003232691.1|1291993_1292821_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	59.2	1.6e-54
WP_003232690.1|1292846_1293782_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|1293803_1294187_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|1294183_1294540_+	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_038428824.1|1294536_1295022_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.4	6.2e-38
WP_003232680.1|1295034_1295475_+	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003232679.1|1295478_1295697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245369.1|1295693_1297094_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|1297095_1297539_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015715734.1|1297629_1298076_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.7	5.9e-11
WP_072566146.1|1298117_1298255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052124599.1|1298265_1302564_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	1.6e-41
WP_038428825.1|1302556_1303216_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	34.2	4.8e-25
WP_038428826.1|1303231_1304209_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_015252273.1|1304208_1304475_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	35.2	1.7e-05
WP_038428827.1|1304531_1304957_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	2.3e-12
WP_003232669.1|1304949_1305996_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_038428828.1|1305979_1306558_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.6	6.7e-15
WP_038428829.1|1306554_1306827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428830.1|1306829_1308893_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	38.4	5.7e-32
WP_038428831.1|1308904_1309234_+|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	40.7	2.9e-15
WP_014479563.1|1309230_1309395_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_003245597.1|1309438_1310278_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_003232655.1|1310330_1310600_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
WP_003232653.1|1310612_1310876_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_003245230.1|1310888_1311782_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
>prophage 95
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1319981	1322829	4079669	protease	Salmonella_phage(50.0%)	2	NA	NA
WP_015715747.1|1319981_1320953_+	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
WP_015252257.1|1321470_1322829_-|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.8e-25
>prophage 96
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1326684	1327692	4079669		Planktothrix_phage(100.0%)	1	NA	NA
WP_029727040.1|1326684_1327692_+	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	2.4e-15
>prophage 97
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1331484	1333377	4079669		Clostridium_phage(50.0%)	2	NA	NA
WP_038428840.1|1331484_1332375_+	gamma-D-glutamyl-L-lysine dipeptidyl-peptidase	NA	A0A0A8WIF2	Clostridium_phage	42.7	3.1e-19
WP_003232600.1|1332387_1333377_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
>prophage 98
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1342042	1357560	4079669	protease	Streptococcus_phage(33.33%)	15	NA	NA
WP_014479591.1|1342042_1343140_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.1	4.3e-71
WP_038428847.1|1343151_1344399_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	5.5e-99
WP_003232574.1|1344524_1344950_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_038428848.1|1344980_1345424_-	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_003232570.1|1345566_1345977_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_003245084.1|1346229_1346700_-	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.8	1.8e-26
WP_038428849.1|1346872_1349161_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_038428850.1|1349576_1350536_-|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	3.3e-75
WP_003232560.1|1350758_1351592_+	RsbT co-antagonist RsbRB	NA	NA	NA	NA	NA
WP_038428852.1|1351622_1352387_-	HMP/thiamine ABC transporter permease ThiX	NA	NA	NA	NA	NA
WP_038428853.1|1352361_1354005_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	2.6e-19
WP_003232554.1|1353991_1354591_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_038428854.1|1354592_1355195_-	HMP/thiamine ABC transporter substrate-binding protein ThiU	NA	NA	NA	NA	NA
WP_038428855.1|1355505_1356192_+	two-component system response regulator YkoG	NA	NA	NA	NA	NA
WP_038428857.1|1356195_1357560_+	two-component system sensor histidine kinase YkoH	NA	A0A1V0SGX0	Hokovirus	32.9	1.7e-16
>prophage 99
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1367031	1370845	4079669		Salmonella_phage(50.0%)	3	NA	NA
WP_015252230.1|1367031_1368045_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	41.3	5.4e-52
WP_038428862.1|1368070_1369906_-	DNA ligase D	NA	NA	NA	NA	NA
WP_003232529.1|1369909_1370845_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	38.4	2.2e-44
>prophage 100
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1374385	1377546	4079669		Bacillus_phage(100.0%)	4	NA	NA
WP_038428864.1|1374385_1375180_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	41.9	2.0e-30
WP_038428865.1|1375443_1376199_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_038428866.1|1376195_1377341_+	anti-sigma-I factor RsgI	NA	NA	NA	NA	NA
WP_003218568.1|1377351_1377546_-	alpha/beta-type small acid-soluble spore protein	NA	A0A217EQS5	Bacillus_phage	66.7	1.4e-14
>prophage 101
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1382763	1385474	4079669		Bacillus_phage(50.0%)	2	NA	NA
WP_029946305.1|1382763_1384980_+	sporulation two-component system sensor histidine kinase KinE	NA	W8CYF6	Bacillus_phage	29.4	1.5e-22
WP_038428870.1|1384976_1385474_+	methylated-DNA--protein-cysteine methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	50.5	5.9e-20
>prophage 102
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1399179	1407150	4079669	protease	Pneumococcus_phage(40.0%)	8	NA	NA
WP_038428877.1|1399179_1401279_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.9	1.1e-131
WP_003244712.1|1401597_1402641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021479407.1|1402953_1403613_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	58.0	5.6e-66
WP_003232462.1|1403605_1404055_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003232460.1|1404047_1404779_+	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.2	7.6e-56
WP_003218613.1|1404796_1405294_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.1	1.4e-56
WP_038428878.1|1405875_1406235_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038428879.1|1406403_1407150_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	7.8e-16
>prophage 103
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1412092	1422877	4079669		Bacillus_phage(25.0%)	9	NA	NA
WP_038428885.1|1412092_1412719_+	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	52.7	1.8e-26
WP_038428886.1|1412836_1414174_+	sporulation protein YkvU	NA	NA	NA	NA	NA
WP_014479641.1|1414224_1414722_+	sporulation thiol-disulfide oxidoreductase StoA	NA	NA	NA	NA	NA
WP_038428887.1|1414957_1416871_+	metal-transporting ATPase PfeT	NA	E4ZFI9	Streptococcus_phage	40.7	1.1e-117
WP_015715796.1|1416909_1417113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038428888.1|1417278_1418373_+	di/tri-peptidase	NA	NA	NA	NA	NA
WP_033884224.1|1418654_1419620_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.5	7.5e-19
WP_003218635.1|1419682_1420549_+	ptsGHI operon transcription antiterminator GlcT	NA	NA	NA	NA	NA
WP_003244661.1|1420777_1422877_+	PTS glucose transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	50.0	2.0e-08
>prophage 104
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1427217	1438125	4079669		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_038428890.1|1427217_1429185_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.1	9.0e-11
WP_038428891.1|1429333_1430200_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003244693.1|1430238_1431012_-	hypothetical protein	NA	U5Q0C0	Bacillus_phage	65.6	1.1e-41
WP_038428892.1|1431348_1433472_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_015252197.1|1433635_1435456_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	1.1e-07
WP_038428893.1|1435465_1436647_-	aminotransferase A	NA	NA	NA	NA	NA
WP_003245246.1|1436848_1437010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014476655.1|1437213_1438125_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	8.0e-47
>prophage 105
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1441680	1442445	4079669		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003232398.1|1441680_1442445_+	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.0	1.0e-39
>prophage 106
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1447299	1449130	4079669		Bacillus_phage(100.0%)	3	NA	NA
WP_038428896.1|1447299_1447776_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	34.9	2.7e-14
WP_038428897.1|1447765_1448659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428898.1|1448674_1449130_+	flavodoxin	NA	A7KUZ7	Bacillus_phage	37.3	8.4e-13
>prophage 107
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1453135	1453582	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_038428900.1|1453135_1453582_+	thiol-disulfide oxidoreductase YkuV	NA	A0A127AW88	Bacillus_phage	47.9	7.7e-35
>prophage 108
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1460149	1466369	4079669		Bacillus_phage(66.67%)	5	NA	NA
WP_038428906.1|1460149_1461907_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.7	4.8e-64
WP_015715813.1|1461918_1463733_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.9	1.6e-54
WP_015715814.1|1463842_1464538_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_015715815.1|1464542_1465676_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_029725930.1|1465676_1466369_+	ABC transporter ATP-binding protein YknY	NA	G9BWD6	Planktothrix_phage	39.9	1.7e-36
>prophage 109
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1472636	1474259	4079669		Tupanvirus(100.0%)	1	NA	NA
WP_029725931.1|1472636_1474259_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.0	7.6e-48
>prophage 110
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1478127	1479882	4079669		Paenibacillus_phage(50.0%)	2	NA	NA
WP_003244728.1|1478127_1478406_+	transcriptional regulator AbhA	NA	A0A2I7SC16	Paenibacillus_phage	47.3	7.4e-12
WP_003232333.1|1478595_1479882_+	two-component sensor histidine kinase KinC	NA	W8CYF6	Bacillus_phage	29.7	4.8e-21
>prophage 111
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1485643	1487007	4079669		Lactococcus_phage(50.0%)	2	NA	NA
WP_015715823.1|1485643_1486417_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	22.2	5.8e-06
WP_029726528.1|1486452_1487007_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.8	3.2e-14
>prophage 112
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1492126	1493539	4079669		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003232309.1|1492126_1493539_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	7.5e-44
>prophage 113
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1506377	1511050	4079669		Streptococcus_phage(50.0%)	5	NA	NA
WP_003232278.1|1506377_1508216_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
WP_038428911.1|1508272_1508590_+	membrane protein	NA	NA	NA	NA	NA
WP_003232271.1|1508645_1508855_-	YlaI family protein	NA	NA	NA	NA	NA
WP_038428912.1|1508937_1509567_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_003245272.1|1509721_1511050_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	34.3	3.1e-55
>prophage 114
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1526640	1530825	4079669		Bacillus_phage(50.0%)	7	NA	NA
WP_003245434.1|1526640_1527681_+	CAP domain-containing protein	NA	U5Q1E2	Bacillus_phage	39.5	9.9e-17
WP_003232233.1|1527912_1528311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232231.1|1528326_1528566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003221370.1|1528681_1529131_+	competence/sporulation regulator complex protein RicF	NA	NA	NA	NA	NA
WP_015715839.1|1529185_1529458_+	YlbG family protein	NA	NA	NA	NA	NA
WP_015252150.1|1529780_1530335_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003245283.1|1530339_1530825_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.5	3.2e-26
>prophage 115
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1559542	1567613	4079669		Bacillus_phage(75.0%)	5	NA	NA
WP_038428922.1|1559542_1563844_+	bacillopeptidase F	NA	A0A217EQY2	Bacillus_phage	32.1	3.5e-23
WP_038430007.1|1564037_1564967_+	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_003221446.1|1565029_1565749_+	RNA polymerase sporulation sigma factor SigE	NA	A0A0A0RV91	Bacillus_phage	28.3	8.1e-18
WP_009967190.1|1565888_1566671_+	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.9	2.0e-46
WP_038428923.1|1566818_1567613_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.6e-11
>prophage 116
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1573615	1584006	4079669	tRNA	Moumouvirus(25.0%)	9	NA	NA
WP_038428926.1|1573615_1576381_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	26.1	6.1e-82
WP_014476755.1|1576525_1576900_+	sporulation-related RNA polymerase-binding protein YlyA	NA	NA	NA	NA	NA
WP_003245047.1|1577002_1577467_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_038428927.1|1577468_1578380_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003232127.1|1578560_1579106_+	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_038428928.1|1579278_1580586_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.7	5.3e-60
WP_038428929.1|1580730_1581645_+	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	36.0	9.9e-37
WP_038428930.1|1581628_1582915_+	dihydroorotase	NA	NA	NA	NA	NA
WP_003232115.1|1582911_1584006_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.2	1.5e-60
>prophage 117
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1589574	1594217	4079669		Pandoravirus(33.33%)	5	NA	NA
WP_082200943.1|1589574_1590225_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	37.9	1.4e-32
WP_003238646.1|1590636_1591338_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_029317784.1|1591349_1592414_+	sulfate permease	NA	NA	NA	NA	NA
WP_038428937.1|1592462_1593611_+	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	29.5	7.8e-39
WP_015252120.1|1593623_1594217_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	41.9	2.5e-09
>prophage 118
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1598219	1608209	4079669	tRNA	Acanthocystis_turfacea_Chlorella_virus(20.0%)	9	NA	NA
WP_015252116.1|1598219_1600892_+	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.5	2.3e-86
WP_009967215.1|1600974_1601850_+	YicC family protein	NA	NA	NA	NA	NA
WP_003154355.1|1601926_1602196_+	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_003232083.1|1602203_1602818_+	guanylate kinase	NA	S4W1R9	Pandoravirus	33.7	1.1e-12
WP_003221520.1|1602821_1603025_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_015252114.1|1603107_1604328_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	2.4e-46
WP_003232079.1|1604324_1606742_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_038428941.1|1606768_1607251_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.7	1.2e-17
WP_038428942.1|1607255_1608209_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.4	1.8e-09
>prophage 119
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1611398	1613345	4079669		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015252109.1|1611398_1613345_+	serine/threonine protein kinase PrkC	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.1	8.3e-25
>prophage 120
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1624769	1626716	4079669		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_014476789.1|1624769_1625510_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	3.0e-20
WP_003154310.1|1625593_1625827_+	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_003232030.1|1625966_1626716_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.9	4.2e-25
>prophage 121
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1637707	1638475	4079669		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_038428946.1|1637707_1638475_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.6	2.9e-26
>prophage 122
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1642836	1650336	4079669	tRNA,protease	Thermus_phage(25.0%)	6	NA	NA
WP_038428949.1|1642836_1643730_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.1	1.3e-28
WP_038428950.1|1643917_1645993_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.1	3.3e-104
WP_038428951.1|1646068_1647376_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003231988.1|1647443_1648358_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.8	5.2e-30
WP_003238555.1|1648370_1648916_+|protease	ATP-dependent protease subunit ClpQ	protease	NA	NA	NA	NA
WP_038428952.1|1648932_1650336_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.2	1.8e-42
>prophage 123
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1676749	1677514	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_003220911.1|1676749_1677514_+	RNA polymerase sigma-28 factor SigD	NA	A0A0A0PIT2	Bacillus_phage	26.0	1.8e-07
>prophage 124
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1681470	1682253	4079669		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003231925.1|1681470_1682253_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	3.7e-24
>prophage 125
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1687389	1699042	4079669	tRNA	Clostridium_phage(33.33%)	10	NA	NA
WP_038428967.1|1687389_1691703_+	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	33.2	2.7e-23
WP_003231915.1|1692032_1692503_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003231912.1|1692537_1693653_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_009967250.1|1693666_1693942_+	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003220946.1|1693943_1694246_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_014479801.1|1694265_1696416_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.2	3.8e-23
WP_003220950.1|1696412_1696691_+	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_009967251.1|1696707_1697061_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_015252083.1|1697143_1698073_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_015252082.1|1698091_1699042_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	28.5	2.6e-08
>prophage 126
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1702873	1704103	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_038428970.1|1702873_1704103_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	32.4	5.2e-49
>prophage 127
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1712534	1720643	4079669		Mycobacterium_phage(25.0%)	6	NA	NA
WP_038428974.1|1712534_1714898_+	DNA translocase SpoIIIE	NA	A0A218M9A2	Mycobacterium_phage	47.1	1.4e-87
WP_003245732.1|1715041_1715767_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031600514.1|1715905_1717117_+	bacillibactin exporter BcbE	NA	NA	NA	NA	NA
WP_038428976.1|1717296_1718577_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.1	6.4e-50
WP_003244823.1|1718573_1719860_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	27.9	6.1e-08
WP_038428977.1|1719914_1720643_+	EF-P-5 aminopentanone reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	9.3e-14
>prophage 128
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1724906	1732957	4079669		Bacillus_phage(40.0%)	7	NA	NA
WP_003245789.1|1724906_1725953_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	73.7	1.9e-137
WP_038428981.1|1726120_1727296_+	serine hydrolase	NA	A0A0B5A438	Mycobacterium_phage	24.8	1.9e-08
WP_003221010.1|1727571_1729134_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_003245138.1|1729202_1729997_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_003154135.1|1730196_1730457_+	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_038428982.1|1730722_1731766_+	L-threonine 3-dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.9	3.0e-21
WP_014664025.1|1731778_1732957_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	2.2e-49
>prophage 129
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1736006	1740482	4079669		Catovirus(50.0%)	2	NA	NA
WP_003231832.1|1736006_1738583_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
WP_038428984.1|1738598_1740482_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.2	3.4e-68
>prophage 130
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1753041	1824402	4079669	protease	Paenibacillus_phage(71.43%)	11	NA	NA
WP_038428996.1|1753041_1768173_+	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	60.1	5.3e-127
WP_082200947.1|1768156_1781773_+	polyketide synthase PksL	NA	D0R7J2	Paenibacillus_phage	29.0	6.8e-33
WP_038428999.1|1781788_1794583_+	polyketide synthase PksM	NA	D0R7J2	Paenibacillus_phage	31.9	1.1e-37
WP_082201007.1|1794650_1811117_+	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	54.9	5.2e-120
WP_038429001.1|1811131_1818766_+	methyltransferase	NA	D0R7J2	Paenibacillus_phage	29.2	9.7e-37
WP_029726465.1|1818810_1820028_-	cytochrome P450	NA	NA	NA	NA	NA
WP_029726464.1|1820258_1820615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726463.1|1820693_1821518_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029726462.1|1821628_1822957_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.2	1.6e-27
WP_014476869.1|1823181_1823415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429002.1|1823694_1824402_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	2.4e-51
>prophage 131
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1828862	1835434	4079669		Bacillus_phage(50.0%)	6	NA	NA
WP_003231758.1|1828862_1829255_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1829214_1831317_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1831334_1832324_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1832373_1832994_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_038429004.1|1833057_1833825_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	9.1e-52
WP_003231746.1|1834465_1835434_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
>prophage 132
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1854533	1857490	4079669		Bacillus_phage(100.0%)	5	NA	NA
WP_038429012.1|1854533_1854764_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	83.8	2.4e-24
WP_038429013.1|1854760_1855399_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_003231681.1|1855667_1855832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429014.1|1855961_1856432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726898.1|1856959_1857490_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	82.9	2.5e-77
>prophage 133
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1866523	1867159	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_015252020.1|1866523_1867159_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	1.7e-72
>prophage 134
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1871226	1874246	4079669	coat	Bacillus_phage(100.0%)	4	NA	NA
WP_003245820.1|1871226_1871661_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	2.0e-72
WP_038429022.1|1872302_1872566_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
WP_003231643.1|1872967_1873132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429023.1|1873406_1874246_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	96.8	9.0e-162
>prophage 135
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1888077	1891108	4079669		Bacillus_phage(66.67%)	4	NA	NA
WP_015714006.1|1888077_1888836_+	gamma-polyglutamate hydrolase PghL	NA	O64134	Bacillus_phage	52.1	5.1e-55
WP_003231606.1|1888862_1889402_-	YndM family protein	NA	NA	NA	NA	NA
WP_038429037.1|1889519_1889954_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	65.5	1.5e-40
WP_003238209.1|1890490_1891108_-	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
>prophage 136
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1906329	1910721	4079669		Bacillus_virus(50.0%)	2	NA	NA
WP_038429042.1|1906329_1908297_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.3	3.0e-123
WP_038429043.1|1908300_1910721_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.5	2.8e-99
>prophage 137
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1919559	1920453	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_038429048.1|1919559_1920453_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.9	3.1e-83
>prophage 138
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1927382	1929032	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038429053.1|1927382_1929032_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	29.2	6.5e-31
>prophage 139
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1932993	1970741	4079669		Tupanvirus(100.0%)	5	NA	NA
WP_082200953.1|1932993_1936833_-	non-ribosomal plipastatin synthetase PpsE	NA	A0A2K9KZV5	Tupanvirus	26.6	1.1e-86
WP_052124602.1|1936840_1947640_-	non-ribosomal plipastatin synthetase PpsD	NA	A0A2K9KZV5	Tupanvirus	27.3	1.7e-164
WP_038429062.1|1947664_1955332_-	non-ribosomal plipastatin synthetase PpsC	NA	A0A2K9KZV5	Tupanvirus	26.7	1.1e-165
WP_038429063.1|1955348_1963031_-	non-ribosomal plipastatin synthetase PpsB	NA	A0A2K9L3I8	Tupanvirus	26.6	8.0e-148
WP_038429065.1|1963055_1970741_-	non-ribosomal plipastatin synthetase PpsA	NA	A0A2K9KZV5	Tupanvirus	25.7	3.3e-85
>prophage 140
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1976181	1980243	4079669	integrase	Bacillus_phage(50.0%)	4	1956501:1956514	1977052:1977065
1956501:1956514	attL	ATCCTTTACATCAA	NA	NA	NA	NA
WP_003231473.1|1976181_1976727_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	51.4	3.6e-42
WP_038429068.1|1977042_1977273_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
1977052:1977065	attR	ATCCTTTACATCAA	NA	NA	NA	NA
WP_038429070.1|1977457_1979221_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_029727235.1|1979385_1980243_-	LysR family transcriptional regulator YofA	NA	Q6JIH3	Burkholderia_virus	35.8	9.0e-08
>prophage 141
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1988578	1992058	4079669		Streptococcus_phage(50.0%)	4	NA	NA
WP_015714042.1|1988578_1989694_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.5	5.3e-69
WP_010886524.1|1989690_1990584_-	Pyrroline-5-carboxylate reductase 1	NA	A0A1X9I6T5	Streptococcus_phage	32.7	1.0e-30
WP_003220337.1|1990731_1991100_-	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.8	9.2e-18
WP_038429073.1|1991341_1992058_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.2	3.7e-47
>prophage 142
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	1996834	1997869	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_038429078.1|1996834_1997869_-	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	30.1	2.0e-25
>prophage 143
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2002220	2003906	4079669		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038429081.1|2002220_2003906_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.0	2.8e-13
>prophage 144
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2008829	2009513	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_021481408.1|2008829_2009513_+	DUF159 family protein	NA	A0A1P8CX02	Bacillus_phage	83.1	3.7e-65
>prophage 145
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2021291	2030910	4079669		Bacillus_phage(40.0%)	10	NA	NA
WP_033883975.1|2021291_2022212_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.9	2.7e-58
WP_038429094.1|2022671_2023034_-	YobA family protein	NA	NA	NA	NA	NA
WP_003231381.1|2023094_2023307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429095.1|2023409_2023673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429096.1|2024031_2026632_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.2	3.7e-44
WP_015251938.1|2027302_2027944_-	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_003231362.1|2028571_2028811_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.1	2.4e-19
WP_015251936.1|2028981_2029320_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	31.7	5.5e-09
WP_038429099.1|2029918_2030284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080019521.1|2030697_2030910_-	hypothetical protein	NA	A0A1P8CWP2	Bacillus_phage	85.4	6.0e-14
>prophage 146
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2035476	2036841	4079669		Pandoravirus(100.0%)	1	NA	NA
WP_015251931.1|2035476_2036841_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.3	1.5e-36
>prophage 147
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2046058	2052930	4079669		Bacillus_phage(75.0%)	4	NA	NA
WP_038429109.1|2046058_2047861_-	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	83.6	2.1e-216
WP_015251922.1|2047961_2048519_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.1	5.3e-102
WP_154231164.1|2048646_2050083_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	1.5e-07
WP_038429111.1|2050509_2052930_+	peptidase G2	NA	D6R401	Bacillus_phage	50.1	8.5e-221
>prophage 148
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2057371	2060284	4079669		Streptococcus_phage(100.0%)	4	NA	NA
WP_038429118.1|2057371_2058313_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	26.6	2.4e-06
WP_015714089.1|2058518_2059064_+	kinase	NA	NA	NA	NA	NA
WP_003231284.1|2059090_2059414_-	Zn(II)-responsive metalloregulatory transcriptional repressor CzrA	NA	NA	NA	NA	NA
WP_003231283.1|2059606_2060284_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	35.0	7.6e-18
>prophage 149
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2067211	2070098	4079669		Bacillus_phage(50.0%)	2	NA	NA
WP_003231267.1|2067211_2068075_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	71.7	1.4e-32
WP_038429123.1|2068322_2070098_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.9	4.8e-80
>prophage 150
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2078376	2079222	4079669		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_015251901.1|2078376_2079222_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.1	2.9e-35
>prophage 151
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2088082	2092576	4079669		Halovirus(33.33%)	4	NA	NA
WP_082098080.1|2088082_2088997_-	MoxR family ATPase	NA	R4TG24	Halovirus	27.6	1.1e-08
WP_038429140.1|2089060_2089651_-	superoxide dismutase-like protein YojM	NA	NA	NA	NA	NA
WP_038429142.1|2089743_2090988_-	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.2	1.0e-15
WP_003231222.1|2091358_2092576_-	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	30.7	8.6e-12
>prophage 152
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2108869	2109691	4079669		Freshwater_phage(100.0%)	1	NA	NA
WP_038429165.1|2108869_2109691_-	LD-carboxypeptidase LdcB	NA	A0A1B0XTX0	Freshwater_phage	33.1	8.9e-05
>prophage 153
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2125925	2126951	4079669		Catovirus(100.0%)	1	NA	NA
WP_003230816.1|2125925_2126951_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.0	5.9e-38
>prophage 154
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2136504	2138419	4079669		Bacillus_virus(66.67%)	3	NA	NA
WP_038429193.1|2136504_2137011_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	49.7	1.9e-37
WP_038429194.1|2137007_2137802_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	65.9	4.3e-105
WP_003230797.1|2137885_2138419_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.5	1.2e-50
>prophage 155
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2143821	2144439	4079669		Pandoravirus(100.0%)	1	NA	NA
WP_038429195.1|2143821_2144439_-	Mn(2+)-dependent (deoxy)ribonucleoside pyrophosphohydrolase	NA	S4W232	Pandoravirus	29.5	2.2e-11
>prophage 156
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2147805	2151786	4079669		Lactococcus_phage(50.0%)	9	NA	NA
WP_003230776.1|2147805_2148006_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	4.2e-17
WP_003230774.1|2148057_2148240_-	transcriptional regulator DegR	NA	NA	NA	NA	NA
WP_015251856.1|2148395_2148665_+	DUF2564 family protein	NA	NA	NA	NA	NA
WP_004399003.1|2148692_2148875_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_014477138.1|2148867_2149548_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_038429197.1|2149630_2150320_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_024572338.1|2150319_2150718_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_010334670.1|2150759_2150888_+	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_003230763.1|2150895_2151786_-	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	28.7	3.2e-24
>prophage 157
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2167385	2169311	4079669		Streptomyces_phage(100.0%)	1	NA	NA
WP_015251842.1|2167385_2169311_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.4	2.3e-11
>prophage 158
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2174479	2176729	4079669		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_038429202.1|2174479_2176729_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	28.6	6.7e-10
>prophage 159
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2180697	2181318	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_004399067.1|2180697_2181318_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	5.5e-23
>prophage 160
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2185343	2196985	4079669	tRNA	Bacillus_phage(40.0%)	11	NA	NA
WP_029726781.1|2185343_2186042_-	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	42.7	3.3e-24
WP_038430016.1|2186134_2187427_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.1	9.9e-59
WP_029317995.1|2187570_2188752_-	aspartate transaminase AspB	NA	NA	NA	NA	NA
WP_014477164.1|2188774_2189260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015251828.1|2189268_2189439_-	YpmA family protein	NA	NA	NA	NA	NA
WP_029726779.1|2189581_2192377_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.6	3.8e-55
WP_003225586.1|2192502_2192886_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_024571841.1|2192887_2193748_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_015714158.1|2193749_2194583_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	39.1	2.4e-50
WP_003230650.1|2194829_2195807_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_038427780.1|2195791_2196985_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.8	2.6e-37
>prophage 161
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2200541	2201414	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_003230635.1|2200541_2201414_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.8	9.6e-74
>prophage 162
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2205647	2206187	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_015251820.1|2205647_2206187_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	2.7e-42
>prophage 163
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2210325	2215811	4079669		Acinetobacter_phage(66.67%)	6	NA	NA
WP_014480119.1|2210325_2211408_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	28.2	1.3e-24
WP_003230608.1|2211418_2212222_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_015383968.1|2212214_2213417_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_038429206.1|2213397_2214045_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_038429207.1|2214049_2214802_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	42.5	4.0e-44
WP_038429208.1|2214794_2215811_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	43.0	1.7e-61
>prophage 164
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2219014	2225736	4079669		Pandoravirus(25.0%)	9	NA	NA
WP_004398727.1|2219014_2220187_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	4.2e-40
WP_038429209.1|2220261_2221032_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_010886554.1|2221268_2221718_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.3	2.4e-28
WP_010886555.1|2221833_2222880_-	Heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
WP_003230580.1|2222821_2223523_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_014480130.1|2223529_2224285_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003230576.1|2224448_2224676_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_038429210.1|2224697_2225270_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	57.0	4.9e-50
WP_003153447.1|2225457_2225736_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
>prophage 165
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2239070	2239988	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_038429214.1|2239070_2239988_-	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	40.3	1.6e-18
>prophage 166
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2246841	2257823	4079669		Bacillus_phage(60.0%)	10	NA	NA
WP_038429218.1|2246841_2248332_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.3	3.2e-61
WP_004398594.1|2248324_2249383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003225461.1|2249648_2249897_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_038429219.1|2249936_2250509_-	riboflavin transporter FmnP	NA	NA	NA	NA	NA
WP_038429220.1|2251005_2252583_+	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.1	1.3e-36
WP_015714185.1|2252625_2253393_-	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_015251796.1|2253504_2254611_-	anti-sigma-X factor RsiX	NA	NA	NA	NA	NA
WP_003230521.1|2254546_2255131_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_029726754.1|2255334_2257104_-	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	38.9	1.6e-38
WP_003246107.1|2257100_2257823_-	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.2	2.7e-45
>prophage 167
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2263302	2271263	4079669		Staphylococcus_phage(57.14%)	10	NA	NA
WP_038429223.1|2263302_2264451_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.6	1.0e-22
WP_004399065.1|2264573_2265113_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_003223904.1|2265167_2265761_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_014477220.1|2265750_2266506_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_032722049.1|2266786_2267311_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2267324_2267699_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2267811_2268276_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_003230496.1|2268308_2269505_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	5.3e-115
WP_004398505.1|2269519_2270167_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
WP_033884145.1|2270177_2271263_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.4	1.3e-56
>prophage 168
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2275111	2275543	4079669		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003223931.1|2275111_2275543_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.9	1.2e-16
>prophage 169
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2283191	2289244	4079669		Bacillus_phage(25.0%)	7	NA	NA
WP_003230458.1|2283191_2283959_-	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.7	1.0e-71
WP_003230452.1|2283970_2284411_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_004398633.1|2284407_2284761_-	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_004398637.1|2284856_2286026_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.0	1.1e-35
WP_017695927.1|2286180_2286996_-	purine nucleoside phosphorylase I, inosine and guanosine-specific	NA	Q5YBA4	Grouper_iridovirus	47.8	3.9e-69
WP_015251776.1|2287008_2288193_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_004398985.1|2288353_2289244_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	34.0	1.7e-41
>prophage 170
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2301954	2306656	4079669		Erysipelothrix_phage(33.33%)	5	NA	NA
WP_033884658.1|2301954_2302986_-	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	41.2	6.3e-32
WP_038429229.1|2302982_2303324_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004398668.1|2303333_2303804_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004398477.1|2303989_2304328_-	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	27.9	2.8e-05
WP_038429230.1|2305366_2306656_-	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	22.5	1.1e-12
>prophage 171
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2314482	2315785	4079669		Bacillus_virus(50.0%)	2	NA	NA
WP_038429239.1|2314482_2315418_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	55.8	2.1e-90
WP_038429240.1|2315461_2315785_-	thiol reductase thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	40.2	5.6e-11
>prophage 172
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2331037	2338998	4079669		Bacillus_phage(100.0%)	7	NA	NA
WP_154231167.1|2331037_2331145_+	impb/mucb/samb family protein	NA	A0A1P8CWP4	Bacillus_phage	78.6	4.4e-05
WP_038429255.1|2331196_2331727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429256.1|2332394_2333399_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_038429257.1|2333546_2333882_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038429258.1|2333925_2335689_-	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	20.6	4.0e-10
WP_038429259.1|2335672_2337562_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_038429261.1|2337765_2338998_+	DNA polymerase IV	NA	O64031	Bacillus_phage	41.6	1.8e-73
>prophage 173
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2347677	2353507	4079669		Oenococcus_phage(25.0%)	6	NA	NA
WP_080287617.1|2347677_2348064_-	hypothetical protein	NA	V5UQY3	Oenococcus_phage	57.3	5.1e-35
WP_003245966.1|2348068_2349028_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.3	5.5e-30
WP_038429268.1|2349099_2350446_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_015483409.1|2350521_2351301_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.1	7.4e-09
WP_038429269.1|2351306_2352266_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_029317946.1|2352670_2353507_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.8	5.3e-29
>prophage 174
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2358673	2361677	4079669		Cyanophage(50.0%)	2	NA	NA
WP_014480196.1|2358673_2360143_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.7	6.1e-81
WP_003230365.1|2360267_2361677_-	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	33.7	1.5e-36
>prophage 175
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2370091	2370814	4079669		Planktothrix_phage(100.0%)	1	NA	NA
WP_004398740.1|2370091_2370814_-	arginine ABC transporter ATP-binding protein ArtR	NA	G9BWD6	Planktothrix_phage	41.4	6.8e-33
>prophage 176
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2393683	2398348	4079669		Staphylococcus_phage(33.33%)	6	NA	NA
WP_038429286.1|2393683_2394415_-	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	28.8	1.4e-17
WP_072173938.1|2394493_2395114_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	43.1	1.3e-24
WP_014480225.1|2395133_2395430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480226.1|2395737_2395890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429287.1|2395962_2397081_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003226427.1|2397544_2398348_-	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.0	7.1e-07
>prophage 177
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2406441	2408777	4079669		Gordonia_phage(50.0%)	2	NA	NA
WP_015251733.1|2406441_2407788_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.9	1.5e-28
WP_003230259.1|2407925_2408777_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.0	5.9e-44
>prophage 178
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2421961	2430971	4079669		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_015251724.1|2421961_2422837_-	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	28.3	1.4e-16
WP_003236923.1|2422962_2423391_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_014664579.1|2423490_2424327_-	octanoyltransferase LipM	NA	NA	NA	NA	NA
WP_004398485.1|2424517_2424898_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015714246.1|2424932_2426399_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.0	3.1e-85
WP_029317920.1|2426391_2427738_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.4	3.4e-62
WP_015714248.1|2427767_2428856_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_003230203.1|2429297_2430971_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.2	4.4e-59
>prophage 179
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2448094	2450011	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_029317906.1|2448094_2450011_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	38.1	5.3e-101
>prophage 180
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2456729	2458332	4079669		Indivirus(50.0%)	2	NA	NA
WP_038429305.1|2456729_2457512_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.1	8.2e-16
WP_038429306.1|2457522_2458332_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	9.4e-15
>prophage 181
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2464954	2465563	4079669		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_038429308.1|2464954_2465563_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.6	4.2e-68
>prophage 182
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2471769	2481819	4079669	tRNA	Bodo_saltans_virus(20.0%)	9	NA	NA
WP_009967756.1|2471769_2472663_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.0	1.3e-25
WP_038429311.1|2472672_2473989_-	DEAD-box ATP-dependent RNA helicase CshB	NA	A0A1V0SIR5	Klosneuvirus	34.5	5.0e-50
WP_038429313.1|2474157_2474892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014477361.1|2475014_2475959_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_038429314.1|2475981_2477103_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	48.0	7.1e-21
WP_072692743.1|2477095_2477785_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_003230068.1|2478002_2478365_-	cytochrome c-550	NA	NA	NA	NA	NA
WP_003226225.1|2478693_2479809_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	5.8e-39
WP_038429315.1|2480007_2481819_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	1.1e-52
>prophage 183
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2492978	2493938	4079669		Rhizobium_phage(100.0%)	1	NA	NA
WP_003230035.1|2492978_2493938_-	PhoH-like protein	NA	L7TP00	Rhizobium_phage	54.0	1.8e-52
>prophage 184
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2498393	2498840	4079669		Xanthomonas_phage(100.0%)	1	NA	NA
WP_003230022.1|2498393_2498840_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	36.1	3.1e-12
>prophage 185
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2503267	2511231	4079669		Catovirus(33.33%)	6	NA	NA
WP_038429320.1|2503267_2504395_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.8	5.9e-23
WP_004398786.1|2504594_2506430_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	6.2e-139
WP_003230005.1|2506453_2507017_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003246126.1|2507088_2508120_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_038429321.1|2508200_2509340_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_003229999.1|2509392_2511231_-	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.6	2.6e-20
>prophage 186
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2516025	2518929	4079669		Clostridium_botulinum_C_phage(50.0%)	2	NA	NA
WP_038429325.1|2516025_2518356_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	34.7	9.6e-36
WP_003229978.1|2518359_2518929_-	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	52.5	2.8e-34
>prophage 187
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2522247	2522817	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_004398676.1|2522247_2522817_-	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	31.5	1.1e-22
>prophage 188
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2527387	2547850	4079669		Bacillus_phage(55.56%)	17	NA	NA
WP_038429329.1|2527387_2528140_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	64.2	8.9e-68
WP_038429330.1|2528326_2528953_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_038429331.1|2528971_2529865_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	35.4	1.4e-56
WP_010886572.1|2530116_2530839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429332.1|2530871_2531282_-	sporulation-specific Dnase NucB	NA	F8WPS9	Bacillus_phage	59.9	1.5e-40
WP_003226102.1|2531480_2532206_+	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.5	1.8e-12
WP_038429334.1|2532965_2533490_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038429335.1|2534715_2536095_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.3	3.9e-13
WP_038429336.1|2536311_2537178_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038429337.1|2537911_2538253_-	membrane protein	NA	NA	NA	NA	NA
WP_038429338.1|2538278_2539604_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	43.9	8.8e-95
WP_038429339.1|2539748_2540636_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_038429340.1|2541010_2541856_+	radical SAM protein	NA	NA	NA	NA	NA
WP_038429341.1|2541906_2542503_+	3'-5' exonuclease	NA	A0A2I6PEZ7	Staphylococcus_phage	27.6	8.7e-10
WP_052124609.1|2542797_2544261_+	carboxylesterase/lipase family protein	NA	NA	NA	NA	NA
WP_038429342.1|2544611_2545739_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	48.8	8.6e-91
WP_038429343.1|2545924_2547850_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	53.5	3.7e-110
>prophage 189
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2554449	2555424	4079669		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_052124610.1|2554449_2554860_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	72.1	4.1e-51
WP_029318115.1|2555157_2555424_+	hypothetical protein	NA	O64122	Bacillus_phage	39.1	1.3e-05
>prophage 190
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2569755	2570316	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_038429361.1|2569755_2570316_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	70.6	2.6e-56
>prophage 191
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2577628	2578666	4079669		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_015714361.1|2577628_2578666_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.9	1.9e-15
>prophage 192
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2590579	2591434	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_038429371.1|2590579_2591434_-	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.2	2.2e-94
>prophage 193
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2602954	2603788	4079669		Streptomyces_phage(100.0%)	1	NA	NA
WP_038429374.1|2602954_2603788_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.8e-19
>prophage 194
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2611295	2615064	4079669	protease	Tupanvirus(50.0%)	3	NA	NA
WP_014480388.1|2611295_2612345_+	formaldehyde dehydrogenase AdhA	NA	A0A2K9L339	Tupanvirus	41.8	8.6e-69
WP_003229836.1|2612477_2612987_+|protease	cysteine protease YraA	protease	NA	NA	NA	NA
WP_038429379.1|2613030_2615064_-	levanase	NA	S6ATV4	Bacillus_phage	38.0	2.8e-84
>prophage 195
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2626311	2632048	4079669		Pseudomonas_phage(50.0%)	3	NA	NA
WP_038429383.1|2626311_2628216_+	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	34.6	3.0e-43
WP_004398584.1|2628349_2628640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429384.1|2628883_2632048_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.1	1.4e-77
>prophage 196
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2639995	2642060	4079669		Pandoravirus(50.0%)	2	NA	NA
WP_017696065.1|2639995_2641135_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	31.0	1.0e-22
WP_014477492.1|2641136_2642060_-	O-acetylserine dependent cystathionine beta-synthase	NA	A0A1W6JHY1	Lactococcus_phage	42.8	3.8e-60
>prophage 197
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2647212	2658082	4079669	tRNA	Catovirus(20.0%)	11	NA	NA
WP_003225916.1|2647212_2647848_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	3.2e-34
WP_003229802.1|2647854_2649123_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.8	9.5e-38
WP_038429389.1|2649141_2650071_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_015251578.1|2650076_2650730_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	31.7	3.2e-05
WP_003229799.1|2650881_2651964_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_038429390.1|2652094_2652376_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003229795.1|2652393_2652810_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003225903.1|2652817_2653084_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_038429391.1|2653168_2655805_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.5	1.1e-67
WP_038429392.1|2656135_2657197_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017696070.1|2657353_2658082_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	5.6e-35
>prophage 198
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2661280	2663677	4079669		Brevibacillus_phage(100.0%)	1	NA	NA
WP_038429395.1|2661280_2663677_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.1	8.5e-80
>prophage 199
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2667331	2684107	4079669	tRNA	Bacillus_phage(25.0%)	13	NA	NA
WP_038429397.1|2667331_2668597_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	53.2	4.0e-113
WP_003229763.1|2668636_2669401_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	31.8	7.0e-20
WP_032722253.1|2669736_2671515_-|tRNA	aspartate--tRNA ligase	tRNA	K7Y9W2	Megavirus	33.6	5.4e-07
WP_032722254.1|2671528_2672803_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004399157.1|2673184_2673355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429398.1|2673487_2675044_+	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	28.7	9.3e-11
WP_004398689.1|2675069_2675510_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003229747.1|2675522_2677727_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.4	1.9e-09
WP_003229745.1|2677894_2678407_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.9	1.5e-29
WP_021480222.1|2678412_2680773_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	1.2e-91
WP_003229740.1|2680839_2681163_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003229739.1|2681238_2681736_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_038429399.1|2681893_2684107_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.5e-30
>prophage 200
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2687417	2741192	4079669	tRNA,coat,protease	uncultured_Mediterranean_phage(22.22%)	57	NA	NA
WP_004398708.1|2687417_2687684_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.3	1.5e-06
WP_003229725.1|2687720_2688866_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|2688892_2689921_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|2689950_2690151_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|2690143_2691148_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|2691158_2691764_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|2691902_2692415_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_003246197.1|2692462_2693770_-	MFS transporter	NA	NA	NA	NA	NA
WP_029318179.1|2693840_2694866_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_038429400.1|2695103_2695751_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|2695796_2695919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722260.1|2696003_2696450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727127.1|2696456_2696597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398698.1|2696760_2698215_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004398802.1|2698255_2698978_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003245996.1|2699080_2699677_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_032722261.1|2699824_2700988_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_032722262.1|2701104_2702211_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_038429401.1|2702197_2703067_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_032722264.1|2703020_2704616_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_029727121.1|2704718_2705906_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|2705865_2706408_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_032722265.1|2706431_2707289_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2707305_2707749_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003246161.1|2707809_2709096_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|2709129_2709708_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2709785_2709908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2710028_2710313_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2710325_2710664_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2710666_2710975_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|2711121_2711988_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_004398684.1|2711980_2712775_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398624.1|2712923_2713730_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2713731_2714412_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2714464_2714983_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2714979_2715852_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2715882_2716896_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_003246034.1|2716987_2717683_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004398496.1|2717719_2718289_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_038429403.1|2718441_2719440_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072592551.1|2719573_2720320_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_038429404.1|2720459_2721752_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_038429405.1|2721811_2724454_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	1.7e-161
WP_003222590.1|2724901_2725093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429406.1|2725111_2726137_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_038429407.1|2726169_2727897_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_003229633.1|2728027_2729320_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_015483525.1|2729349_2730324_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_038429408.1|2730320_2731109_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_082200968.1|2731098_2732043_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2732075_2732906_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|2732913_2734281_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003229624.1|2734509_2735007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014114673.1|2735028_2735616_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229618.1|2735612_2737937_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_014477564.1|2738117_2739776_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2739929_2741192_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 201
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2747286	2752121	4079669		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_038429410.1|2747286_2748843_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_003222549.1|2748829_2749858_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_004399096.1|2749881_2750400_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_029726372.1|2750396_2752121_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.4	2.2e-61
>prophage 202
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2757163	2757760	4079669		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_015251523.1|2757163_2757760_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	33.5	5.5e-12
>prophage 203
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2761345	2761570	4079669		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003184172.1|2761345_2761570_-	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.2e-15
>prophage 204
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2769642	2769957	4079669		Indivirus(100.0%)	1	NA	NA
WP_003222500.1|2769642_2769957_-	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 205
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2775261	2781642	4079669		Staphylococcus_phage(33.33%)	4	NA	NA
WP_038429424.1|2775261_2776944_-	long-chain-fatty-acid--CoA ligase LcfA	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.0e-31
WP_003237674.1|2777132_2777537_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_015714480.1|2777551_2779909_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.2e-16
WP_038429425.1|2779929_2781642_-	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	24.8	2.4e-12
>prophage 206
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2786207	2787242	4079669	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003229529.1|2786207_2787242_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.0	7.7e-30
>prophage 207
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2809603	2810125	4079669		Agrobacterium_phage(100.0%)	1	NA	NA
WP_010886591.1|2809603_2810125_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	7.1e-16
>prophage 208
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2813258	2823560	4079669	tRNA	Enterobacteria_phage(25.0%)	9	NA	NA
WP_015251492.1|2813258_2815040_-	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	31.0	4.1e-71
WP_015251491.1|2815206_2815989_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_014480529.1|2816027_2817959_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.3	4.9e-110
WP_003229471.1|2818352_2819198_-	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_038430039.1|2819276_2819918_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_014480531.1|2819951_2820887_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	34.4	9.7e-40
WP_015251489.1|2820914_2822333_-	replication initiation membrane attachment protein DnaB	NA	NA	NA	NA	NA
WP_003223586.1|2822447_2822906_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_003223584.1|2823179_2823560_-	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	1.6e-17
>prophage 209
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2826801	2837752	4079669		Bacillus_phage(50.0%)	9	NA	NA
WP_003229455.1|2826801_2827644_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.8	4.2e-82
WP_004398928.1|2827685_2828279_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_029726380.1|2828294_2828927_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_019712903.1|2829093_2829924_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.6	5.1e-24
WP_038429446.1|2829946_2832589_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	30.4	2.3e-41
WP_038429447.1|2832832_2834572_-	sensory box histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	40.6	4.9e-45
WP_003229442.1|2834564_2835287_-	two-component system response regulator PhoP	NA	W8CYM9	Bacillus_phage	43.6	3.5e-45
WP_038429448.1|2835498_2836437_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003229433.1|2836480_2837752_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.1e-12
>prophage 210
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2841553	2843311	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004398560.1|2841553_2843311_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	50.6	1.0e-13
>prophage 211
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2848034	2851382	4079669		Streptomyces_phage(100.0%)	1	NA	NA
WP_038429452.1|2848034_2851382_-	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	36.1	1.6e-177
>prophage 212
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2857750	2861890	4079669		Indivirus(50.0%)	5	NA	NA
WP_038429454.1|2857750_2858443_-	RNA-binding riboflavin kinase RibR	NA	A0A1V0SD03	Indivirus	30.9	1.5e-05
WP_038429455.1|2858491_2859820_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038429456.1|2859816_2860095_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_038429457.1|2860109_2861114_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003229383.1|2861110_2861890_-	sulfur-containing amino-acid ABC transporter ATP-binding protein TcyN	NA	G9BWD6	Planktothrix_phage	38.3	6.9e-31
>prophage 213
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2876804	2882420	4079669		Burkholderia_phage(33.33%)	5	NA	NA
WP_038429466.1|2876804_2877812_-	signal peptide peptidase SppA	NA	Q6UYI0	Burkholderia_phage	32.6	1.9e-17
WP_014477655.1|2877997_2878801_+	NAD kinase	NA	NA	NA	NA	NA
WP_038429467.1|2878832_2880422_-	amidohydrolase	NA	NA	NA	NA	NA
WP_015714519.1|2880441_2882031_-	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.0	1.5e-72
WP_003223491.1|2882210_2882420_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	76.9	4.7e-19
>prophage 214
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2890462	2896707	4079669	tRNA	Bacillus_phage(33.33%)	5	NA	NA
WP_038429469.1|2890462_2892202_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	1.9e-20
WP_003229307.1|2892284_2892467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229304.1|2892496_2893099_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_038429470.1|2893378_2894647_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	43.3	4.5e-80
WP_038429471.1|2894988_2896707_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	73.0	1.4e-209
>prophage 215
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2902220	2903297	4079669		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003223454.1|2902220_2903297_-	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	28.5	1.6e-14
>prophage 216
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2906500	2910949	4079669		Mycobacterium_phage(50.0%)	3	NA	NA
WP_038429474.1|2906500_2909359_-	DNA translocase SftA	NA	S5VNE3	Mycobacterium_phage	49.6	9.1e-89
WP_038429475.1|2909518_2910124_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_009967991.1|2910139_2910949_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	54.5	9.6e-36
>prophage 217
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2923225	2928884	4079669		Streptococcus_phage(33.33%)	5	NA	NA
WP_003229237.1|2923225_2924161_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.9	5.5e-83
WP_014477689.1|2924194_2925586_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_014480583.1|2925682_2926981_+	hypoxanthine/guanine permease PbuO	NA	A0A0R6PHV4	Moraxella_phage	32.8	4.6e-48
WP_038429479.1|2927019_2928177_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015714539.1|2928173_2928884_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	2.5e-19
>prophage 218
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2932141	2935131	4079669		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003229222.1|2932141_2933404_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.9	8.8e-28
WP_015384403.1|2933592_2935131_+	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	26.3	2.0e-21
>prophage 219
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2948959	2951465	4079669		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_038429486.1|2948959_2950129_-	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	30.1	5.5e-40
WP_038429487.1|2950118_2951465_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	8.6e-13
>prophage 220
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2959404	2968864	4079669	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_015251406.1|2959404_2961819_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.7	0.0e+00
WP_003246114.1|2962245_2962581_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_038429491.1|2962985_2963771_+	blue-light photoreceptor	NA	NA	NA	NA	NA
WP_038429492.1|2964007_2965201_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	52.0	1.7e-105
WP_014480618.1|2965389_2966136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429493.1|2966172_2968113_-	bacitracin ABC transporter permease BceB	NA	NA	NA	NA	NA
WP_003229137.1|2968102_2968864_-	bacitracin ABC transporter ATP-binding protein BceA	NA	G9BWD6	Planktothrix_phage	35.8	6.1e-32
>prophage 221
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	2972054	2995100	4079669	holin	Staphylococcus_phage(58.33%)	28	NA	NA
WP_003229129.1|2972054_2972750_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	1.0e-38
WP_029726913.1|2972764_2973742_-	ABC transporter permease YtrD	NA	NA	NA	NA	NA
WP_029726914.1|2973771_2974758_-	ABC transporter permease YtrC	NA	NA	NA	NA	NA
WP_003229123.1|2974751_2975630_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	6.8e-19
WP_003229121.1|2975622_2976015_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003229119.1|2976048_2976186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229117.1|2976340_2976613_-	YtzC family protein	NA	NA	NA	NA	NA
WP_024572829.1|2976774_2977743_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	4.2e-54
WP_038429495.1|2977739_2978324_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	51.6	2.2e-45
WP_038429496.1|2978313_2979417_-	tetraprenyl-beta-curcumene synthase	NA	NA	NA	NA	NA
WP_003229109.1|2979437_2980217_-	phospholipase YtpA	NA	A0A220T682	Eptesipox_virus	26.2	3.6e-11
WP_004399093.1|2980265_2980781_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_038429497.1|2981026_2982418_-	amino acid permease	NA	NA	NA	NA	NA
WP_003229103.1|2982553_2984452_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	29.4	4.3e-34
WP_003229102.1|2984601_2985804_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.6	4.3e-165
WP_014480627.1|2986306_2987890_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.4	1.6e-196
WP_003223304.1|2987928_2988171_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_038429498.1|2988222_2988996_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	41.9	5.8e-38
WP_033884525.1|2989147_2990152_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003229092.1|2990164_2990947_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	7.4e-33
WP_014477740.1|2990921_2991734_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003229087.1|2991760_2992237_-	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_024573054.1|2992443_2992848_-|holin	holin family protein	holin	NA	NA	NA	NA
WP_003229083.1|2993013_2993451_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_010886599.1|2993543_2993720_+	YtzI protein	NA	NA	NA	NA	NA
WP_024573053.1|2993713_2994151_-	FixH family protein	NA	NA	NA	NA	NA
WP_003219361.1|2994270_2994744_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_038429499.1|2994872_2995100_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	68.9	6.2e-25
>prophage 222
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3001043	3005587	4079669		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_029727101.1|3001043_3001796_-	manganese ABC transporter ATP-binding protein MntB	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	6.7e-15
WP_029318300.1|3001814_3002735_-	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_003229057.1|3003014_3004130_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_029727102.1|3004126_3005587_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.9	3.8e-75
>prophage 223
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3011511	3014735	4079669		Bacillus_phage(66.67%)	3	NA	NA
WP_003229044.1|3011511_3012330_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	8.2e-51
WP_038429502.1|3012501_3013788_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.8	3.0e-71
WP_038429503.1|3013784_3014735_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.3	1.6e-29
>prophage 224
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3020511	3022908	4079669		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_038429509.1|3020511_3022908_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.2	5.8e-12
>prophage 225
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3037701	3039231	4079669		Orpheovirus(100.0%)	1	NA	NA
WP_014477772.1|3037701_3039231_-	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
>prophage 226
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3048069	3048918	4079669		Brevibacillus_phage(100.0%)	1	NA	NA
WP_032726765.1|3048069_3048918_-	exo-glucosaminidase LytG	NA	A0A0K2CP65	Brevibacillus_phage	41.1	1.0e-24
>prophage 227
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3061317	3069684	4079669		uncultured_Caudovirales_phage(100.0%)	4	NA	NA
WP_038429524.1|3061317_3063306_-	methyl-accepting chemotaxis protein TlpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.0	1.2e-15
WP_017695501.1|3063419_3065405_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	3.4e-26
WP_038429525.1|3065530_3067519_-	methyl-accepting chemotaxis protein TlpA	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.5	1.2e-15
WP_015714604.1|3067695_3069684_-	methyl-accepting chemotaxis protein McpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.4	4.4e-13
>prophage 228
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3076103	3077090	4079669		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003228881.1|3076103_3077090_+	potassium channel protein KbfO	NA	A0A1B0Y2S3	Lactobacillus_phage	34.8	4.8e-05
>prophage 229
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3084825	3085647	4079669		Mycobacterium_phage(100.0%)	1	NA	NA
WP_014480683.1|3084825_3085647_+	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.5	3.3e-07
>prophage 230
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3098349	3103382	4079669		Brazilian_cedratvirus(50.0%)	4	NA	NA
WP_038429533.1|3098349_3099882_+	guanosine ABC transporter ATP-binding protein NupO	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	3.6e-07
WP_015714618.1|3099874_3100921_+	guanosine ABC transporter permease NupP	NA	NA	NA	NA	NA
WP_015714619.1|3100921_3101881_+	guanosine ABC transporter permease NupQ	NA	NA	NA	NA	NA
WP_015714620.1|3102035_3103382_+	sodium/malate symporter MaeN	NA	A0A140XAH4	Dickeya_phage	48.4	8.8e-18
>prophage 231
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3116704	3118177	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_003228788.1|3116704_3118177_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.8	6.5e-107
>prophage 232
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3127220	3131708	4079669		Mycobacterium_phage(100.0%)	1	NA	NA
WP_038429547.1|3127220_3131708_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	21.7	3.7e-36
>prophage 233
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3138025	3145162	4079669		Tupanvirus(100.0%)	1	NA	NA
WP_038429550.1|3138025_3145162_-	nonribosomal peptide synthetase DhbF	NA	A0A2K9KZV5	Tupanvirus	26.8	1.9e-98
>prophage 234
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3153925	3168229	4079669	protease	Mycoplasma_phage(14.29%)	18	NA	NA
WP_015251314.1|3153925_3155428_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.3	9.8e-58
WP_003244337.1|3155585_3156062_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_015251313.1|3156091_3156748_-	stationary phase survival protein SpsC	NA	A0A217ER34	Bacillus_phage	31.8	7.4e-10
WP_003243877.1|3156851_3157172_-	membrane protein	NA	NA	NA	NA	NA
WP_003243733.1|3157225_3157369_-	YuiA family protein	NA	NA	NA	NA	NA
WP_033881474.1|3157541_3158762_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015251312.1|3159093_3160092_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	53.2	5.5e-33
WP_003228723.1|3160131_3160272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029725886.1|3160550_3161531_+	GMP reductase	NA	G3MBI2	Bacillus_virus	85.8	1.5e-163
WP_033883910.1|3161604_3162228_-|protease	protease synthase/sporulation negative transcriptional regulator PaiB	protease	NA	NA	NA	NA
WP_003244000.1|3162251_3162770_-	spermidine/spermine N(1)-acetyltransferase	NA	NA	NA	NA	NA
WP_003244166.1|3163106_3163469_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	45.3	1.4e-18
WP_038429557.1|3163547_3164402_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003228710.1|3164524_3165739_-	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.3	1.6e-13
WP_003222913.1|3165875_3166112_-	YuzB family protein	NA	NA	NA	NA	NA
WP_003228707.1|3166374_3167442_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038429558.1|3167467_3167794_-	YuzD family protein	NA	NA	NA	NA	NA
WP_003151955.1|3167992_3168229_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.3	2.9e-09
>prophage 235
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3175008	3175509	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_003243814.1|3175008_3175509_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.0	1.2e-41
>prophage 236
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3178960	3179941	4079669		Microcystis_phage(100.0%)	1	NA	NA
WP_003243462.1|3178960_3179941_+	L-Ala--D-Glu endopeptidase	NA	A0A075BS18	Microcystis_phage	37.3	3.0e-07
>prophage 237
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3188007	3190655	4079669		Enterobacteria_phage(100.0%)	2	NA	NA
WP_038429569.1|3188007_3189357_+	uric acid permease PucJ	NA	Q9KX94	Enterobacteria_phage	28.1	8.8e-26
WP_038429570.1|3189392_3190655_+	uric acid permease PucK	NA	Q9KX94	Enterobacteria_phage	30.3	9.8e-27
>prophage 238
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3202499	3203603	4079669		Mycoplasma_phage(100.0%)	1	NA	NA
WP_038429582.1|3202499_3203603_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	28.6	6.6e-19
>prophage 239
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3208596	3209583	4079669		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_015251278.1|3208596_3209583_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	23.6	1.9e-09
>prophage 240
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3214562	3224682	4079669		Mycobacterium_phage(20.0%)	15	NA	NA
WP_003222809.1|3214562_3215006_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	1.9e-14
WP_038429586.1|3214995_3216216_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.8	2.6e-117
WP_003228602.1|3216215_3217529_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|3217546_3218332_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	22.7	3.5e-06
WP_003228600.1|3218525_3218663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014477920.1|3218856_3219234_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_021480560.1|3219519_3220344_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_003228593.1|3220357_3221026_-	methionine ABC transporter permease MetP	NA	NA	NA	NA	NA
WP_003242531.1|3221018_3222044_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	1.4e-31
WP_003228587.1|3222370_3222715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014480792.1|3222821_3223142_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_021480561.1|3223143_3223584_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_003228581.1|3223583_3223820_-	YusG family protein	NA	NA	NA	NA	NA
WP_003222781.1|3223875_3224259_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003222779.1|3224325_3224682_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	54.6	1.8e-23
>prophage 241
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3230492	3231401	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038429591.1|3230492_3231401_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	42.2	5.2e-62
>prophage 242
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3234771	3237692	4079669		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_038429593.1|3234771_3235512_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.9	1.4e-12
WP_015714676.1|3235645_3236533_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003228549.1|3236552_3236840_-	YusU family protein	NA	NA	NA	NA	NA
WP_076457600.1|3236864_3237692_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	7.1e-10
>prophage 243
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3241318	3244153	4079669	protease	Clostridium_phage(33.33%)	3	NA	NA
WP_038429599.1|3241318_3241780_+	metalloregulation DNA-binding stress protein MgrA	NA	A0A0A7RTZ1	Clostridium_phage	49.6	9.1e-31
WP_038429600.1|3241821_3243198_-|protease	serine protease Do-like protein HtrB	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.5	2.5e-20
WP_003228529.1|3243475_3244153_+	secretion stress-responsive two-component system response regulator CssR	NA	W8CYM9	Bacillus_phage	34.1	2.4e-27
>prophage 244
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3258896	3261286	4079669		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_082201018.1|3258896_3260225_-	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.7	3.1e-07
WP_015251250.1|3260224_3261286_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.9	6.5e-16
>prophage 245
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3264369	3266822	4079669		Bacillus_phage(100.0%)	2	NA	NA
WP_032726840.1|3264369_3266112_-	two-component system sensor histidine kinase YvrG	NA	W8CYF6	Bacillus_phage	24.2	1.3e-16
WP_003243545.1|3266108_3266822_-	two-component system response regulator YvrH	NA	W8CYM9	Bacillus_phage	36.5	7.9e-34
>prophage 246
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3271104	3273951	4079669		Planktothrix_phage(50.0%)	3	NA	NA
WP_014480848.1|3271104_3271794_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	9.4e-40
WP_021480587.1|3271777_3272971_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_038429611.1|3273141_3273951_-	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	26.9	3.1e-10
>prophage 247
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3279578	3285387	4079669		Bacillus_phage(33.33%)	6	NA	NA
WP_003228444.1|3279578_3280061_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.4	1.3e-08
WP_038429615.1|3280160_3282014_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.1	5.0e-88
WP_038430048.1|3282042_3282969_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_003243706.1|3283079_3283862_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_119899754.1|3283833_3284526_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015483687.1|3284556_3285387_-	glyoxal/methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.8	1.7e-80
>prophage 248
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3297590	3302267	4079669		Streptococcus_phage(50.0%)	2	NA	NA
WP_154231165.1|3297590_3299699_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.9	1.0e-116
WP_038429629.1|3299858_3302267_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.2	1.6e-118
>prophage 249
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3309986	3329701	4079669	holin	Thermus_phage(25.0%)	24	NA	NA
WP_003220025.1|3309986_3310457_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
WP_003228386.1|3310601_3312941_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
WP_003242610.1|3312959_3313700_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003220028.1|3313831_3314062_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_038429635.1|3314210_3314981_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	29.6	2.9e-05
WP_009968172.1|3315020_3315254_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014665397.1|3315405_3315813_+	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_014480905.1|3315842_3316262_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003242888.1|3316353_3316680_+	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_038429637.1|3316807_3318508_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	1.4e-23
WP_003228374.1|3318547_3319228_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_038429639.1|3319244_3320165_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038429641.1|3320176_3320830_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_038429643.1|3320846_3321992_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_014478002.1|3322275_3322809_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009968174.1|3323030_3323507_+	sporulation-delaying system protein SdpA	NA	NA	NA	NA	NA
WP_003228363.1|3323503_3324475_+	sporulation-delaying protein SdpB	NA	NA	NA	NA	NA
WP_003243360.1|3324517_3325129_+	sporulation delaying protein SdpC	NA	NA	NA	NA	NA
WP_038429645.1|3325175_3325799_-	immunity protein SdpI	NA	NA	NA	NA	NA
WP_003243541.1|3325795_3326068_-	sporulation delaying system autorepressor SdpR	NA	NA	NA	NA	NA
WP_003244403.1|3326244_3326934_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_082201019.1|3326951_3327818_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228349.1|3327882_3328536_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_038429648.1|3328558_3329701_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 250
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3335253	3336546	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_003228333.1|3335253_3336546_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.5	6.4e-175
>prophage 251
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3350352	3351387	4079669		Microbacterium_phage(100.0%)	1	NA	NA
WP_038429654.1|3350352_3351387_-	glycosylase	NA	A0A2P1CFB9	Microbacterium_phage	25.4	2.0e-09
>prophage 252
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3357048	3357954	4079669		Staphylococcus_phage(100.0%)	1	NA	NA
WP_072692770.1|3357048_3357954_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.7	8.0e-23
>prophage 253
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3365395	3366388	4079669		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003244199.1|3365395_3366388_-	galactan degradation operon transcriptional regulator GanR	NA	C6ZCU4	Enterobacteria_phage	22.3	8.0e-08
>prophage 254
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3371799	3372966	4079669		Tupanvirus(100.0%)	1	NA	NA
WP_029725953.1|3371799_3372966_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.4	7.4e-29
>prophage 255
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3381154	3384941	4079669		Catovirus(50.0%)	3	NA	NA
WP_003244557.1|3381154_3381991_-	glycosyltransferase EpsE	NA	A0A1V0SAH6	Catovirus	39.6	1.7e-14
WP_003242735.1|3381987_3383133_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015251176.1|3383144_3384941_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	30.6	2.6e-25
>prophage 256
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3390855	3395795	4079669		Mycobacterium_phage(50.0%)	3	NA	NA
WP_038429683.1|3390855_3392211_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	24.1	7.8e-14
WP_001022105.1|3392749_3394171_+	levansucrase	NA	NA	NA	NA	NA
WP_003243729.1|3394244_3395795_+	2,6-beta-fructan 6-levanbiohydrolase	NA	F8WPR5	Bacillus_phage	42.9	7.6e-98
>prophage 257
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3402972	3404303	4079669		Agrobacterium_phage(50.0%)	2	NA	NA
WP_003228214.1|3402972_3403566_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.8	2.6e-54
WP_038429687.1|3403628_3404303_-	beta-phosphoglucomutase	NA	A7ITQ4	Paramecium_bursaria_Chlorella_virus	27.3	4.9e-09
>prophage 258
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3415690	3418322	4079669		Catovirus(33.33%)	3	NA	NA
WP_003228180.1|3415690_3416266_-	LOG family protein YvdD	NA	A0A1V0S9E9	Catovirus	27.1	3.8e-10
WP_003242570.1|3416382_3416703_+	hypothetical protein	NA	G3MBI9	Bacillus_virus	42.3	2.3e-17
WP_038429702.1|3416729_3418322_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.0	5.9e-45
>prophage 259
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3422246	3423026	4079669		Planktothrix_phage(100.0%)	1	NA	NA
WP_003228167.1|3422246_3423026_-	lantibiotic ABC transporter ATP-binding protein PsdA	NA	G9BWD6	Planktothrix_phage	34.4	3.2e-28
>prophage 260
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3426323	3436253	4079669		Streptococcus_phage(33.33%)	8	NA	NA
WP_003228147.1|3426323_3427274_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	4.3e-51
WP_003244450.1|3427296_3428250_-	gluconeogenesis morphogenetic factor	NA	A1IMD5	Streptococcus_phage	41.1	4.0e-65
WP_003243903.1|3428251_3429139_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.0	8.7e-06
WP_010886622.1|3429163_3429640_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003228139.1|3429958_3430909_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.2	2.0e-88
WP_038429709.1|3431113_3432523_-	peptidoglycan DL-endopeptidase CwlO	NA	A0A0A0RVE6	Bacillus_phage	52.6	1.6e-25
WP_033885400.1|3432903_3434358_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_038429712.1|3434483_3436253_-	multidrug resistance ABC transporter ATP-binding protein/permease BmrA	NA	W8CYL7	Bacillus_phage	59.3	6.3e-165
>prophage 261
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3448023	3448542	4079669		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003228107.1|3448023_3448542_-	heptaprenylglyceryl phosphate O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	25.7	5.6e-05
>prophage 262
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3462665	3465539	4079669		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003228057.1|3462665_3465539_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.5	0.0e+00
>prophage 263
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3477421	3478108	4079669		Planktothrix_phage(100.0%)	1	NA	NA
WP_003228039.1|3477421_3478108_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.0	1.7e-25
>prophage 264
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3488570	3488795	4079669		Vibrio_phage(100.0%)	1	NA	NA
WP_033884178.1|3488570_3488795_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	50.0	3.4e-07
>prophage 265
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3494690	3499930	4079669		Streptococcus_phage(66.67%)	5	NA	NA
WP_038429730.1|3494690_3496082_-	ATP-dependent helicase ComFA	NA	A0A1X9I5S6	Streptococcus_phage	37.6	4.0e-66
WP_038429731.1|3496187_3497033_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	5.7e-15
WP_003219701.1|3497130_3497820_-	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_003227983.1|3497902_3499060_-	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_003227979.1|3499276_3499930_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.1	5.8e-39
>prophage 266
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3503620	3508049	4079669		Catovirus(50.0%)	4	NA	NA
WP_003242619.1|3503620_3504379_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.4	9.4e-17
WP_029318784.1|3504402_3505083_-	Teichuronic acid biosynthesis protein TuaF	NA	NA	NA	NA	NA
WP_032726971.1|3505112_3506579_-	teichuronic acid biosynthesis protein TuaE	NA	NA	NA	NA	NA
WP_038430049.1|3506663_3508049_-	UDP-glucose 6-dehydrogenase TuaD	NA	A0A127AXI2	Bacillus_phage	42.3	2.6e-89
>prophage 267
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3511669	3520681	4079669		Paenibacillus_phage(20.0%)	7	NA	NA
WP_033884184.1|3511669_3513160_-	N-acetylmuramoyl-L-alanine amidase LytC	NA	A0A0N9SGH1	Paenibacillus_phage	39.4	1.9e-21
WP_015714810.1|3513198_3515316_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	27.6	6.7e-12
WP_003242772.1|3515339_3515648_-	membrane-bound protein LytA	NA	NA	NA	NA	NA
WP_014478144.1|3515831_3516752_+	transcription antiterminator LytR	NA	NA	NA	NA	NA
WP_038429734.1|3516791_3517934_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.0	1.2e-26
WP_003227944.1|3518180_3519059_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.7	3.3e-82
WP_038429735.1|3519097_3520681_-	teichoic acids export ABC transporter ATP-binding subunit TagH	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	6.1e-18
>prophage 268
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3526127	3533017	4079669		Hokovirus(33.33%)	5	NA	NA
WP_003227921.1|3526127_3526517_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.6	1.7e-17
WP_038429738.1|3526917_3527688_+	N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D- mannosaminyltransferase	NA	NA	NA	NA	NA
WP_038429739.1|3527721_3528867_+	teichoic acid glycerol-phosphate primase	NA	NA	NA	NA	NA
WP_033884187.1|3528986_3530315_+	teichoic acid biosynthesis protein	NA	A0A1J0MII7	Staphylococcus_phage	29.3	6.2e-24
WP_038429740.1|3530374_3533017_-	beta-N-acetylglucosaminidase LytD	NA	Q4ZC50	Staphylococcus_virus	44.9	1.8e-38
>prophage 269
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3538081	3543047	4079669		Aichi_virus(50.0%)	4	NA	NA
WP_038429742.1|3538081_3539455_-	MFS transporter	NA	O13311	Aichi_virus	30.5	8.7e-37
WP_038429743.1|3539787_3540756_+	polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagT	NA	NA	NA	NA	NA
WP_038429744.1|3540911_3541772_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_038430050.1|3541805_3543047_-	gamma-DL-glutamyl hydrolase	NA	S5MM68	Bacillus_phage	42.0	1.4e-17
>prophage 270
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3549230	3550712	4079669		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_032726997.1|3549230_3550712_+	ribose ABC transporter ATP-binding protein RbsA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	1.5e-13
>prophage 271
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3557047	3559495	4079669		Lactobacillus_phage(50.0%)	2	NA	NA
WP_003227859.1|3557047_3557956_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	8.9e-14
WP_080529885.1|3558166_3559495_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	29.5	6.4e-45
>prophage 272
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3570052	3588092	4079669		Bacillus_phage(33.33%)	19	NA	NA
WP_038429752.1|3570052_3570766_-	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.5	5.5e-19
WP_014481129.1|3570886_3571240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021480772.1|3572373_3572583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429753.1|3572596_3573115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429754.1|3573122_3574934_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	35.5	1.0e-37
WP_014478191.1|3574952_3575213_-	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_017696586.1|3575221_3575644_-	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
WP_154231166.1|3575833_3575986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429755.1|3576035_3576821_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_038429756.1|3577032_3578355_-	UDP-glucose 6-dehydrogenase UglF	NA	A0A127AXI2	Bacillus_phage	39.3	2.3e-87
WP_014481136.1|3578549_3579314_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_038429757.1|3579362_3580079_-	tyrosine-protein kinase PtkA	NA	A0A1X9I5D6	Streptococcus_phage	38.7	1.1e-27
WP_003227811.1|3580068_3580815_-	protein-tyrosine kinase activator TkmA	NA	NA	NA	NA	NA
WP_003242876.1|3581048_3581192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429758.1|3581395_3583006_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_038429759.1|3582992_3585761_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	27.5	1.3e-39
WP_038429760.1|3585886_3586744_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003244075.1|3586749_3587526_-	transcriptional regulator GlcR	NA	NA	NA	NA	NA
WP_014478203.1|3587750_3588092_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	66.0	2.0e-35
>prophage 273
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3595955	3596237	4079669		Clostridium_phage(100.0%)	1	NA	NA
WP_003221804.1|3595955_3596237_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 274
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3607237	3608110	4079669		Clostridium_phage(100.0%)	1	NA	NA
WP_038429766.1|3607237_3608110_-	stage II sporulation protein spoIIQ	NA	I3PV24	Clostridium_phage	36.1	1.1e-05
>prophage 275
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3618570	3619704	4079669		Bacillus_phage(100.0%)	1	NA	NA
WP_015251020.1|3618570_3619704_-	response regulator aspartate phosphatase RapB	NA	A0A1P8CWN8	Bacillus_phage	45.5	9.9e-87
>prophage 276
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3624279	3625311	4079669		Pseudomonas_phage(100.0%)	1	NA	NA
WP_019712591.1|3624279_3625311_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	41.0	1.6e-43
>prophage 277
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3636747	3641567	4079669		Aeromonas_phage(50.0%)	6	NA	NA
WP_038429778.1|3636747_3637995_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.4	4.2e-99
WP_003227667.1|3638201_3638744_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_003221910.1|3638756_3639206_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_015384897.1|3639362_3639815_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003227661.1|3639890_3640448_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_015251011.1|3640526_3641567_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.6	2.2e-61
>prophage 278
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3644642	3645713	4079669		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003227645.1|3644642_3645713_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 279
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3649962	3650550	4079669		Bacillus_virus(100.0%)	1	NA	NA
WP_014478269.1|3649962_3650550_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	45.9	3.1e-36
>prophage 280
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3655311	3659858	4079669		Synechococcus_phage(33.33%)	5	NA	NA
WP_003227626.1|3655311_3655950_-	fructose-6-phosphate aldolase	NA	A0A0E3FQP8	Synechococcus_phage	45.0	7.3e-47
WP_003243339.1|3656069_3656927_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003227621.1|3657107_3657482_-	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	2.9e-11
WP_014481199.1|3657647_3658169_+	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_003227612.1|3658250_3659858_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
>prophage 281
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3665420	3669039	4079669		Bacillus_phage(100.0%)	4	NA	NA
WP_038429783.1|3665420_3666383_+	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.2	1.0e-39
WP_003227597.1|3666463_3666736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429784.1|3666777_3667302_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_032727056.1|3667311_3669039_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	2.0e-59
>prophage 282
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3672382	3673846	4079669		Escherichia_phage(100.0%)	1	NA	NA
WP_014481212.1|3672382_3673846_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	4.2e-21
>prophage 283
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3681222	3761881	4079669	bacteriocin,tRNA,coat,protease	Bacillus_phage(25.0%)	83	NA	NA
WP_003227570.1|3681222_3682893_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|3682889_3683318_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3683630_3683762_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_082200983.1|3683718_3683871_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_015714887.1|3683895_3685242_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3685254_3685416_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_038429789.1|3685412_3686132_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	3.6e-18
WP_038429790.1|3686124_3687435_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_082201022.1|3687424_3688585_+	insulinase family protein	NA	NA	NA	NA	NA
WP_038429792.1|3688589_3689870_+	insulinase family protein	NA	NA	NA	NA	NA
WP_038429793.1|3689866_3690568_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_038429794.1|3690573_3691950_-	YncE family protein	NA	NA	NA	NA	NA
WP_038429795.1|3691989_3693345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429796.1|3693341_3693572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429797.1|3693574_3694720_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.0	8.5e-78
WP_009968329.1|3694703_3694823_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_015714892.1|3695076_3695556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714893.1|3695704_3696493_+	membrane protein	NA	NA	NA	NA	NA
WP_015714894.1|3696479_3697154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714895.1|3697154_3697961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714896.1|3697963_3698611_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.7e-28
WP_015714897.1|3698603_3699164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227545.1|3699212_3700085_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3700145_3700976_-	spermidine synthase	NA	NA	NA	NA	NA
WP_038429798.1|3701178_3703254_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_038429799.1|3703546_3704065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|3704078_3704738_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3704846_3705035_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003227535.1|3705077_3705497_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038429800.1|3705616_3707533_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	42.7	6.2e-142
WP_038429801.1|3708622_3710032_-	MFS transporter	NA	NA	NA	NA	NA
WP_038429802.1|3710031_3710502_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3710613_3711114_-	YwgA family protein	NA	NA	NA	NA	NA
WP_015250978.1|3711149_3712451_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3712612_3712837_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_038429803.1|3713051_3713828_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_038429804.1|3713971_3714862_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003227511.1|3715029_3715875_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_038429805.1|3715923_3716823_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|3716968_3717940_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_038429806.1|3718209_3718974_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_038429807.1|3719106_3719886_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_014481235.1|3719900_3721100_-	transaminase BacF	NA	NA	NA	NA	NA
WP_019712823.1|3721100_3722285_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_038429808.1|3722281_3723700_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_038430056.1|3723718_3724480_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.8e-21
WP_003244300.1|3724482_3725190_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3725179_3725794_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_038429809.1|3725945_3727184_-	MFS transporter	NA	NA	NA	NA	NA
WP_038429810.1|3727393_3728806_-	amino acid permease	NA	NA	NA	NA	NA
WP_017696234.1|3728805_3730506_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_038429811.1|3730579_3732127_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227482.1|3732353_3733628_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003227472.1|3733805_3734270_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_014481242.1|3734594_3735050_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_015250965.1|3735042_3735894_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
WP_003244201.1|3735907_3736855_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|3736854_3737595_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_038429812.1|3737619_3738639_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_038429813.1|3738641_3739364_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_038429814.1|3739356_3740478_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_003227457.1|3740477_3741347_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_038429815.1|3741347_3742517_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	5.5e-16
WP_019712828.1|3742537_3743962_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015250957.1|3743966_3744737_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_014481253.1|3745056_3745602_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3745645_3746017_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_015384975.1|3746078_3747401_-	purine permease	NA	NA	NA	NA	NA
WP_003243806.1|3747420_3747738_-	YwdI family protein	NA	NA	NA	NA	NA
WP_038429816.1|3747905_3749276_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015384978.1|3749300_3749978_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_017696218.1|3749991_3750798_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_038429817.1|3750887_3751421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429818.1|3751468_3752104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227432.1|3752096_3752435_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014665830.1|3752578_3753394_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3753484_3753733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429819.1|3753826_3755266_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	26.7	5.4e-21
WP_038429820.1|3755262_3756648_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_038429821.1|3756949_3757720_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227423.1|3757758_3758589_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3758628_3758931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038429822.1|3759460_3761881_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
>prophage 284
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3787248	3796845	4079669	protease	Streptococcus_phage(33.33%)	8	NA	NA
WP_038429833.1|3787248_3788436_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.2	1.5e-74
WP_038429834.1|3788556_3788937_+	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_038429835.1|3788974_3789652_-	DUF2711 domain-containing protein	NA	NA	NA	NA	NA
WP_038429837.1|3789743_3791066_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_038429838.1|3791293_3793231_+|protease	minor protease Epr	protease	A0A1B0T6A2	Bacillus_phage	34.6	1.4e-45
WP_038429840.1|3793656_3795036_+	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_015714931.1|3795089_3795932_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_014478368.1|3795984_3796845_-	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.2	3.8e-06
>prophage 285
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3806340	3809036	4079669		Tupanvirus(50.0%)	2	NA	NA
WP_038429848.1|3806340_3807852_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	29.1	3.9e-46
WP_003227327.1|3807848_3809036_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.9	5.2e-22
>prophage 286
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3819056	3823663	4079669		Tupanvirus(50.0%)	4	NA	NA
WP_038429851.1|3819056_3820700_+	catalase	NA	A0A2K9L572	Tupanvirus	45.2	4.0e-97
WP_038429852.1|3820803_3822006_+	MFS transporter	NA	NA	NA	NA	NA
WP_003243335.1|3822002_3822779_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038429853.1|3822775_3823663_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	3.4e-26
>prophage 287
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3827422	3830850	4079669		Bacillus_phage(50.0%)	2	NA	NA
WP_038429855.1|3827422_3829150_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	23.9	5.8e-22
WP_038429856.1|3829146_3830850_-	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	23.5	1.3e-13
>prophage 288
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3838190	3845257	4079669		Planktothrix_phage(33.33%)	6	NA	NA
WP_003242648.1|3838190_3839288_-	maltodextrin ABC transporter ATP-binding protein MsmX	NA	G9BWD6	Planktothrix_phage	31.2	2.4e-21
WP_038429859.1|3839408_3840302_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038429860.1|3840485_3841943_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003242615.1|3841984_3842821_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	1.0e-40
WP_038429861.1|3843270_3844200_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_038429862.1|3844234_3845257_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.1	1.9e-97
>prophage 289
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3850775	3853298	4079669		uncultured_virus(100.0%)	2	NA	NA
WP_038429866.1|3850775_3851909_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.5	2.8e-89
WP_038429867.1|3852161_3853298_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.8	5.2e-88
>prophage 290
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3860953	3863014	4079669		Tupanvirus(100.0%)	1	NA	NA
WP_038429873.1|3860953_3863014_-	catalase	NA	A0A2K9L0T1	Tupanvirus	52.5	1.0e-153
>prophage 291
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3868793	3870233	4079669		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_015250888.1|3868793_3870233_-	ATP-dependent RNA helicase DbpA	NA	A0A1B1IS59	uncultured_Mediterranean_phage	36.1	6.9e-61
>prophage 292
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3884565	3885309	4079669		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_038429885.1|3884565_3885309_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.1	2.0e-11
>prophage 293
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3896394	3897921	4079669		Catovirus(100.0%)	1	NA	NA
WP_038429895.1|3896394_3897921_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.5	3.3e-93
>prophage 294
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3903351	3904653	4079669		Geobacillus_virus(100.0%)	1	NA	NA
WP_038429900.1|3903351_3904653_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	61.5	2.7e-133
>prophage 295
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3912371	3913121	4079669		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003243284.1|3912371_3913121_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	6.0e-16
>prophage 296
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3916914	3917901	4079669		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_038429907.1|3916914_3917901_-	penicillin V amidase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	31.1	9.6e-30
>prophage 297
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3924767	3925541	4079669		Planktothrix_phage(100.0%)	1	NA	NA
WP_003243557.1|3924767_3925541_-	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	37.3	1.5e-30
>prophage 298
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3943804	3945685	4079669		Catovirus(100.0%)	1	NA	NA
WP_003243561.1|3943804_3945685_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.5	6.2e-94
>prophage 299
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3953183	3955427	4079669		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_029318573.1|3953183_3955427_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	29.4	7.1e-28
>prophage 300
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3966331	3967480	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_038429928.1|3966331_3967480_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.0	2.6e-50
>prophage 301
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3971338	3975330	4079669		Synechococcus_phage(50.0%)	3	NA	NA
WP_003243876.1|3971338_3972745_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	2.3e-32
WP_003243686.1|3973223_3973787_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003226996.1|3973800_3975330_+	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
>prophage 302
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3979229	3979859	4079669		Tupanvirus(100.0%)	1	NA	NA
WP_038429933.1|3979229_3979859_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L407	Tupanvirus	23.8	8.9e-05
>prophage 303
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3985056	3989738	4079669		Moraxella_phage(50.0%)	6	NA	NA
WP_038429936.1|3985056_3986250_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	26.7	6.4e-12
WP_038429937.1|3986246_3987083_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_038429938.1|3987149_3987629_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003219122.1|3987709_3987880_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_038429939.1|3988064_3988478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080121227.1|3988511_3989738_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	28.9	1.5e-11
>prophage 304
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	3992972	4011422	4079669	protease	Bacillus_phage(33.33%)	15	NA	NA
WP_017695778.1|3992972_3994070_+	response regulator aspartate phosphatase RapG	NA	D6R410	Bacillus_phage	39.6	2.1e-73
WP_003226961.1|3994069_3994186_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003226959.1|3994421_3995312_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
WP_003242721.1|3995384_3996788_-	amino acid permease	NA	NA	NA	NA	NA
WP_024571526.1|3997010_3998216_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.0e-29
WP_003244510.1|3998453_3999839_+	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
WP_015250812.1|4000150_4001353_-|protease	serine protease HtrC	protease	W5SAB9	Pithovirus	40.4	5.9e-13
WP_003226939.1|4001434_4002229_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.6	9.8e-41
WP_038429943.1|4002250_4003093_-	WalRK two-component regulatory system regulator WalI	NA	NA	NA	NA	NA
WP_003226936.1|4003079_4004447_-	WalRK two-component regulatory system regulator WalH	NA	NA	NA	NA	NA
WP_024572714.1|4004436_4006272_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	5.8e-36
WP_003244363.1|4006279_4006987_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	41.2	3.4e-45
WP_003226929.1|4008017_4009310_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	3.1e-68
WP_038429944.1|4009515_4009935_-	VOC family protein	NA	NA	NA	NA	NA
WP_003226923.1|4010057_4011422_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.8	3.6e-128
>prophage 305
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	4033060	4033582	4079669		Streptococcus_phage(100.0%)	1	NA	NA
WP_014481497.1|4033060_4033582_-	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	47.8	7.3e-45
>prophage 306
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	4043833	4045458	4079669		Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_038429969.1|4043833_4044592_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	46.3	1.1e-60
WP_003219224.1|4044656_4044896_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003219228.1|4044939_4045458_-	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	69.8	2.3e-51
>prophage 307
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	4050936	4054803	4079669	protease	Bacillus_virus(25.0%)	5	NA	NA
WP_003243890.1|4050936_4051554_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	32.7	2.0e-17
WP_038429972.1|4051592_4052441_-	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	38.9	2.0e-20
WP_003219244.1|4052433_4053195_-	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	31.1	6.5e-26
WP_038429973.1|4053442_4053883_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_015250778.1|4053951_4054803_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	36.7	9.5e-18
>prophage 308
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	4063599	4071120	4079669		Bacillus_virus(66.67%)	6	NA	NA
WP_003226811.1|4063599_4064736_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	32.9	1.8e-16
WP_003226810.1|4064866_4065082_+	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_038429975.1|4065097_4066210_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003219266.1|4066227_4066473_+	extracellular matrix regulator RemB	NA	NA	NA	NA	NA
WP_003226808.1|4066527_4068444_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.8	9.9e-156
WP_014475555.1|4068654_4071120_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	36.9	7.1e-114
>prophage 309
NZ_CP009796	Bacillus subtilis strain SG6, complete genome	4079669	4077574	4079041	4079669		Klosneuvirus(100.0%)	1	NA	NA
WP_003226803.1|4077574_4079041_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.9	1.9e-98
